spacer

Target Detailed View


Hit information for ENSBTAT00000002707

Gene Name LOC616156
Transcript ENSBTAT00000002707
Gene ENSBTAG00000002098
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-661 18.1724 -43.03 3.626790e-02 8.472810e-04 8.472810e-04 192 215
UGCGCGUCCGGUCUCUGGGUCCgu
:| :|||||||||||||:||||
GCCTGCAGGCCAGAGACTCAGGgt
hsa-miR-661 17.9635 -34.24 4.174080e-02 8.472810e-04 8.472810e-04 329 354
UGCGCGUCCGGU--CUCUGGGUCCGU
:| |  |||:|:  |:||||||||||
GCCCCAAGGTCGGTGGGACCCAGGCA
bta-miR-331 17.688 -35.57 3.256580e-02 3.204120e-02 5.914150e-04 487 507
aagaUCCUAUCCGGGUCCCCG
    |||| :|||||:|||||
gggcAGGAAGGGCCCGGGGGC
hsa-miR-637 17.6502 -37.59 5.089850e-02 4.962490e-02 5.763810e-04 410 433
uGCGUCUCGGGCUUUCGGGGGUCa
 | | |||||:|:||||:|||:|
cCTCTGAGCCTGGAAGCTCCCGGg
bta-let-7g 17.4958 -21.5 2.226090e-02 4.486300e-03 2.255260e-07 20 39
UUGACAUGUUUGAUGAUGGAGU
|||| ||||||:| :|||||||
AACT-TACAAATT-TTACCTCA
hsa-miR-326 17.4604 -41.91 4.247900e-02 4.158940e-02 7.356040e-04 485 506
GACC--UCCUUCCCGGGUCUCC
||||  |||||||||||:|:||
CTGGGCAGGAAGGGCCCGGGGG
hsa-miR-767-3p 17.4142 -28.57 2.379600e-02 2.351510e-02 1.139130e-03 472 493
UCUUUGGUACCCCAUACUCGUCU
||::||| |||| | ||:||||:
AGGGACC-TGGGCTCTGGGCAGG
mmu-miR-351 17.3368 -29.97 3.373710e-02 3.317440e-02 9.489570e-03 152 173
GUCCGAGUUUCCCGAGGAGUCCCU
::||| ||:|  ||| ||||||||
TGGGC-CAGA-CGCTGCTCAGGGA
hsa-miR-432 17.3093 -28.88 4.362680e-02 4.268880e-02 8.651830e-03 97 119
GGUGGGUUACUGGAUGAGGUUCU
|||||| ||  ||  |||||:|:
CCACCCCATCTCCGCCTCCAGGG
bta-miR-125b 17.285 -19.79 2.510330e-02 1.714810e-03 1.714810e-03 194 215
aGUGUUCAAUCCCAGAGUCCCu
 ::||:|  || | |||||||
cTGCAGGCCAGAGACTCAGGGt
bta-miR-125a 17.2044 -21.9 2.776180e-02 1.714810e-03 1.714810e-03 150 173
GUGUCCAAUUUCCCA-GAGUCCCU
|:::||  |:| | | ||||||||
CGTGGGCCAGACGCTGCTCAGGGA
bta-let-7c 16.7581 -19.15 5.344620e-02 4.486300e-03 2.255260e-07 19 39
UUGGUAUGUUGGAUGAUGGAGU
|| | ||||| :| :|||||||
AAACTTACAAATT-TTACCTCA
hsa-miR-663 16.7581 -32.33 6.960990e-02 6.724240e-02 5.510870e-03 175 195
cgccaGGGCGCCGCGGGGCGGA
     ||:||  :|||||||||
cctagCCTGC-CTGCCCCGCCT
bta-let-7f 16.6527 -17.71 5.170340e-02 4.486300e-03 2.255260e-07 20 39
UUGAUAUGUUAGAUGAUGGAGU
|||| ||||| :| :|||||||
AACT-TACAAATT-TTACCTCA
bta-let-7a 16.6527 -18.77 5.621480e-02 4.486300e-03 2.255260e-07 20 39
UUGAUAUGUUGGAUGAUGGAGU
|||| ||||| :| :|||||||
AACT-TACAAATT-TTACCTCA
hsa-miR-595 16.5229 -20.62 4.423230e-02 4.326830e-02 4.326830e-02 494 514
UCUGUGUGGUGCCGUGUGAAg
| : :| | : |||||||||
AAGGGCCCGGGGGCACACTTg
bta-let-7i 16.4419 -20.46 6.967650e-02 4.486300e-03 2.255260e-07 19 39
UUGUCGUGUUUGAUGAUGGAGU
||   :|||||:| :|||||||
AAACTTACAAATT-TTACCTCA
bta-let-7b 16.4419 -18.67 7.825810e-02 4.486300e-03 2.255260e-07 19 39
UUGGUGUGUUGGAUGAUGGAGU
|| | :|||| :| :|||||||
AAACTTACAAATT-TTACCTCA
bta-miR-423 16.2925 -30.75 4.228990e-02 3.342370e-03 3.342370e-03 517 544
