spacer

Target Detailed View


Hit information for ENSBTAT00000005673

Gene Name LOC515854
Transcript ENSBTAT00000005673
Gene ENSBTAG00000004269
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-583 18.5784 -19.6 1.202210e-02 1.195010e-02 1.195010e-02 174 194
cAUUACCCUGGAAGGAGAAAc
 | :|| ||::|||||||||
cTTGTGAGATTTTCCTCTTTa
hsa-miR-662 18.1537 -30.44 9.256860e-03 9.214150e-03 2.475580e-04 499 521
GACGACC--CGGUGUUGCACCCU
:||| ||   |:|||||||||||
TTGCAGGACACTACAACGTGGGA
bta-miR-22-5p 17.4307 -24.09 2.773590e-02 2.735480e-02 1.222080e-05 452 474
auUUCGAACG-GUGACUUCUUGA
  | |||||| ||| ||||:|||
gtATGCTTGCTCACAGAAGGACT
hsa-miR-612 17.4069 -37.2 4.861370e-02 4.745100e-02 4.745100e-02 292 317
UUCCUCG-AGUCUUCGGGACGGGUCg
||||||| || |:|| :|||:||:|
AAGGAGCTTCTGGAGGTCTGTCCGGg
hsa-miR-301a 17.1389 -20.88 2.931710e-02 2.889150e-02 7.649390e-04 108 130
cgaAACUGUUAUGAUAACGUGac
   |||:||:| :||||||||
atcTTGGCAGTCTTATTGCACac
hsa-miR-301b 17.1389 -20.26 2.818370e-02 2.818370e-02 7.649390e-04 108 130
cgaAACUGUUAUAGUAACGUGac
   |||:||:| |:|||||||
atcTTGGCAGTCTTATTGCACac
hsa-miR-674 17.1138 -22.65 3.894440e-02 3.819580e-02 6.775900e-04 151 172
aUGUGGUGAGGGUAGAGUCACg
 | | ||| :||  |||||||
aAGAGCACATCCTCCTCAGTGa
hsa-miR-513-3p 17.0338 -21.62 4.625820e-02 4.520460e-02 6.037990e-03 161 186
GGAAGAGUCUUUC---CACUUUAAAu
||| ||||| :||   ||||:||||
CCTCCTCAGTGAGCTTGTGAGATTTt
hsa-miR-495 17.0081 -13.35 3.572490e-02 3.509430e-02 4.994030e-05 511 533
uucUUCACGUGGU-ACAAACAAA
   | ||| : || |||||||||
acaACGTGGGACATTGTTTGTTT
bta-miR-499 16.8798 -16.63 4.152560e-02 4.067520e-02 4.067520e-02 104 123
uuUGUAGUGACGUUCAGAAUu
  ||||| :||  |||||||
gcACATC-TTGGCAGTCTTAt
hsa-miR-501-5p 16.7968 -21.63 4.677810e-02 4.570090e-02 2.238790e-02 5 28
AGAGU--GGGUCCCUGUUUCCUAA
|||:|   :::|  :|||||||||
TCTTAGGGTTGGTTGCAAAGGATT
bta-miR-487a 16.7736 -25.33 2.094440e-02 2.094440e-02 2.094440e-02 417 436
ugACCUACAGGGACAUACUAa
  ||||  |||||||:||||
tgTGGA-CTCCCTGTGTGATc
hsa-miR-648 16.7392 -19.27 2.898360e-02 2.856760e-02 2.289070e-02 113 132
ugGUCACGG-GACGUGUGAa
  |||| :: :||||||||
ggCAGTCTTATTGCACACTg
mmu-miR-719 16.6912 -21.03 1.954320e-02 1.935350e-02 1.935350e-02 374 395
UUGUAAAAAGACAUCGGCUCua
||  |||| |||| ||||||
AAGCTTTTCCTGTTGCCGAGtg
bta-miR-29b 16.6438 -15.7 3.710420e-02 3.710420e-02 7.980250e-05 193 217
uUUGUGACUAAAGUU-UACCACGAU
 | : :|  || ||| :||||||||
tATTCTTCCTTCCAATGTGGTGCTA
bta-miR-29c 16.5856 -16.45 3.315200e-02 3.315200e-02 7.980250e-05 195 217
auuggcuAAAGUU-UACCACGAU
       || ||| :||||||||
ttcttccTTCCAATGTGGTGCTA
hsa-miR-506 16.349 -17.53 4.337100e-02 4.244390e-02 1.240150e-04 328 349
agauGAGU-CUUCCCACGGAAu
    ||:| |||  |||||||
gaatCTTATGAAATGTGCCTTt
hsa-miR-431 16.349 -22.99 3.854690e-02 3.781340e-02 4.181770e-03 489 508
acGUACUGCCGGACGUUCUGU
  ::||||  |:||||:||||
aaTGTGAC-ACTTGCAGGACA
bta-miR-19a 16.2977 -13.13 5.909740e-02 5.909740e-02 2.634560e-06 67 90
aGUCAAAACGUAUC-UAAACGUGU
 ||  ||   | || |||||||||
aCATCTTAAAAGAGAATTTGCACA
bta-miR-23a 16.2686 -17.13 5.945950e-02 5.772630e-02 1.456130e-03 192 213
accuuuAGGGACCGUUACACUA
      |:|||  |||||||:|
ttattcTTCCTTCCAATGTGGT
hsa-miR-597 16.2686 -18.95 3.411470e-02 3.353940e-02 6.108820e-03 477 499
