spacer

Target Detailed View


Hit information for ENSBTAT00000006586

Gene Name Q3T105_BOVIN
Transcript ENSBTAT00000006586
Gene ENSBTAG00000005002
Description GALE protein (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q3T105]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-512-5p 18.9411 -29.37 6.116570e-03 6.097900e-03 6.097900e-03 191 213
cuuucacGGGAGUUCCGACUCAC
       ||  ||||||||||||
atgcagaCCACCAAGGCTGAGTG
hsa-miR-326 18.3316 -29.78 2.166200e-02 2.142910e-02 2.173120e-03 65 84
gaccucCUUCCCGGGUCUCC
      |::|| ||||||||
gaacctGGGGGCCCCAGAGG
bta-let-7b 18.1348 -21.95 1.471730e-02 1.471730e-02 2.131520e-08 76 97
uuGGUGUGUUGGAUGAUGGAGU
  ||| | : :| :|||||||:
ccCCAGAGGCTCCGCTACCTCG
hsa-miR-187 18.1348 -18.71 8.484880e-03 8.448990e-03 8.448990e-03 217 238
GGCCGACGUUGUGUUCUGUGCu
:| || | : | :||||||||
TCAGCAGAGCCTTAAGACACGc
bta-let-7c 18.1348 -21.94 1.356910e-02 1.356910e-02 2.131520e-08 76 97
uuGGUAUGUUGGAUGAUGGAGU
  ||| | : :| :|||||||:
ccCCAGAGGCTCCGCTACCTCG
hsa-miR-769-5p 17.9096 -25.37 1.600150e-02 3.640260e-03 2.388130e-04 127 146
UCGAGUCUUGGGUCUCCAGAGu
:|| |||:: ||| |||||||
GGCACAGGG-CCA-AGGTCTCc
hsa-miR-615-5p 17.7969 -28.87 3.873790e-02 3.778500e-03 3.262430e-07 83 104
CUAGGCUCGUGGCCCCUGGGGg
|: :| : :|||  |||||||
GGCTCCGCTACCTCGGACCCCa
hsa-miR-760 17.7623 -28 4.670340e-02 4.562960e-02 2.838120e-04 119 138
aGGGGUGUCUGGGUCUCGGc
 |||  |||:| |||:|||
gCCCGCCAGGCACAGGGCCa
bta-let-7f 17.5716 -15.65 2.071930e-02 2.071930e-02 2.131520e-08 76 97
uuGAUAUGUUAGAUGAUGGAGU
  | | | : || :|||||||:
ccCCAGAGGCTCCGCTACCTCG
hsa-miR-452 17.5716 -11.21 1.995810e-02 1.976030e-02 1.976030e-02 290 311
agUCAAAGGAGACGUUUGUCAA
  ||| |::    :||||||||
aaAGTATTTAAAATAAACAGTT
bta-let-7i 17.5716 -21.05 2.249210e-02 2.249210e-02 2.131520e-08 74 97
UUGUCGUGUUUGA--UGAUGGAGU
::|  || |::||  :|||||||:
GGCCCCAGAGGCTCCGCTACCTCG
bta-miR-199b 17.372 -19.06 2.281880e-02 2.281880e-02 2.794460e-04 300 324
cUUGUCUAUCAGA--UUUGUGACCc
 ||:| | |||:|    |||||||
aAATAAACAGTTTTCTTACACTGGa
hsa-miR-628-5p 17.3464 -17.52 1.568000e-02 1.555770e-02 1.555770e-02 201 223
ggagaucAUUUA-UACAGUCGUa
       |:|:| :||||||||
ccaaggcTGAGTGGTGTCAGCAg
hsa-miR-146b-3p 17.2337 -29.52 3.525290e-02 2.363590e-03 7.098210e-04 159 181
GGUCUUGACUCA-GGUGUCCCgu
:|:|: ||| || ||||||||
TCGGGTCTGTGTGCCACAGGGgc
bta-let-7a 17.2337 -18.61 3.167090e-02 3.167090e-02 2.131520e-08 76 97
uuGAUAUGUUGGAUGAUGGAGU
  | | | : :| :|||||||:
ccCCAGAGGCTCCGCTACCTCG
hsa-miR-323-5p 17.2337 -22.31 2.724490e-02 3.805050e-03 5.476000e-04 183 203
cgCUUGCGCGGUGCCUGGUGGa
  |||| |  ::| |||||||
agGAAC-CCATGCAGACCACCa
hsa-miR-661 17.178 -27.58 7.049580e-02 4.196070e-03 3.277130e-05 235 259
UGC-GCGUCCGGUCUCUGGGUCCGU
||| || || ||     |||||||:
ACGCCGAAGCCCCTCCTCCCAGGCG
