spacer

Target Detailed View


Hit information for ENSBTAT00000003678

Gene Name LOC533928
Transcript ENSBTAT00000003678
Gene ENSBTAG00000002837
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-520d-3p 18.8747 -21.2 6.695410e-03 6.695410e-03 3.671730e-05 51 72
UGGGUGGUUUCUCUUCGUGAAA
:|| : |  : |||||||||||
GCCGGGCCTGAAGAAGCACTTT
hsa-miR-520h 18.761 -20.38 6.440080e-03 6.440080e-03 3.671730e-05 55 74
ugaGAUUUCCCUUCGUGAAACa
   ||:||  |||||||||||
ggcCTGAA--GAAGCACTTTGa
hsa-miR-520g 18.5772 -20.57 8.279070e-03 8.279070e-03 3.671730e-05 53 74
ugugaGAUUUCCCUUCGUGAAACa
     ||:||  |||||||||||
cgggcCTGAA--GAAGCACTTTGa
hsa-miR-520a-3p 18.5336 -19.01 6.738220e-03 6.738220e-03 3.671730e-05 52 72
uGUCAGGUUUCCCUUCGUGAAA
 |:| || :|  ||||||||||
cCGGGCCTGA-AGAAGCACTTT
mmu-miR-351 18.3521 -25.65 1.510670e-02 1.499320e-02 1.499320e-02 66 89
guccGAGUUUCCCGAGGAGUCCCu
    :|::|||  ||||||:|||
gcacTTTGAAGACCTCCTCGGGGt
hsa-miR-520b 18.2893 -17.02 1.026640e-02 1.026640e-02 3.671730e-05 54 72
gggaGAUUUUCCUUCGUGAAA
    ||:||  ||||||||||
gggcCTGAA--GAAGCACTTT
hsa-miR-520c-3p 18.1925 -17.02 1.151260e-02 1.151260e-02 3.671730e-05 53 72
ugggaGAUUUUCCUUCGUGAAA
     ||:||  ||||||||||
cgggcCTGAA--GAAGCACTTT
hsa-miR-520e 18.1749 -17.96 1.204480e-02 1.204480e-02 3.671730e-05 52 72
gggaguuuUUCCUUCGUGAAA
        :| ||||||||||
ccgggcctGAAGAAGCACTTT
bta-miR-93 18.0788 -24.3 1.315340e-02 1.306730e-02 1.929070e-06 51 73
auggaCGUGCUU-GUCGUGAAAC
     || :|||  |||||||||
gccggGCCTGAAGAAGCACTTTG
hsa-miR-519d 17.8514 -18.11 1.029730e-02 1.024450e-02 4.718060e-06 54 73
gugaGAUUUCCCUCCGUGAAAC
    ||:||  || ||||||||
gggcCTGAA--GAAGCACTTTG
bta-miR-17-5p 17.7891 -25.11 1.837920e-02 3.099120e-03 1.418050e-05 48 73
ugaUGGACGUGAC--AUUCGUGAAAC
   :|| |  |||   ||||||||||
gggGCCGGGCCTGAAGAAGCACTTTG
mmu-miR-350 17.7377 -18.34 1.643840e-02 1.630400e-02 1.630400e-02 124 149
CUUUC-ACAUACCCG---AAACACUU
|||:| | |: |||:   ||||||||
GAAGGTTCTGAGGGTTGATTTGTGAA
hsa-miR-302d 17.6485 -18.21 1.974650e-02 1.974650e-02 1.244990e-04 48 72
ugugaGUUUGUAC--CUUCGUGAAu
     |:::| ||  |||||||||
ggggcCGGGCCTGAAGAAGCACTTt
hsa-miR-520f 17.624 -15.99 1.851540e-02 1.834500e-02 3.671730e-05 52 71
uugggaGAUUUUCCUUCGUGAA
      ||:||  |||||||||
ccgggcCTGAA--GAAGCACTT
mmu-miR-294 17.624 -16.82 1.809410e-02 1.793140e-02 8.773730e-06 51 72
uguguguuuuccCUUCGUGAAA
            ||||||||||
gccgggcctgaaGAAGCACTTT
mmu-miR-291a-3p 17.624 -16.25 1.704690e-02 1.690240e-02 8.638200e-06 51 72
cguguguuucacCUUCGUGAAA
