spacer

Target Detailed View


Hit information for ENSBTAT00000002813

Gene Name LOC532081
Transcript ENSBTAT00000002813
Gene ENSBTAG00000002171
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-647 18.3906 -23.49 1.170130e-02 1.163310e-02 1.163310e-02 376 396
CUUCCUUCACUCACGUCGGUG
| ||  :|||| ||||||||:
GCAGATGGTGACTGCAGCCAT
hsa-miR-875-3p 18.3906 -17.21 1.407350e-02 1.397490e-02 4.452340e-03 494 514
GUGUUGGAGUCACAAAGGUCc
|| |:|: |:|| |||||||
CAAAGCTACGGTTTTTCCAGt
hsa-miR-511 17.749 -30.13 2.610690e-02 2.576910e-02 2.576910e-02 384 407
ACUGACGUC--U-CGUUUUCUGUG
|||||||||  | |:|||||||:|
TGACTGCAGCCATGTAAAAGACGC
hsa-miR-135b 17.6839 -22.99 1.773490e-02 1.773490e-02 1.773490e-02 410 431
aGUGUAUCCUUACUUUUCGGUAU
 ||| | |||| |||||||:||:
gCACCTTGGAA-GAAAAGCTATG
hsa-miR-135a 17.3663 -20.29 2.711790e-02 2.675350e-02 2.675350e-02 410 431
aGUGUAUCCUUAUUUUUCGGUAU
 ||| | |||| :||||||:||:
gCACCTTGGAA-GAAAAGCTATG
bta-miR-140 17.342 -20.13 2.310480e-02 2.283990e-02 2.283990e-02 568 589
AGGCACCAAGAUGGGACACCAU
|:  || ||:|:  |||||||:
TTGATGCTTTTGAACTGTGGTG
hsa-miR-548d-5p 17.2356 -9.94 7.236830e-02 2.495610e-03 3.893360e-05 152 173
ccGUUUUUGGUGUUAAUGAAAa
  :||| |:||   |||||||
ttTAAACATCAACTTTACTTTc
hsa-miR-548d-3p 17.1292 -11.18 3.521210e-02 2.495610e-03 3.893360e-05 489 510
cGUUUUCUUUGACACCAAAAAc
 :|::  ||:||  |||||||
cTAGGCAAAGCTACGGTTTTTc
mmu-miR-666-3p 17.1292 -25.53 4.950480e-02 4.829940e-02 5.129310e-03 375 394
uCGUCCGCUAGUGCGACGUCGG
 |||| :|:| |  ||||||||
tGCAGATGGTGA--CTGCAGCC
hsa-miR-628-3p 17.1075 -19.47 2.139220e-02 2.116500e-02 4.808870e-05 338 358
AGCUGACGGUGAGAAUGAUCU
|: |  ||||:| ||:|||||
TTAAAGGCCATTATTGCTAGA
hsa-miR-593 17.0764 -17.07 5.310250e-02 2.320300e-03 2.320300e-03 5 23
UCUUUGGGGUCGUCUCUGu
| |||| :::|:||||||
AAAAACATTGGTAGAGACt
mmu-miR-682 17.0006 -25.35 3.241620e-02 3.189640e-02 1.184810e-02 372 392
gucugaagUGACACUGACGUC
        |: ||||||||||
cactgcagATGGTGACTGCAG
hsa-miR-770-5p 16.9427 -26.16 2.302330e-02 2.276030e-02 2.276030e-02 572 594
ACCGGGACUGUGCACCAUGACCU
|| :::|||  :|||||::||||
TGCTTTTGAACTGTGGTGTTGGA
bta-miR-487a 16.8937 -13.82 1.886320e-02 1.886320e-02 1.886320e-02 272 292
ugaccUACAGGGACAUACUAA
     || | : |||||||||
agcccATATGTATGTATGATT
hsa-miR-593 16.7522 -17.79 6.971890e-02 2.320300e-03 2.320300e-03 447 465
ucuuuggggUCGUCUCUGU
         ||||||||||
gtattaaaaAGCAGAGACA
mmu-miR-466a-3p 16.7309 -11.65 4.831780e-02 4.831780e-02 1.468300e-03 267 289
aGAAUACACACGCACAUACAUAU
 :||| |    : |||||||||:
cTTTAAGCCCATATGTATGTATG
hsa-miR-944 16.7037 -7.18 7.211350e-02 6.957470e-02 4.720550e-06 108 129
GAGUAGGCUACAUGUUAUUAAA
