spacer

Target Detailed View


Hit information for ENSBTAT00000008398

Gene Name LOC507620
Transcript ENSBTAT00000008398
Gene ENSBTAG00000006405
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-522 20.0118 -21.8 3.678420e-03 3.671660e-03 3.671660e-03 69 90
uGUGAGAUUUCCCUUGGUAAAa
 ::||||||||| :||:||||
cTGCTCTAAAGGAGACTATTTg
bta-miR-150 19.4586 -24.92 5.183920e-03 5.170510e-03 5.170510e-03 173 195
uGUGACCAUGUUCCCAACCCUCU
 ||:| ||||    |||||||||
tCATTTGTACTTATGTTGGGAGA
mmu-miR-669b 19.2158 -26.19 6.016980e-03 5.998910e-03 3.374340e-05 248 269
UGUACGUGUACGUGUGUUUUGA
| | |||:|||:|||:|||:||
AAAGGCATATGTACATAAAGCT
hsa-miR-622 18.4036 -20.43 1.098580e-02 1.092570e-02 1.092570e-02 119 138
cgAGGUUGGAGUCGUCUGACA
  |:|| :|| | ||||||||
tgTTCATTCTGA-CAGACTGT
hsa-miR-892a 18.1749 -17.58 9.345040e-03 9.301510e-03 9.301510e-03 11 29
gaUGCGUCUUUCCUGUGUCAC
  || ::||||  ||||||||
taACTTGGAAA--ACACAGTG
bta-miR-19a 17.8748 -12.43 1.685750e-02 3.379290e-03 4.631690e-07 216 238
agucaaAACGUAUCUAAACGUGU
      || |  | |||||||||
ttgtgaTTCCTCACATTTGCACA
hsa-miR-424 17.8514 -17.13 2.601010e-02 2.567480e-02 6.532580e-04 53 74
aaguuuuguaCUUAACGACGAc
          ||:||||||||
gtactctttgGAGTTGCTGCTc
mmu-miR-322 17.8514 -17.13 2.659600e-02 2.624540e-02 7.100800e-04 53 74
agguuuuguaCUUAACGACGAc
          ||:||||||||
gtactctttgGAGTTGCTGCTc
hsa-miR-559 17.7177 -9.13 4.398790e-02 4.303450e-02 2.039880e-05 275 295
AAAACCACGUAUAAAUGAAAU
| ||  |  |||||||:|||:
TGTTAATAAATATTTATTTTG
hsa-miR-519e 17.624 -21.46 1.400580e-02 1.400580e-02 1.400580e-02 136 158
uUGUGAGAUUUUC-CUCCGUGAa
 ::::|||:| :| |:||||||
tGTGTTCTGATGGTGGGGCACTa
hsa-miR-548c-3p 17.624 -11.28 3.654870e-02 3.588890e-02 1.753460e-03 198 218
cguuuucAUUAACUCUAAAAAC
       ||| || ||||||||
gggtataTAAGTG-GATTTTTG
bta-miR-15b 17.624 -15.92 2.717360e-02 2.717360e-02 8.455900e-03 52 74
aCAUUUGGUACUAC-ACGACGAu
 |||  |: ||: | |||||||
aGTACTCTTTGGAGTTGCTGCTc
bta-miR-455 17.6034 -16.49 1.033140e-02 1.027820e-02 1.027820e-02 238 258
cuacaucAGGUUUCCGUGUAU
       |::|||||||:||:
atttcctTTTAAAGGCATATG
mmu-miR-881 17.5103 -12.5 2.082300e-02 2.060770e-02 2.060770e-02 10 29
agaUAAGUCUUUUCUGUGUCAa
   | |::||||  |||||||
gtaACTTGGAAA--ACACAGTg
bta-miR-199a-3p 17.5103 -18.63 1.616360e-02 1.603370e-02 7.795070e-05 139 162
auuGGUUA-CACGUC-UGAUGACa
   |::|| ||| :| |||||||
gttCTGATGGTGGGGCACTACTGa
mmu-miR-466h 17.5103 -20.84 2.791630e-02 2.753020e-02 1.771250e-04 243 264
auguGUGUUCGUGUACGUGUGU
    :| |:|||:|||:|||:|
ctttTAAAGGCATATGTACATA
hsa-miR-576-3p 17.5103 -16.07 2.233350e-02 2.208600e-02 6.010730e-05 220 242
CUAAGG-UUAAAAAGGUGUAGAa
||||||  |  ||| |||||:|
GATTCCTCACATTTGCACATTTc