            ||||||||||
gccgggcctgaaGAAGCACTTT
hsa-miR-760 17.5872 -37.49 5.313720e-02 5.175010e-02 2.678070e-03 35 54
aGGGGUGUCUGGGUCUCGGC
 ||| :||||||::|:||||
gCCCAGCAGACCTGGGGCCG
hsa-miR-373 17.5354 -17.42 2.493080e-02 2.462260e-02 1.270810e-05 52 72
uGUGGGGUUUUAGCUUCGUGAAG
 |:  || :||  |||||||||:
cCGGGCCTGAA--GAAGCACTTT
bta-miR-20a 17.5354 -21.41 2.653930e-02 2.619020e-02 2.150350e-06 49 73
gaUGGACGUGA--UAUUCGUGAAAU
  :|| |  ||  | |||||||||:
ggGCCGGGCCTGAAGAAGCACTTTG
hsa-miR-552 17.4891 -18.45 1.909610e-02 1.891490e-02 2.269310e-03 86 108
aaCAGAUUGGUCA--GUGGACAa
  ||:|: :|| |  |||||||
ggGTTTGCTCATTTGCACCTGTg
hsa-miR-302a 17.4222 -19.41 2.506480e-02 2.506480e-02 1.244990e-04 49 72
agUGGUUUUG-UACCUUCGUGAAu
  :||::: | :  |||||||||
ggGCCGGGCCTGAAGAAGCACTTt
mmu-miR-295 17.4222 -15.28 2.159610e-02 2.136460e-02 6.008380e-05 50 72
ucugaguuuuCAUCAUCGUGAAA
          | || ||||||||
ggccgggcctGAAGAAGCACTTT
bta-miR-106 17.3966 -20.87 2.519510e-02 2.488040e-02 4.986470e-06 50 73
aUGGACGUGAC--AUUCGUGAAAa
 :|| |  |||   |||||||||
gGCCGGGCCTGAAGAAGCACTTTg
hsa-miR-885-3p 17.3966 -19.87 3.000170e-02 2.955610e-02 9.709020e-04 145 166
auaggUGAUGUGGGGCGACGGa
     |: |::|:||||||:|
gtgaaATGATGCTCCGCTGTCa
hsa-miR-324-3p 17.3573 -35.46 4.700660e-02 3.233720e-03 1.224340e-03 37 55
GGUCGUCGUGGACCCCGUCa
||||||| ||||||||| |
CCAGCAG-ACCTGGGGCCGg
hsa-miR-574-5p 17.3091 -22.92 3.901690e-02 3.826550e-02 3.826550e-02 230 251
UGUGUGAGUGUGUGUGUGUGAGU
|: |:| | | | ||||||||:|
ATCCGC-CTCCCCCACACACTTA
bta-miR-484 17.2829 -23.82 3.714810e-02 3.646660e-02 2.268560e-03 40 61
uagcccucCCCUGACUCGGACU
        |||:| |:||||||
gcagacctGGGGCCGGGCCTGA
bta-miR-19b 17.196 -16.06 2.491410e-02 2.491410e-02 2.538460e-07 84 104
agUCAAAACGUACCUAAACGUGu
  :| ||||| |  ||||||||
cgGGGTTTGC-T-CATTTGCACc
bta-miR-19a 17.196 -16.06 2.901770e-02 2.860070e-02 2.538460e-07 84 104
agUCAAAACGUAUCUAAACGUGu
  :| ||||| |  ||||||||
cgGGGTTTGC-T-CATTTGCACc
bta-miR-20b 17.1692 -22.79 2.517030e-02 2.517030e-02 2.150350e-06 50 73
aUGGACGUGAC-AC-UCGUGAAAC
 :|| |  |||  | |||||||||
gGCCGGGCCTGAAGAAGCACTTTG
mmu-miR-666-3p 17.1692 -21.82 4.801060e-02 4.687630e-02 7.012990e-04 163 186
ucGUCCGCU--AGUGCGACGUCGg
  || |:||  |:::|:||||||
gtCAAGTGAACTTGTGTTGCAGCa
hsa-miR-372 17.0828 -15.45 2.730040e-02 2.693110e-02 8.368960e-05 50 72
ugcgaguuuACAGCGUCGUGAAA
         ||  | ||||||||
ggccgggccTGAAGAAGCACTTT
hsa-miR-302c 17.0828 -20.13 3.086290e-02 3.086290e-02 1.244990e-04 50 72
gguGACUUUGUACCUUCGUGAAu
