spacer

Target Detailed View


Hit information for ENSBTAT00000007689

Gene Name LOC540856
Transcript ENSBTAT00000007689
Gene ENSBTAG00000005848
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
gga-miR-757 18.6845 -23.73 1.113430e-02 1.107250e-02 1.291460e-06 436 457
CUUA-GGGUAGACGUCGAGACg
|||| :::||||| |||||||
GAATGTTTATCTGAAGCTCTGa
bta-miR-181c 18.1093 -19.03 1.113400e-02 1.113400e-02 1.926660e-05 144 165
UUUGAGUGGCUGUCCAACUUACAA
||:|||||  ::|  |||||||||
AAGCTCAC--GTATTTTGAATGTT
bta-let-7g 18.0645 -21.33 1.250580e-02 2.215410e-03 2.005530e-06 253 275
uuGACAUGUUUGAU-GAUGGAGU
  || |:| :|||| ||||||||
ccCTTTGCTGACTATCTACCTCA
bta-miR-98 17.642 -21.73 2.001760e-02 1.280760e-03 3.457330e-05 295 317
uUGUUAUGUUGAA-UGAUGGAGU
 | || ||||||| ::|||||||
cAGAAGACAACTTGGTTACCTCA
bta-let-7e 17.5168 -21.45 2.729570e-02 2.215410e-03 2.005530e-06 254 275
uGAUAUG-UUGGAGGAUGGAGU
 || |:| :||: :||||||||
cCTTTGCTGACTATCTACCTCA
hsa-miR-190 17.325 -14.06 3.741100e-02 3.741100e-02 5.246450e-04 204 224
UGGAUUAUAUAGUUUGUAUAGU
||: :|| ||| |||:||||||
ACTGGAT-TATAAAATATATCA
mmu-miR-466f-3p 17.3044 -24.51 2.950000e-02 3.854740e-03 3.366900e-04 384 405
cacACAUACACA-CACACAUAC
   |||||||||  |||||:||
tgcTGTATGTGTCATGTGTGTG
bta-let-7a 17.2194 -19.83 3.212470e-02 2.215410e-03 2.005530e-06 253 275
uuGAUAUGUUGGAU-GAUGGAGU
  || |:| : ||| ||||||||
ccCTTTGCTGACTATCTACCTCA
bta-let-7f 17.2194 -18.76 2.946580e-02 2.215410e-03 2.005530e-06 253 275
uuGAUAUGUUAGAU-GAUGGAGU
  || |:| : ||| ||||||||
ccCTTTGCTGACTATCTACCTCA
hsa-miR-505 17.1138 -18.61 1.866920e-02 1.849600e-02 1.849600e-02 541 563
UCCUUUGGUCGUUC-ACAACUGc
| ||:|  ||:::| |||||||
AAGAGAAAAGTGGGCTGTTGACt
hsa-miR-190b 17.0921 -13.68 4.069170e-02 3.987490e-02 5.246450e-04 203 224
UUGGGUU-AUAGUUUGUAUAGU
:||: :| ||| |||:||||||
GACTGGATTATAAAATATATCA
mmu-miR-464 17.0338 -18.53 2.693410e-02 2.657460e-02 2.657460e-02 288 311
auagaGUGUCUUAU-UUGAACCAu
     | ||||| | ||||||||
gcaaaCTCAGAAGACAACTTGGTt
bta-let-7i 17.0081 -19.14 3.966910e-02 2.215410e-03 2.005530e-06 253 275
uugucGUGUUUGAU-GAUGGAGU
     ::| :|||| ||||||||
cccttTGCTGACTATCTACCTCA
bta-let-7d 17.0081 -19.18 3.717860e-02 2.215410e-03 2.005530e-06 253 275
uuGAUACGUUGGAU-GAUGGAGa
  || ||| : ||| |||||||
ccCTTTGCTGACTATCTACCTCa