||: |:  ||| | :|||||||
CTTTTTATATGGAAGATAATTT
mmu-miR-466b-3-3p 16.5191 -9.52 5.587960e-02 5.587960e-02 1.468300e-03 267 289
aGAAUACACACGCACAUACAUAa
 :||| |    : |||||||||
cTTTAAGCCCATATGTATGTATg
mmu-miR-710 16.3845 -10.86 6.184000e-02 5.996670e-02 1.918510e-02 5 26
gagUUGAGAGGGGUUCUGAACc
   ||| :|  : :|||||||
aaaAACATTGGTAGAGACTTGa
mmu-miR-466d-3p 16.3591 -11.65 5.981730e-02 5.806340e-02 1.468300e-03 269 289
GAUACACACGCACAUACAUAU
:|| |    : |||||||||:
TTAAGCCCATATGTATGTATG
bta-miR-374 16.2781 -4.26 7.223310e-02 6.968600e-02 6.235990e-04 46 67
GUGAAUAGUCCAACAUAAUAUU
:: |||  |   | ||||||||
TGATTAAGATAATCTATTATAA
bta-miR-145 16.2015 -19.71 7.027540e-02 6.786290e-02 1.776880e-04 519 541
UCCCUAAGGACCCUUUUGACCUG
||| ||   || ||:|::|||||
AGGTATAGATGTGAGAGTTGGAC
mmu-miR-742 16.1717 -12.29 6.435570e-02 6.232860e-02 8.265920e-04 291 310
AAAUGGGUCGUACCACCGAAAG
||  :::| :||  ||||||||
TTGTTTTATTAT--TGGCTTTC
bta-let-7i 16.1717 -17.18 9.081280e-02 8.681140e-02 2.757920e-06 16 37
uUGUCGUGUUUGAUGAUGGAGU
 | ||  : :|| |:|||||||
tAGAGACTTGACAATTACCTCA
hsa-miR-196a 16.0653 -13.54 8.317830e-02 7.981290e-02 3.128860e-04 14 36
ggGUUGUUGUACU-UUGAUGGAu
  :|: :|| ||| ||:|||||
ggTAGAGACTTGACAATTACCTc
bta-miR-21 16.0234 -13.77 5.399480e-02 5.256300e-02 3.322940e-06 66 91
UCAGUUG-UAGUCA-GACUAUUCGAu
| | ||| || | | ||||||||:|
AATAAACTATAAATGCTGATAAGTTc
hsa-miR-655 15.9589 -6.67 8.286650e-02 7.952600e-02 2.902250e-04 432 453
uuucuccAAUUGGUACAUAAUa
       | :|: :|||||||
accaatcTAGATAGTGTATTAa
bta-miR-139 15.7779 -13.05 8.509170e-02 8.157190e-02 7.839700e-04 566 588
UGACCUCUGUGCACGUGACAUCu
| | || :| : || |||||:|
AATTGATGCTTTTGAACTGTGGt
hsa-miR-323-3p 15.6106 -12.42 5.000910e-02 4.877920e-02 2.210350e-05 164 184
ucuccagcuGGCACAUUACAC
         |:  ||||||||
ctttactttCTAGGTAATGTG
hsa-miR-153 15.4269 -13.7 8.491520e-02 8.140980e-02 1.327200e-06 172 193
cuagugaaaACACUGAUACGUu
         |||| ||:||||
tctaggtaaTGTGCCTGTGCAn
hsa-miR-935 15.3543 -14.81 7.323550e-02 7.061810e-02 9.933760e-03 368 390
cgccaUCGCCUUCGCCAUUGACc
     | :| |: :|||:||||
aaatcACTGCAGATGGTGACTGc
bta-miR-487b 15.3205 -13.09 3.500630e-02 3.440070e-02 3.440070e-02 271 292
UUCACCUACUGGGACAUGCUAA
|||   ||   : ||||:||||
AAGCCCATATGTATGTATGATT
hsa-miR-219-5p 15.1829 -7.82 6.915220e-02 2.796040e-03 1.925240e-04 12 32
ucUUAACGCAAACCUGUUAGU
  ::| | |  | ||||||:|
ttGGTAGAGACTTGACAATTA
hsa-miR-219-5p 15.076 -15.87 7.671070e-02 2.796040e-03 1.925240e-04 525 546
UCUUAACGC-AAACCUGUUAgu
|||  || |  |||||||||
AGATGTGAGAGTTGGACAATaa
Features
AFFY_Bovine Bt.16248.1.A1_at
UniGene Bt.46189
UniGene Bt.83628
spacer
spacer