   | |:  ::  |||||||||
ggcCGGGCCTGAAGAAGCACTTt
hsa-miR-302b 17.0828 -15.95 3.317560e-02 3.263130e-02 1.244990e-04 48 72
gaugauUUUGUAC--CUUCGUGAAu
      :::| ||  |||||||||
ggggccGGGCCTGAAGAAGCACTTt
mmu-miR-680 17.0319 -23.26 3.470450e-02 3.410920e-02 2.090270e-03 18 38
gggggUACAGUCGUCUACGGG
     | |  |||||:|||||
ctgagACGCGAGCAGGTGCCC
bta-miR-151* 17.0319 -18.28 2.075330e-02 2.053940e-02 2.053940e-02 66 86
ugaucugacaCUCGAGGAGCU
          || |||||||:
gcactttgaaGACCTCCTCGG
bta-miR-127 16.9418 -20.83 1.832000e-02 1.815320e-02 3.935720e-03 104 124
ucgGUUCGAGUCUGCCUAGGCU
   ::: |||: : |||||||:
ctgTGGACTCGCG-GGATCCGG
hsa-miR-595 16.9176 -13.83 3.013210e-02 2.968270e-02 2.968270e-02 231 251
ucuguGUGGUGCCGUGUGAAg
     | || |  |||||||
tccgcCTCCCCCACACACTTa
bta-miR-107 16.7144 -15.08 4.440560e-02 4.343410e-02 4.343410e-02 136 157
CUAUCGGGACAUGUUACGACGA
|:| | ::|||: |||| ||||
GGTTGATTTGTGAAATGATGCT
mmu-miR-467e 16.7144 -11.58 5.239480e-02 5.104590e-02 1.270030e-05 231 252
uguauauguacGAGUGUGAAUa
           | ||||||||
tccgcctccccCACACACTTAa
hsa-miR-147 16.6676 -14.4 4.027180e-02 3.947170e-02 1.421940e-04 229 248
cgucuucguaaaGGUGUGUG
            ||||||||
aatccgcctcccCCACACAC
hsa-miR-605 16.5172 -17.53 3.696010e-02 3.628540e-02 1.193670e-03 69 92
uccuCUUCCGUGGUA-CCCUAAAU
    |||| | :| | |||:|||:
ctttGAAGACCTCCTCGGGGTTTG
hsa-miR-887 16.487 -26.88 1.483340e-02 1.472390e-02 1.434820e-04 187 208
ggaGCCCUACCGCGGGCAAGUG
   ||| :  ||  |:||||||
tgaCGGCGGCGCAGCTGTTCAC
hsa-miR-187 16.487 -22.48 4.162410e-02 4.076970e-02 4.076970e-02 7 28
ggccgaCGUUGUGUUCUGUGCU
      ||::  ::||||:|||
gtgcagGCGGGCTGAGACGCGA
hsa-miR-646 16.4196 -19.14 6.860340e-02 6.630310e-02 6.676540e-03 188 206
cggaguCUCCGUCGACGAa
      |: |||||||:|
gacggcGGCGCAGCTGTTc
hsa-miR-375 16.3733 -31.26 2.302420e-02 2.276120e-02 2.276120e-02 9 33
aGUGCGCUCGGCU---UGCUUGUUU
 || |||:||:||   :|||:||::
gCAGGCGGGCTGAGACGCGAGCAGG
hsa-miR-671-3p 16.346 -25.89 4.569550e-02 4.434950e-03 4.434950e-03 105 125
cCACCUCGGGACUCUUGGCCU
 ||||| :|  |:|| |||||
tGTGGACTCGCGGGATCCGGA
hsa-miR-566 16.1883 -20.32 4.286780e-02 4.196200e-02 4.196200e-02 20 38
caacccuagUGUCCGCGGG
         :||||:||||
gagacgcgaGCAGGTGCCC
bta-miR-18b 16.1459 -15.02 5.619990e-02 3.387360e-03 1.518370e-06 52 73
auugacgugaUCUACGUGGAAU
          ||| ||||:||:
ccgggcctgaAGAAGCACTTTG
bta-miR-18a 16.1459 -15.25 5.480470e-02 3.387360e-03 1.518370e-06 52 73
auagacgugaUCUACGUGGAAU
          ||| ||||:||:
ccgggcctgaAGAAGCACTTTG