bta-miR-199a-5p 17.1211 -17.55 2.433620e-02 2.404250e-02 2.794460e-04 305 324
UUGUCCAUCAGACUUGUGACCc
|||| ||  |||  |||||||
AACA-GTTTTCT-TACACTGGa
hsa-miR-550 17.0358 -20.34 3.115660e-02 1.235390e-03 2.461330e-07 110 132
cccGAGAAUGAGGGAGUCCGUGa
   | || |  ||  |||||||
gtcCACTGAGCCCGCCAGGCACa
hsa-miR-942 17.0084 -16.89 8.484590e-02 8.134620e-02 1.076290e-02 16 37
guguaccggUUUUGUCUCUUCu
         ||:: |||||||
ggaccagaaAAGGGAGAGAAGc
mmu-miR-343 16.9653 -17.19 5.280540e-02 5.143540e-02 2.645600e-03 13 32
aGACCCGUGUACUUCCCUCU
 | || |  :  ||||||||
cCCGGACCAGAAAAGGGAGA
mmu-miR-763 16.8958 -25.71 4.524730e-02 4.423890e-02 8.785200e-04 88 109
cggugaccaagaaGGGUCGACC
             |||||||||
cgctacctcggacCCCAGCTGG
bta-miR-24 16.8958 -22.39 5.400530e-02 5.257290e-02 2.763910e-03 101 122
gacaaGGACGACUUGACUCGGu
     |: | |  ||||||||
cccagCTGGGTCCACTGAGCCc
mmu-miR-764-3p 16.7832 -18.3 6.148100e-02 5.962920e-02 9.440010e-04 1 14
ugucaacggUGAUACCGGAGGa
         ||  ||||||||
--------gACCCTGGCCTCCc
bta-let-7e 16.7583 -17.84 5.650730e-02 5.650730e-02 2.131520e-08 77 97
uGAUAUGUUGGAGGAUGGAGU
 | | | : :|  |||||||:
cCCAGAGGCTCCGCTACCTCG
hsa-miR-661 16.7318 -29.41 9.452940e-02 4.196070e-03 3.277130e-05 172 195
uGCGCGUCCGGUCUCUGGGUCCGU
 | |  :||||||: ||||| |||
cCACAGGGGCCAGGAACCCATGCA
bta-let-7g 16.6705 -17.73 5.101030e-02 5.101030e-02 2.131520e-08 74 97
uugacaUGUUUGA--UGAUGGAGU
      | |::||  :|||||||:
ggccccAGAGGCTCCGCTACCTCG
hsa-miR-615-5p 16.5579 -30.54 8.955510e-02 3.778500e-03 3.262430e-07 58 80
cuagGCUCGUGG-CCCCUGGGGg
    | :| ||| ||||:||||
ctggCAGGAACCTGGGGGCCCCa
hsa-miR-550 16.4754 -22.04 5.054990e-02 1.235390e-03 2.461330e-07 241 261
ccCGAGAAUGAGGGAGUCCGUGA
  || | | ||||  |||||:||
aaGCCCCTCCTCC--CAGGCGCT
hsa-miR-941 16.4754 -18.02 3.811970e-02 3.740230e-02 3.740230e-02 90 112
cGUGUACACGUGUGUCGGCCCAc
 :|| |  |  | ||||:||||
cTACCTCGGACCCCAGCTGGGTc
hsa-miR-518d-5p 16.4453 -16.2 5.472350e-02 5.325310e-02 1.023710e-03 34 56
gUCUUUCAC-GAAGGGAGAUCuc
 || || || || |:||||||
aAGCAACTGCCTGCTCTCTAGcc
hsa-miR-541 16.4453 -28.02 6.817650e-02 6.590440e-02 1.442500e-03 103 126
ucaGGUCUA--AGACACGGGUGGU
   |::|:|   ||| ||||:|||
cagCTGGGTCCACTGAGCCCGCCA
bta-miR-34b 16.4453 -18.25 5.669820e-02 5.669820e-02 7.244080e-03 254 275
GUUAGUCGAUU-AAUGUGACGGa
||: | ||||| |||:|||||:
CAGGC-GCTAATTTATACTGCTa
bta-let-7d 16.4453 -17.44 6.478280e-02 6.272900e-02 2.131520e-08 76 97
uugauacguuGGAUGAUGGAGa
          :| :|||||||
ccccagaggcTCCGCTACCTCg
hsa-miR-296-5p 16.4187 -27.94 7.318800e-02 7.057390e-02 1.650750e-04 59 79
uguccuaacuccCCCCCGGGa
            ||||||||
tggcaggaacctGGGGGCCCc
hsa-miR-146b-3p 16.3326 -21.78 7.038180e-02 2.363590e-03 7.098210e-04 116 137
ggucuugacucagGUGUCCCGu
             ||||||||
tgagcccgccaggCACAGGGCc
gga-miR-456 16.3326 -17.86 9.907600e-02 9.432610e-02 1.279940e-04 37 58