mmu-miR-344 16.9286 -26.55 1.294150e-02 1.285810e-02 5.210130e-04 188 212
UGUCAG-UCCG-AAACCGAUCUAGU
|||||| |||: |||| ||:|||:|
ACAGTCAAGGTGTTTGACTGGATTA
hsa-miR-543 16.9025 -13.1 2.381930e-02 8.586110e-04 8.536040e-05 145 166
uucuucaCGUGGCGCUUACAAA
       |:|:: :||||||||
agctcacGTATTTTGAATGTTT
bta-let-7c 16.9025 -20.4 4.635920e-02 2.215410e-03 2.005530e-06 253 275
uuGGUAUGUUGGAU-GAUGGAGU
  |: |:| : ||| ||||||||
ccCTTTGCTGACTATCTACCTCA
bta-miR-181a 16.8532 -17.36 3.336380e-02 3.336380e-02 1.926660e-05 145 165
UUGAGUGGCUGUCGCAACUUACAA
|:|||||  ::| : |||||||||
AGCTCAC--GTA-TTTTGAATGTT
mmu-miR-878-5p 16.7968 -18.19 2.561700e-02 1.213360e-05 1.213360e-05 190 211
aCAGAACUGUAGGUUGAUCUAu
 |||  |:::|:::|||:|||
aGTCAAGGTGTTTGACTGGATt
hsa-miR-511 16.7736 -12.95 6.618430e-02 6.404170e-02 1.066020e-02 170 191
ACUGACGUCUCG-UUUUCUGUg
|| | |||  |: ||||||||
TGTCAGCAATGTGAAAAGACAg
mmu-miR-350 16.6912 -12.37 3.774760e-02 3.704400e-02 1.794680e-03 55 76
CUUUCACAUACCCGAAACACUU
|::||   | |  :||||||||
GGGAGCCAAAGCCTTTTGTGAA
bta-miR-98 16.6912 -18.62 5.148560e-02 1.280760e-03 3.457330e-05 254 275
uuguuauGUUGAAUGAUGGAGU
       ::|||  ||||||||
cctttgcTGACTATCTACCTCA
hsa-miR-768-3p 16.6886 -21.67 2.564400e-02 2.531800e-02 5.274820e-04 156 183
cagucguCAAACUCACAGUCGUAACACU
       |||| | |||||||| |||||
tttgaatGTTTCATTGTCAGCAATGTGA
hsa-miR-577 16.6675 -11.71 8.966690e-02 8.576430e-02 2.917620e-02 429 448
GUCCAUGGUUAUAAAAUAGAU
:: |||  |||: |||||||:
TGAGTAAGAATG-TTTATCTG
bta-miR-30b 16.5856 -15.68 3.957250e-02 3.957250e-02 2.314060e-04 426 446
UCGACUCACAUCCUACAAAUGu
|| |||||  || |||||||:
AGGTGAGT-AAGAATGTTTATc
bta-let-7a 16.5856 -20.71 6.003390e-02 2.215410e-03 2.005530e-06 295 317
uugaUAUGUUGGA-UGAUGGAGU
    | |||||:| ::|||||||
cagaAGACAACTTGGTTACCTCA
bta-let-7c 16.5856 -20.71 6.329650e-02 2.215410e-03 2.005530e-06 295 317
uuggUAUGUUGGA-UGAUGGAGU
    | |||||:| ::|||||||
cagaAGACAACTTGGTTACCTCA
bta-let-7b 16.5856 -18.61 6.808800e-02 2.215410e-03 2.005530e-06 253 275
uuGGUGUGUUGGAU-GAUGGAGU
  |: ::| : ||| ||||||||
ccCTTTGCTGACTATCTACCTCA
bta-let-7b 16.5856 -20.99 6.808800e-02 2.215410e-03 2.005530e-06 295 317
uuggUGUGUUGGA-UGAUGGAGU
    | |||||:| ::|||||||
cagaAGACAACTTGGTTACCTCA