mmu-miR-466d-5p 16.1459 -12.27 7.648850e-02 7.363640e-02 1.206470e-03 228 249
guacauguacauGCGUGUGUGu
            | |||||||
aaatccgcctccCCCACACACt
hsa-miR-654-3p 16.1459 -20.11 4.716220e-02 4.606730e-02 4.606730e-02 27 48
UUCCACUACCAGUCGUCUGUAU
:||  |:||  |||||||| |:
GAGCAGGTGCCCAGCAGACCTG
bta-miR-17-3p 16.0929 -19.46 8.087270e-02 3.099120e-03 1.418050e-05 164 185
uGUUCAC--GGAAGUGACGUCa
 ||||||  |:| :::|||||
tCAAGTGAACTTGTGTTGCAGc
hsa-miR-636 16.0647 -30.41 4.812830e-02 2.081660e-03 2.081660e-03 8 33
ACGCCCGCCCUGCU---CGUUCGUgu
||| |||||| :||   ||:||||
TGCAGGCGGGCTGAGACGCGAGCAgg
hsa-miR-105 16.0647 -22.28 5.734290e-02 5.572980e-02 1.684320e-03 79 101
uGGUGUCCUCAGACUCGUAAACu
 :| : ||:||:||  ||||||
cTCCTCGGGGTTTGCTCATTTGc
hsa-miR-223 15.9185 -8.29 7.048390e-02 6.805730e-02 7.006260e-03 237 258
accccauaaacuguUUGACUGu
              |||||||
tcccccacacacttAACTGACc
mmu-miR-293 15.8047 -19.1 4.023200e-02 3.943340e-02 6.520200e-04 176 199
UGUGAUGUUUGA--GACGCCGUGa
::::|:||:  |  | |||||:|
GTGTTGCAGCATGACGGCGGCGCa
hsa-miR-636 15.7253 -25.6 6.595400e-02 2.081660e-03 2.081660e-03 47 70
ACGCCCGCCCUG-CUCGUUCGUGu
|| || |||| | ||  ||||||
TGGGGCCGGGCCTGAAGAAGCACt
bta-miR-18a 15.691 -16.62 8.465600e-02 3.387360e-03 1.518370e-06 87 107
aUAGACGUGAUCUACGUGGAau
 :|:||| | |  |||||||
gGTTTGCTC-ATTTGCACCTgt
hsa-miR-362-5p 15.6499 -22.17 9.818480e-02 9.351860e-02 8.745730e-03 116 139
ugaguguggaUCCAAGGUUCCUAA
          ||||||::|||:||
gggatccggaAGGTTCTGAGGGTT
hsa-miR-324-5p 15.6121 -23.66 8.265910e-02 3.233720e-03 1.224340e-03 100 123
UGUGGUUACGGGAUC-CCCUACGC
:|||| :||  || | ||||| ||
GCACCTGTGGACTCGCGGGATCCG
hsa-miR-671-3p 15.4316 -23.64 9.727100e-02 4.434950e-03 4.434950e-03 37 56
ccaCCUCGGGACUCUUGGCCU
   | || |||| |::||||:
ccaGCAGACCTG-GGGCCGGG
hsa-miR-518c 15.0465 -17.6 9.027620e-02 8.632120e-02 4.629530e-05 51 73
ugugagauuucUCUUCGCGAAAC
           |||||| |||||
gccgggcctgaAGAAGCACTTTG
hsa-miR-518e 14.9743 -15.5 8.308040e-02 8.308040e-02 4.629530e-05 54 72
gugaGACUUCCCUUCGCGAAA
    |||||  ||||| ||||
gggcCTGAA--GAAGCACTTT
bta-miR-363 14.86 -11.5 8.639490e-02 8.276810e-02 8.664500e-03 1 13
gcgucuaccuauGGCACGUUa
            :||||||:
--------gcccTCGTGCAGg
hsa-miR-518d-3p 14.86 -16.3 8.879780e-02 8.632120e-02 4.629530e-05 55 73
cgaGGUUUCCCUUCGCGAAAC
   |::||  ||||| |||||
ggcCTGAA--GAAGCACTTTG
Features
AFFY_Bovine Bt.4095.1.A1_at
AFFY_Bovine Bt.4095.2.S1_at
EntrezGene 533928
RefSeq_dna_predicted XM_613495
RefSeq_peptide_predicted XP_613495
UniGene Bt.61871
spacer
spacer