hsa-miR-496 17.5103 -18.78 1.557310e-02 9.495060e-04 9.495060e-04 38 59
cucuAACCGGUACAUUAUGAGu
    ||||||   ||:|||||
atttTTGGCCTCTTAGTACTCt
hsa-miR-105 17.3091 -20.95 1.982450e-02 1.962930e-02 1.962930e-02 21 43
UGGUGUCCUCAGACUCGUAAAcu
| ||||| : ||||:|:||||
AACACAGTGTTCTGGGTATTTtt
hsa-miR-206 17.2829 -18.37 3.184780e-02 3.134600e-02 1.883500e-04 224 243
GGUGUGUGAAGGAAUGUAAGGu
|| ||||:|| |  |||||:|
CCTCACATTTGC--ACATTTCc
bta-miR-497 17.2829 -13.75 4.049210e-02 3.968320e-02 6.166900e-04 54 74
AUGUUUGGUGUCACACGACGAc
|||   ::: ||| |||||||
TACTCTTTGGAGT-TGCTGCTc
hsa-miR-515-3p 17.2829 -20.21 2.248850e-02 2.223750e-02 1.750180e-02 136 158
uUGCGAGGUUUUC-UUCCGUGAg
 ::|:||::| :| ::||||||
tGTGTTCTGATGGTGGGGCACTa
mmu-miR-350 17.2829 -13.13 2.361760e-02 2.334090e-02 2.334090e-02 204 222
cuUUCACAUACCCGAAACACUu
  ||||| ||   :|||||||
atAAGTGGAT---TTTTGTGAt
hsa-miR-658 17.2594 -20.24 3.494960e-02 3.434590e-02 3.434590e-02 98 122
uGGUUGCCUGGAUGAAGGGAGGCGG
 ::||   ||:||:|| ||||:|::
tTTAAAACACTTATTTACCTCTGTT
hsa-miR-643 17.1692 -17.79 1.721620e-02 1.706880e-02 1.706880e-02 188 209
gauggaCUCGAUCGUAUGUUCA
      |||  :|:|||:||||
ttgggaGAGAGGGTATATAAGT
bta-miR-98 17.0555 -15.22 3.591690e-02 3.527950e-02 3.527950e-02 98 119
uuGUUAUGUUGAAUGAUGGAGu
  :|| ||| :|  :||||||
ttTAAAACACTTATTTACCTCt
hsa-miR-141 17.0555 -11.84 3.006740e-02 3.374040e-03 3.374040e-03 10 32
gGUAGAA-AUGGUCUGUCACAAu
 :| |||  |  | ||||||||
gTAACTTGGAAAACACAGTGTTc
hsa-miR-520a-5p 17.0319 -19.44 4.803390e-02 4.689850e-02 8.125800e-03 45 65
ucuuucAUGAAGGGAGACCUC
      || | |:||:|||||
gcctctTAGTACTCTTTGGAG
mmu-miR-692 17.0319 -16.8 4.120460e-02 4.036720e-02 4.036720e-02 63 84
CUC-ACUCCGCGAGUUUCUCUa
||| ||  || || ||:||||
GAGTTGCTGCTCTAAAGGAGAc
bta-miR-545* 17.0319 -12.69 6.014770e-02 5.837460e-02 1.654220e-02 274 294
guaGGUUAUUUGUAAAUGAcu
   ::||||||:|||||:|
atgTTAATAAATATTTATTtt
bta-miR-19b 16.9697 -12.43 2.996130e-02 3.379290e-03 4.631690e-07 216 238
agucaaaacguaccUAAACGUGU
              |||||||||
ttgtgattcctcacATTTGCACA
hsa-miR-297 16.9176 -16.16 4.830050e-02 4.715260e-02 3.208660e-03 243 263
GUACGUGUACGUGUGUAUGUA
| | :| | |||:|::|||||
CTTTTAAAGGCATATGTACAT
hsa-miR-595 16.9176 -19.29 3.013210e-02 2.968270e-02 1.181180e-02 222 242
ucuGUGUGGUGCCGUGUGAAG
   | |||  : |||||:|||
ttcCTCACATTTGCACATTTC
hsa-miR-574-5p 16.8566 -19.95 5.802840e-02 5.637690e-02 1.261910e-03 220 242
uguguGAGUGUGUGUGUGUGAGu
     ||||||: ::||||:|:
gattcCTCACATTTGCACATTTc
hsa-miR-501-5p 16.8281 -23.01 4.544790e-02 4.443060e-02 1.484390e-04 181 202
aGAGUGGGUCCCUGUUUCCUAa
 ||:|: : |||| |:|||:|
aCTTATGTTGGGAGAGAGGGTa
bta-miR-361 16.8281 -20.2 2.952800e-02 2.909630e-02 2.909630e-02 112 133