acUGUUGGUAGAUUGGUCGGAc
  || :||  ||  |:|||||
caACTGCCTGCTCTCTAGCCTc
hsa-miR-876-3p 16.3326 -15.83 5.564230e-02 5.412260e-02 4.078670e-03 182 203
acuuaaugaaACAUUUGGUGGU
          || |:|||||||
caggaacccaTGCAGACCACCA
bta-miR-98 16.3326 -17.72 7.313370e-02 7.052340e-02 1.398330e-04 76 97
uuGUUAUGUUGAAUGAUGGAGU
  | | | : :  :|||||||:
ccCCAGAGGCTCCGCTACCTCG
hsa-miR-196a 16.22 -12.13 7.155970e-02 6.905930e-02 1.477580e-03 25 46
gggUUGUUGUACUUUGAUGGAU
   :: :| | | ||||:|||:
aagGGAGAGAAGCAACTGCCTG
hsa-miR-196b 16.22 -14.88 6.453880e-02 6.453880e-02 1.477580e-03 25 46
gggUUGUUGUCCUUUGAUGGAU
   :: :| | | ||||:|||:
aagGGAGAGAAGCAACTGCCTG
bta-miR-331 16.1922 -25.34 9.029090e-02 8.633460e-02 3.651930e-06 56 76
aAGAUCCUAUCCGGGUCCCCG
 |||:| | :  ||::|||||
cTCTGGCAGGAACCTGGGGGC
hsa-miR-769-3p 16.1392 -33.97 8.785210e-02 3.640260e-03 2.388130e-04 59 81
uugGUUCUGGGGCCUCUAGGGUC
   ||:|| ||:||:|: |||||
tggCAGGAACCTGGGGGCCCCAG
bta-miR-34c 16.1073 -18.46 8.895380e-02 8.511220e-02 7.244080e-03 254 275
GUUAGUCGAUU-GAUGUGACGGa
||: | ||||| :||:|||||:
CAGGC-GCTAATTTATACTGCTa
cfa-miR-449 16.1073 -20.18 9.155270e-02 8.748680e-02 7.653940e-03 255 275
ugguCGAUUGUUAUGUGACGGU
    |||||:  ||:|||||:|
aggcGCTAAT-TTATACTGCTA
hsa-miR-566 16.0342 -15.23 4.832930e-02 4.718000e-02 4.718000e-02 244 262
caacccuAGUGUCCGCGGg
       || |||||||:
cccctccTCCCAGGCGCTa
hsa-miR-489 15.9947 -17.49 4.520170e-02 4.419530e-02 4.419530e-02 199 220
cgacggcauAUACACUACAGUg
         |: |||:|||||
caccaaggcTGAGTGGTGTCAg
mmu-miR-466g 15.8525 -13.95 6.217580e-02 6.028230e-02 7.878710e-03 149 170
acacacaCGUA-CACAGACAUA
       |:|| | ||||||:|
tgaccagGTATCGGGTCTGTGT
hsa-miR-609 15.8267 -17.32 9.283340e-02 8.865470e-02 1.678740e-03 271 289
ucucUACUCUCUUUGUGGGa
    |||| ||||:||:||
tgctATGA-AGAAGCATCCc
hsa-miR-144 15.8267 -12.9 9.610420e-02 9.163060e-02 2.275720e-02 255 274
ucauguAGUAGAUAUGACau
      | ||:|||||||
aggcgcTAATTTATACTGct
mmu-miR-688 15.599 -13.6 6.563730e-02 6.352950e-02 1.347890e-03 30 49
cUUAUUCAUCAGCGGACGcu
 :| ||| |  :||||||
aGAGAAGCAACTGCCTGCtc
bta-miR-10b 15.3546 -17.85 7.226430e-02 6.971500e-02 7.886350e-04 158 181
guGUUUAAGC-CAAGAUGUCCCau
  |:::| :| || | ||||||
atCGGGTCTGTGTGCCACAGGGgc
hsa-miR-220 15.1731 -16.39 6.299450e-02 6.105140e-02 3.727270e-03 153 172
uUUCACAGUCUAUGCCACACc
 |:|| ||:|:| | |||||
cAGGTATCGGGT-CTGTGTGc
hsa-miR-323-3p 14.9466 -13.63 8.987890e-02 3.805050e-03 5.476000e-04 198 218
ucuccagCUGGCACAUUACAc
       |:|:| ||::|||
ccaccaaGGCTGAGTGGTGTc
Features
AFFY_Bovine Bt.12474.1.S1_at
EMBL BC102185
EntrezGene 523154
GO GO:0003824
GO GO:0003978
GO GO:0005975
GO GO:0006012
GO GO:0016857
GO GO:0044237
GO GO:0050662
protein_id AAI02186
RefSeq_dna_predicted XM_867316
RefSeq_peptide_predicted XP_872409
UniGene Bt.12474
Uniprot/SPTREMBL Q3T105
spacer
spacer