spacer

Target Detailed View


Hit information for ENSBTAT00000008314

Gene Name LOC540350
Transcript ENSBTAT00000008314
Gene ENSBTAG00000006338
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-921 17.4712 -30.44 1.641000e-02 1.627610e-02 1.183120e-03 253 280
CUUAGGA-CCAAGACAG--GGAGUGAUC
||: |:| || |||||:   ||||||||
GAGACTTGGGGTCTGTTGAGCTCACTAG
bta-let-7i 17.3904 -20.29 2.700840e-02 2.700840e-02 6.126750e-03 508 529
UUGUCGUGUUUGAUGAUGGAGU
| || || ::|| |:|||||||
ATCAACAGGGACCATTACCTCA
hsa-miR-421 17.0995 -16.25 2.319390e-02 2.292700e-02 1.479020e-03 250 272
cgcgggUUAAUUACAGACAACUa
      | ||:: |||||||||
gaggagACTTGGGGTCTGTTGAg
hsa-miR-512-3p 16.9689 -22.66 3.244770e-02 3.192690e-02 3.192690e-02 230 250
cuGGAGUCGAUACUGUCGUGAa
  :|||||  | |:|||||||
ctTCTCAGGCA-GGCAGCACTg
bta-miR-345 16.9465 -21.98 3.361390e-02 3.305520e-02 3.305520e-02 543 563
ucGUGACCUGAUCCUCAGUCg
  || | | : |||||||||
taCAGTAGCTGAGGAGTCAGa
bta-miR-10a 16.8897 -25.45 2.140840e-02 2.140840e-02 2.140840e-02 498 519
GUGUUUAAGCCUAGAUGUCCCau
|:||:|||: |||| ||||||
CGCAGATTT-GATCAACAGGGac
mmu-miR-466h 16.7581 -19.41 5.260570e-02 5.260570e-02 2.831880e-04 117 138
AUGUGUGUU-CGUGUACGUGUGU
| | || || |||: ||||||||
TTCCCAGAATGCAT-TGCACACA
mmu-miR-719 16.7581 -18.58 1.838360e-02 1.821570e-02 7.849210e-03 536 557
UUGUAAAAAGACAUCGGCUCUa
:||| ||| | |||||:|||:
GACACTTTACAGTAGCTGAGGa
hsa-miR-146a 16.6527 -17.18 4.725370e-02 4.725370e-02 4.725370e-02 161 182
UUGGGUACCUUAAGUCAAGAGu
|| || || ||  |:||||||
AAACCTTGCAACCCGGTTCTCc
hsa-miR-520e 16.6288 -22.5 4.939340e-02 4.939340e-02 1.154420e-02 231 251
GGGAGUUUUUCCUUCGUGAaa
::||||:: ||| ||||||
TTCTCAGGCAGGCAGCACTga
bta-let-7b 16.5473 -21.63 7.066670e-02 6.822760e-02 6.126750e-03 508 529
UUGGUGUGUUGGAUGAUGGAGU
| | ||| :: | |:|||||||
ATCAACAGGGACCATTACCTCA
mmu-miR-466d-5p 16.5473 -20.72 5.555930e-02 5.404410e-02 2.831880e-04 118 140
guacaugUACAU-GCGUGUGUGU
       ||| | :|||||||||
tcccagaATGCATTGCACACACA
hsa-miR-671-5p 16.3652 -24.19 9.398170e-02 8.970060e-02 3.378140e-02 215 235
GAGGUCGGGGAGGUCCCGAAGGa
|||::|| |||::  ||||||:
CTCTGGCACCTTT--GGCTTCTc
bta-miR-19b 16.3652 -14.55 4.890440e-02 4.890440e-02 1.776220e-06 61 83
agucaaaacGUACCUAAACGUGU
         :| | |||||||||
tctccccctTAGGAATTTGCACA
hsa-miR-367 16.2311 -16.38 3.867220e-02 3.793400e-02 3.793400e-02 189 210
agugguAACGAUUUCACGUUAa
      |||| ::||||||:|
cctgacTTGCGGGAGTGCAGTg
bta-miR-25 16.2311 -20.59 3.812230e-02 3.740480e-02 3.740480e-02 189 210
aGUCUGGCUCUGUUCACGUUAC
 | |||: : : :||||||:||
cCTGACTTGCGGGAGTGCAGTG
hsa-miR-220b 16.2051 -21.32 5.118130e-02 4.989360e-02 1.007600e-03 300 322
UUCACAGUCUG-UG-CCACCACC
|: || :| :| || ||||||||
AGATGCTATGCAACAGGTGGTGG
bta-miR-10b 16.0505 -22.82 3.840410e-02 3.767600e-02 3.767600e-02 498 519
GUGUUUAAGCCAAGAUGUCCCau
|:||:|||: | || ||||||
CGCAGATTT-GATCAACAGGGac
bta-miR-19a 16.0505 -12.32 7.170880e-02 6.919810e-02 1.776220e-06 61 83
agucaaaacGUAUCUAAACGUGU
         :| : |||||||||
tctccccctTAGGAATTTGCACA
hsa-miR-224 15.9933 -20.52 7.077230e-02 6.832600e-02 4.668440e-03 196 215
uUGCCUUGGUGAUCACUGAAc
 :|||:| ::| ||||:|||
tGCGGGAGTGC-AGTGGCTTc
hsa-miR-597 15.8095 -11.96 5.219310e-02 1.591550e-03 1.591550e-03 577 598
ugucaccaGUAGCUCACUGUGu
        ::|: :|||||||
tattcccaTGTTAGGTGACACc
hsa-miR-520b 15.7815 -17.48 9.998820e-02 9.515190e-02 1.154420e-02 231 251
GGGAGAUUUUCCUUCGUGAaa
::||| :: ||| ||||||
TTCTCAGGCAGGCAGCACTga
hsa-miR-648 15.7365 -17.39 7.441210e-02 7.171090e-02 1.541980e-05 68 86
uGGUCACGGGACGUGUGAA
 ::||   ::||||||:||
cTTAGGAATTTGCACATTT
hsa-miR-597 15.7041 -19.35 5.750820e-02 1.591550e-03 1.591550e-03 398 419
uGUCACCAGUAGCUCACUGUGu
 ::|||  : | |:|||||:|
cTGGTGTCTCTGGGGTGACGCt
hsa-miR-197 15.7041 -18.82 7.428780e-02 7.159550e-02 2.502080e-03 302 323
cgacccACCUCUUCCACCACUU
      || |  ||||||||:|
atgctaTGCAACAGGTGGTGGA
hsa-miR-153 15.4933 -13.02 8.001990e-02 7.690200e-02 2.721090e-02 291 312
cuagugaaaacacUGAUACGUU
             :||||||||
aagcctgacagatGCTATGCAA
Features
EntrezGene 540350
GO GO:0005515
RefSeq_dna_predicted XM_593398
RefSeq_peptide_predicted XP_593398
spacer
spacer