cAUGGGGACCUCUAAGACUAUU
 ||||:|||   ||||||| |:
tTACCTCTGTTCATTCTGACAG
hsa-miR-508-5p 16.7435 -18.91 4.879460e-02 4.762330e-02 1.426830e-02 45 67
guacucACUGCGGGAGACCUCAu
      | :: |:||:||||||
gcctctTAGTACTCTTTGGAGTt
bta-miR-200a 16.7435 -12.03 3.677700e-02 3.610890e-02 1.238190e-03 12 32
UUGUAGCAAUGGUCUGUCACAAu
||| | |  |  | ||||||||
AACTTGG--AAAACACAGTGTTc
hsa-miR-498 16.7435 -11.35 3.341420e-02 3.286210e-02 3.286210e-02 251 274
CUUUUUGCG-GGGGACCGAACUUU
|: | |:|: | :   ||||||||
GGCATATGTACATAAAGCTTGAAA
hsa-miR-409-5p 16.6303 -16.78 1.774410e-02 1.758760e-02 1.758760e-02 1 16
uacguuucaaCGAGCCCAUUGGA
          |:| |||||||:|
-------aaaGTTAGGGTAACTT
bta-miR-532 16.6007 -13.21 3.073480e-02 3.026730e-02 3.026730e-02 235 256
ugccAGGAUGUGAGUUCCGUAc
    |::  : :| |||||||
cacaTTTCCTTTTAAAGGCATa
hsa-miR-454 16.5172 -13.5 4.949540e-02 4.829050e-02 4.829050e-02 162 184
UGGGAUAUUCGUUAUAACGUGAu
|:|:|: | ||    |||:|||
ATCTTGAATGCTCATTTGTACTt
mmu-miR-467e 16.487 -9.42 6.312440e-02 1.206250e-04 2.791320e-05 90 111
uguauauguacgagUGUGAAUA
              ||||||||
gaaagagttttaaaACACTTAT
bta-miR-106 16.487 -11.7 5.499880e-02 5.351370e-02 2.321230e-02 22 43
augGACGUGACAUUCGUGAAAA
   | |:::| |::|:|:||||
acaCAGTGTTCTGGGTATTTTT
hsa-miR-648 16.4196 -16.53 3.923440e-02 3.847470e-02 1.084920e-05 223 241
uggucacgGGACGUGUGAA
        ::||||||:||
tcctcacaTTTGCACATTT
hsa-miR-496 16.3733 -11.86 4.422360e-02 9.495060e-04 9.495060e-04 155 175
cucUAACCGGUACAUUAUGAGU
   | || :| || |||:||||
actACTGATCTTG-AATGCTCA
hsa-miR-196b 16.3733 -19.94 5.542460e-02 1.847600e-03 7.273030e-04 69 90
ggguuGUUGUCCUUUGAUGGAU
     | | ||||:||||::|:
ctgctCTAAAGGAGACTATTTG
hsa-miR-338-3p 16.3733 -16.72 5.948450e-02 5.774990e-02 2.305410e-03 171 192
guuguuuuaGUGACUACGACCU
         :||| |||:|||:
gctcatttgTACTTATGTTGGG
bta-miR-16 16.346 -12.22 6.839660e-02 6.611000e-02 5.422150e-04 52 74
cgGUUAUAAA--UGCACGACGAu
  :| | |||  |  |||||||
agTACTCTTTGGAGTTGCTGCTc
hsa-miR-891b 16.2596 -15.07 3.796160e-02 3.725010e-02 1.387570e-03 50 70
AGUUACUGAGUCCAUUCAACGu
|:|:| ||||    :||||||
TTAGT-ACTCTTTGGAGTTGCt
hsa-miR-196b 16.2596 -17.24 6.205530e-02 1.847600e-03 7.273030e-04 141 162
GGGUUGUUGUCCUUUGAUGGau
:|::|:::::||: |||||:
TCTGATGGTGGGGCACTACTga
hsa-miR-1 16.2596 -8.67 7.865750e-02 7.564350e-02 3.351900e-05 221 243
UAUGUA-UGAAGAAAUGUAAGGu
|| | | || |:|  |||||:|
ATTCCTCACATTTGCACATTTCc
bta-miR-195 16.2596 -13.93 7.573720e-02 7.294020e-02 9.082050e-04 48 74
ACGGUUAU-AAAGAC----ACGACGAu
| ::|:|| | |:||    |||||||
TCTTAGTACTCTTTGGAGTTGCTGCTc
mmu-miR-684 16.1883 -8.42 9.167060e-02 8.759440e-02 7.672770e-03 6 24
aacugaacuucCCUUUUGa
           |||||||