hsa-miR-640 16.5613 -21.35 2.861180e-02 1.235450e-03 1.235450e-03 483 504
ucucCGU-CCAAGGACCUAGUA
    ||| ||  ::||||||||
ctttGCATGGGGTTTGGATCAT
bta-miR-23b 16.508 -14.41 4.565640e-02 4.565640e-02 5.372580e-04 162 184
caccAUUAGGGACCGUUACACUa
    | ||: :  |||||||||
tgttTCATTGTCAGCAATGTGAa
mmu-miR-878-3p 16.4799 -18.22 2.558510e-02 1.213360e-05 1.213360e-05 378 400
AGAUGGGUCACA-CCACAGUACG
|: | ::: |||  ||||||||:
TTCAGTTGCTGTATGTGTCATGT
hsa-miR-377 16.4799 -15.19 4.844750e-02 4.729260e-02 2.024470e-02 386 407
uGUUUUCAACGGAAACACACUA
 :: | ||  | | ||||||||
cTGTATGTGTCATGTGTGTGAT
mmu-miR-883a-5p 16.3743 -17.26 6.538290e-02 6.329130e-02 1.682790e-04 321 342
CAUUGACGAUGAAGAGAGUCGu
|| :: |: ::|  |||||||
GTTGTGGTAGTTGATCTCAGCt
hsa-miR-494 16.3743 -11.24 5.550520e-02 5.399290e-02 9.067860e-05 147 168
cuccaaAGGGCACAUACAAAGU
      | :: || ||||||||
ctcacgTATTTTGAATGTTTCA
bta-miR-23a 16.3743 -14.42 5.444480e-02 5.298920e-02 5.372580e-04 163 184
accuuUAGGGACCGUUACACUa
     ||: :  |||||||||
gtttcATTGTCAGCAATGTGAa
hsa-miR-337-3p 16.3743 -19.38 3.385800e-02 3.329120e-02 1.157410e-04 405 426
CUUCUUUCCGUAGUAUAUCCuc
||   |||| :|||||||||
GATCCAAGGAGTCATATAGGta
hsa-miR-543 16.2686 -13.55 4.202290e-02 8.586110e-04 8.536040e-05 423 443
UUCUUCACGUGGCGCUUACAAA
:: |:||| | :  ||||||||
GGTAGGTG-AGTAAGAATGTTT
bta-miR-204 16.2686 -19.74 9.491180e-02 9.054690e-02 3.154570e-02 220 239
uccGUAUCCUACUGUUUCCCUU
   ||  |||  :|||||||||
tatCACTGGA--GCAAAGGGAA
mmu-miR-878-5p 16.2686 -22.28 4.219780e-02 1.213360e-05 1.213360e-05 85 106
ACAGAACUGUAGGUUGAUCUAU
| |||||::|||: |:|:|:||
TATCTTGGTATCTTATTGGGTA
hsa-miR-518a-5p 16.2207 -14.68 6.769130e-02 3.699350e-03 3.209540e-04 471 490
cUUUCCCGAAGGGAAACGUc
 ||:   ||  ||||||||
cAAGAAACTGACCTTTGCAt
hsa-miR-491-3p 16.163 -13.16 4.199970e-02 4.112990e-02 4.112990e-02 324 349
CAUCUUCCCUUAGA----ACGUAUUc
||:| ||  :||||    |||||||
GTGGTAGTTGATCTCAGCTGCATAAa
bta-miR-181b 16.1561 -16.98 8.251330e-02 7.920080e-02 1.926660e-05 144 165
UUUGGGUGGCUGUCGUUACUUACAA
||:|:|||  ::| :  ||||||||
AAGCTCAC--GTA-TTTTGAATGTT
hsa-miR-453 15.9823 -18.64 6.767680e-02 6.543750e-02 4.988470e-03 287 307
aCGCUUGAGUGGUGCCUGUUGGA
 || ||||||  |  ||||||:|
gGCAAACTCAGAA--GACAACTT
hsa-miR-640 15.9243 -17.17 5.055110e-02 1.235450e-03 1.235450e-03 193 213