ugucACCAGUAGCU-CACUGUGu
    | | |||| | |||||||
gttaTAGGCATCAATGTGACACt
hsa-miR-454 16.1926 -13.72 6.490190e-02 3.355770e-03 3.355770e-03 69 91
UGGGAUAUUCGUUAUAACGUGau
|:|:|| ||| :|  ||||||
ATCTTAAAAGAGAATTTGCACat
bta-miR-23b 16.1926 -17.13 5.939080e-02 5.772630e-02 1.456130e-03 191 213
caccauuAGGGACCGUUACACUA
       |:|||  |||||||:|
tttattcTTCCTTCCAATGTGGT
hsa-miR-500 16.0875 -17.03 5.844310e-02 5.676810e-02 9.040990e-04 5 29
AGAGU-GGGUCCAUCG-UUCCUAAu
|||:|   : ||| || |||||||
TCTTAGGGTTGGTTGCAAAGGATTt
bta-miR-450 16.0574 -15.26 4.016870e-02 3.937260e-02 1.171860e-02 4 24
UAUAAUCCUUGUGUAGCGUUUU
:| |||||: :: :|:|||||:
GTCTTAGGGTTG-GTTGCAAAG
hsa-miR-574-3p 16.0574 -22.19 2.723790e-02 2.687030e-02 6.165710e-04 428 451
ACAC-CCACAC-ACGUACUCGCAC
|||| | | ||  |:|||||:|||
TGTGTGATCTGCCGTATGAGTGTG
hsa-miR-576-3p 16.0574 -12.3 8.029000e-02 7.715130e-02 1.426970e-04 91 112
cuaagguuaaaAAGGUGUAGAA
           || ||||||||
tccctggaagcTTGCACATCTT
bta-miR-19b 15.9823 -11.6 6.649760e-02 6.433480e-02 2.634560e-06 68 90
agucaaaacguaCCUAAACGUGU
            | |||||||||
catcttaaaagaGAATTTGCACA
mmu-miR-706 15.9517 -7.99 7.391360e-02 7.124810e-02 1.449240e-02 394 415
AAAAAACUCUGUCCCAAAGAGa
| |||| :  |   |||||||
TGTTTTCGTTCTCTGTTTCTCc
hsa-miR-454 15.8772 -16.45 8.424890e-02 3.355770e-03 3.355770e-03 108 130
UGGGAUAUUCGUUAUAACGUGau
|:|:|:  ||:  ||||||||
ATCTTGGCAGTCTTATTGCACac
bta-miR-122 15.8461 -22.18 9.052630e-02 8.654970e-02 7.490850e-03 481 502
GUUUGUGGUAACAGUGUGAGgu
:|::||:|| ||| |||||:
TAGGCATCAATGTGACACTTgc
hsa-miR-216a 15.7404 -15.47 7.023330e-02 6.782370e-02 1.388290e-02 164 185
aGUGUCAACGGUCGACUCUAAu
 | ||||   |   |||||||
cCTCAGTGAGCTTGTGAGATTt
bta-miR-29a 15.6669 -13.26 5.401480e-02 5.258190e-02 7.980250e-05 196 218
auuggcuaaagUCUACCACGAUc
           | :||||||||
tcttccttccaATGTGGTGCTAt
mmu-miR-687 15.6348 -18.14 7.071330e-02 6.827100e-02 8.893490e-03 305 326
aguaacgACGUAAGGUCCUAUc
       | |:  ||||||||
aggtctgTCCGGGCCAGGATAa
bta-miR-425-5p 15.5292 -15.13 3.906360e-02 3.831050e-02 1.705540e-02 347 368
AGUUGCCCUCACUAGCACAGUa
|:  | |  | ||||||||:|
TTTTCTGATGAGATCGTGTTAg
hsa-miR-525-3p 15.3179 -12.81 6.709980e-02 6.489810e-02 1.144540e-04 328 349
gcgAGAUUUCCCUUCGCGGAAG
   ||| | |  | |:|||||:
gaaTCTTATGAAATGTGCCTTT
hsa-miR-524-3p 15.2874 -12.54 7.625370e-02 7.341890e-02 1.524620e-02 329 349
UGAGGUUUCCCUUCGCGGAAG
| ||: | |  | |:|||||:
AATCTTATGAAATGTGCCTTT
bta-miR-380-5p 15.2122 -10.1 6.901990e-02 6.669190e-02 7.988880e-03 20 41
cgcguacAAGAUACCAGUUGGu
       ||:| | ||:||||
caaaggaTTTTTTAGTTAACCt
hsa-miR-147b 15.1066 -18.45 8.398770e-02 8.055740e-02 1.371190e-02 109 130
aucGUCUUCGUAAAGGCGUGUG
   ::| ||: || ::||||||
tctTGGCAGTCTTATTGCACAC
bta-miR-487b 15.1066 -25.99 4.301530e-02 4.210330e-02 4.210330e-02 416 436
uuCACCUACUGGGACAUGCUAa
  |||||   ||||||::|||
ttGTGGA-CTCCCTGTGTGATc
hsa-miR-560 14.2998 -24.78 9.214070e-02 8.802320e-02 1.665890e-02 263 282
ccgccGGCCGGCCGCGUGCG
     ::||| |||| ||||
tctcaTTGGCAGGCGGACGC
Features
AFFY_Bovine Bt.16123.1.S1_at
AFFY_Bovine Bt.16123.2.S1_a_at
EntrezGene 515854
GO GO:0005515
GO GO:0006468
GO GO:0006974
RefSeq_peptide_predicted XP_869737
spacer
spacer