tagggtaacttGGAAAACa
bta-miR-19b 16.1778 -9.48 5.686230e-02 3.379290e-03 4.631690e-07 159 183
aGUCAAAACGUAC--CUAAACGUGu
 :: | ||| |||   |||||:||
cTGATCTTGAATGCTCATTTGTACt
hsa-miR-299-3p 16.1459 -18 5.577160e-02 5.424490e-02 1.021580e-02 206 232
UUCGCC---AAAUGGUA--GGGUGUAu
|||:||   |||:: ||  |:|||||
AAGTGGATTTTTGTGATTCCTCACATt
bta-miR-26a 16.1459 -12.03 5.688970e-02 5.688970e-02 2.041730e-03 71 92
ucGGAUAGGACCUAAUGAACUU
  :|||     || ||:|||||
gcTCTAAAGGAGACTATTTGAA
bta-miR-15a 16.1174 -12.22 8.804120e-02 8.427690e-02 8.455900e-03 53 74
UGUUUGGUAAUAC-ACGACGAu
::|  |: | : | |||||||
GTACTCTTTGGAGTTGCTGCTc
mmu-miR-467e 16.0322 -13.87 9.127970e-02 1.206250e-04 2.791320e-05 214 235
uguAUAUGUACGAGUGUGAAUa
   |:|:  | ||||||:||:
tttTGTGATTCCTCACATTTGc
bta-miR-19a 15.8384 -9.38 8.455220e-02 3.379290e-03 4.631690e-07 159 183
aGUCAAAACGUAU--CUAAACGUGu
 :: | ||| ||:   |||||:||
cTGATCTTGAATGCTCATTTGTACt
bta-miR-26b 15.8047 -10.4 9.856540e-02 9.386360e-02 2.041730e-03 71 92
uuGGAUAGGACUUAAUGAACUU
  :|||     :| ||:|||||
gcTCTAAAGGAGACTATTTGAA
hsa-miR-141 15.8047 -18.12 8.448450e-02 3.374040e-03 3.374040e-03 122 142
GGUAGAAAUGGUCUGUCACAAu
:||| | |: ||||| |||||
TCAT-TCTGACAGACTGTGTTc
hsa-miR-184 15.8047 -18.57 6.903880e-02 6.670950e-02 4.450160e-03 104 124
UGGGAAUAGUCAAGAGGCAGGU
|| |||||:    |||:||:||
ACACTTATT-TACCTCTGTTCA
hsa-miR-938 15.8047 -13.12 4.745290e-02 4.634460e-02 2.818010e-03 233 254
ugacccAAGUGGAAAUUCCCGU
      ||: |:||||| ||||
tgcacaTTTCCTTTTAAAGGCA
hsa-miR-619 15.7625 -18.57 9.507070e-02 9.069140e-02 9.141110e-03 13 38
UGACCCGUGUUUGU-AC-AGGUCCAg
||| || | | ||| || ||::|||
ACTTGGAAAACACAGTGTTCTGGGTa
bta-miR-365 15.4636 -8.65 4.266440e-02 4.176710e-02 4.176710e-02 20 41
uauuccUAAAAAUCCCCGUAAu
      | | ||  |||:|||
aaacacAGTGTTCTGGGTATTt
mmu-miR-467b 15.4316 -9.99 9.186440e-02 1.206250e-04 2.791320e-05 166 186
GUAUAUGUACGUCCGUGAAUG
:: ||:|   :  |:|||||:
TGAATGCTCATTTGTACTTAT
hsa-miR-610 15.4316 -11.25 9.810170e-02 9.344330e-02 1.117270e-02 99 119
AGGGUCGUGUGUAAAUCGAGu
|:  | ||| :||||| |||
TTAAAACACTTATTTACCTCt
hsa-miR-887 15.2362 -13.55 5.128320e-02 4.999040e-02 4.999040e-02 104 125
ggagcccuaccGCGGGCAAGUG
           | :|:|||||:
acacttatttaCCTCTGTTCAT
hsa-miR-371-3p 14.9333 -21.42 8.495900e-02 8.145010e-02 1.754130e-06 137 158
UGUGAGUUUUCUACCGCCGUGAa
::::|| :| |:| | ||||||
GTGTTCTGATGGT-GGGGCACTa
mmu-miR-467d 14.8951 -13.15 8.680090e-02 1.206250e-04 2.791320e-05 164 185
GCGUAUAUGUACGCGCGUGAAU
| :: ||:|   : :|:|||||
CTTGAATGCTCATTTGTACTTA
Features
AFFY_Bovine Bt.18229.1.A1_at
EntrezGene 507620
RefSeq_dna_predicted XM_584266
RefSeq_peptide_predicted XP_584266
UniGene Bt.51708
spacer
spacer