ucUCCGUCCAAGGACCUAGUA
  |||::  |  ||||||:||
caAGGTGTTTGACTGGATTAT
bta-miR-487a 15.8182 -18.87 4.791850e-02 4.678850e-02 2.333220e-02 385 408
UGACCUACAGGG---ACAUACUAa
:||| |||| :|   |||:||||
GCTGTATGTGTCATGTGTGTGATc
mmu-miR-466a-3p 15.772 -14.15 8.959620e-02 3.854740e-03 3.366900e-04 376 396
AGAAUACACACGCACAUACAUAu
|:||  || ||| |||||||:|
TTTTCAGT-TGC-TGTATGTGTc
mmu-miR-466b-3-3p 15.772 -14.41 9.048190e-02 3.854740e-03 3.366900e-04 376 396
AGAAUACACACGCACAUACAUAa
|:||  || ||| |||||||:|
TTTTCAGT-TGC-TGTATGTGTc
hsa-miR-219-5p 15.6058 -14.79 4.571300e-02 4.468390e-02 1.731600e-02 174 194
UCUUAACGCAAACCUGUUAGU
|| | ||:|    ||||:|||
AGCAATGTGAAAAGACAGTCA
bta-miR-30c 15.5617 -12.58 8.502730e-02 8.151280e-02 2.314060e-04 423 446
CGACUCUCACA-UCCUACAAAUGu
| | :| | || || |||||||:
GGTAGGTGAGTAAGAATGTTTATc
hsa-miR-379 15.4997 -18.66 7.604880e-02 7.322900e-02 2.312780e-03 263 283
gGAUGCAAGGUAUCAGAUGGU
 |||: | ||  |||:|:|||
aCTATCTACCTCAGTTTGCCA
hsa-miR-518c 15.4566 -19.52 6.270960e-02 3.699350e-03 3.209540e-04 353 375
ugUGAGAUUUCUCUUCGCGAAAC
  |: ||    || ||||:||||
tgATACTTCCTAGTAGCGTTTTG
hsa-miR-628-5p 15.4235 -12 8.918130e-02 8.532030e-02 2.576370e-03 158 178
ggagAUCAUUUAUACAGUCGUa
    |: |  || ||||||||
tgaaTGTTTCAT-TGTCAGCAa
hsa-miR-183 15.3179 -13.56 9.401490e-02 8.973080e-02 1.464950e-03 377 399
ucACUUAA-GAUGGUCACGGUAU
  | |:|| ||::  |||:|||:
ttTCAGTTGCTGTATGTGTCATG
bta-miR-380-5p 15.1066 -14.3 7.654160e-02 7.368560e-02 4.112110e-04 157 178
cGCGUACAAGAUACCAGUUGgu
 :| |||||: || ||||:|
tTGAATGTTTCATTGTCAGCaa
hsa-miR-518d-3p 14.8627 -20.68 8.858370e-02 3.699350e-03 3.209540e-04 355 375
cgagguuuccCUUCGCGAAAC
          | ||||:||||
atacttcctaGTAGCGTTTTG
hsa-miR-518b 14.7897 -17.83 8.113310e-02 3.699350e-03 3.209540e-04 354 375
uggagauuuccCCUCGCGAAAC
           | ||||:||||
gatacttcctaGTAGCGTTTTG
hsa-miR-891a 14.684 -14.23 6.777640e-02 6.553060e-02 4.294260e-03 306 326
AGUC-ACCGAGUCCAAGCAACGU
|::| |  ||||  |||||||::
TTGGTTACCTCA--TTCGTTGTG
bta-miR-425-5p 14.684 -14.87 8.392850e-02 8.050300e-02 6.863200e-04 379 398
AGUUGCCCUCACUAGCACAGUA
|||:: |  || | :|||||||
TCAGTTGCTGT-A-TGTGTCAT
Features
EntrezGene 540856
RefSeq_dna_predicted XM_613448
RefSeq_peptide_predicted XP_613448
spacer
spacer