UGACUCCCCGGAGUC----UGGCUCGAa
:||||| |||| ::|    ||:|||||
GCTGAGAGGCCCTGGGGGTACTGAGCTc
bta-miR-125a 16.2603 -24.01 5.973780e-02 1.714810e-03 1.714810e-03 195 215
GUGUCCAAUUUCCCAGAGUCCCu
::||||  |:|  | |||||||
TGCAGGCCAGA--GACTCAGGGt
bta-miR-98 16.2311 -17.87 8.071020e-02 7.753900e-02 4.978820e-06 19 39
UUGUUAUGUUGAAUGAUGGAGU
||   ||||| || :|||||||
AAACTTACAAATT-TTACCTCA
bta-let-7b 16.2311 -23.82 9.584200e-02 4.486300e-03 2.255260e-07 52 72
uugguGUGUUGGAUGAUGGAGu
     |:| :|| ||||||||
tctgcCGCCGCC-ACTACCTCc
bta-let-7e 16.2051 -19.71 9.515750e-02 4.486300e-03 2.255260e-07 21 39
UGAUAUGUUGGAGGAUGGAGU
||| |||||  |::|||||||
ACT-TACAA-ATTTTACCTCA
hsa-miR-662 16.2051 -27.82 4.331170e-02 4.238710e-02 1.274860e-04 137 156
gacGACCCGGUGUUGCACCCu
   ||||| ||| :||||||
tccCTGGG-CACCGCGTGGGc
hsa-miR-615-3p 16.0203 -34.46 6.130560e-02 5.946420e-02 4.348690e-03 113 136
uucUCCCUCUG--GGUCCGAGCcu
   ||||||:|  ||:||||||
tccAGGGAGGCCGCCGGGCTCGcg
bta-miR-484 16.0203 -19.67 9.394810e-02 8.967000e-02 1.176400e-03 401 422
uagcccuccccuGACUCGGACU
            |||||||||:
tcagccgcccctCTGAGCCTGG
bta-let-7d 16.0203 -20.92 9.785130e-02 4.486300e-03 2.255260e-07 52 72
uugauaCGUUGGAUGAUGGAGa
      || :|| ||||||||
tctgccGCCGCC-ACTACCTCc
hsa-miR-551b 15.9933 -22.03 4.739470e-02 4.739470e-02 4.739470e-02 429 450
GACUUUGGUUCAU-ACCCAGCG
| |:::||   |: |||||||:
CCGGGGCCTCCTGTTGGGTCGT
hsa-miR-495 15.9149 -9.75 7.849130e-02 7.548990e-02 8.279120e-05 256 276
uucuucACGUGGUACAAACAAA
      ||| ::: ||||||||
tctcttTGCTTTG-GTTTGTTT
hsa-miR-509-3-5p 15.8095 -19.93 8.903960e-02 8.519070e-02 9.120360e-03 180 201
GUACUAACGGUGCAGACGUCau
| ||  |||| || ||||||
CCTGCCTGCCCCGCCTGCAGgc
hsa-miR-648 15.7365 -21.86 7.441210e-02 7.171090e-02 6.143540e-03 492 513
uggUCACGGG---ACGUGUGAA
   || ||||    ||||||||
ggaAGGGCCCGGGGGCACACTT
hsa-miR-220b 15.6756 -23.71 7.341050e-02 7.078070e-02 4.029890e-04 556 579
uUCACAGUCUGU---GCCACCACc
 ||||||   |:   :|||||||
cAGTGTCCTCCGTGCTGGTGGTGt
mmu-miR-291b-5p 15.5987 -14.07 9.695620e-02 9.240420e-02 1.727400e-04 250 271
ccucucccGGAGGUGAAACUAG
        :||:::|||||:|:
acctcttcTCTTTGCTTTGGTT
bta-miR-423 15.4569 -34.75 8.407570e-02 3.342370e-03 3.342370e-03 459 485
ugaCUCCCCGGAGUCU---GGCUCGAa
   |||||||| |||:   |:|:|||
gggGAGGGGCCACAGGGACCTGGGCTc
bta-miR-193a 15.3879 -27.55 8.154400e-02 7.830780e-02 7.282470e-03 139 161
uGACCC-UGAAACAUCCGGUCaa
 ||||| ||   ||:||||||
cCTGGGCACCGCGTGGGCCAGac
mmu-miR-700 15.3578 -21.02 4.871320e-02 4.754570e-02 1.076530e-05 118 138
CCACCUGAGCCAAGGGCGCAc
|| || | | |  |:|||||
GGAGGCCGCCGGGCTCGCGTc
hsa-miR-572 15.3311 -31.13 8.333930e-02 7.996110e-02 7.694430e-03 211 233
aCCCGGUGGCG---GCUCGCCUG
 |||:| | ||   :|||:||||
aGGGTCCCGGCTTGTGAGTGGAC
hsa-miR-611 15.3161 -29.21 7.839560e-02 7.540140e-02 6.915390e-03 543 567
caGUCUGGGGCUC--CCCAGGAGcg
  ||| :||||:|  | ||||||
tcCAGCTCCCGGGCAGTGTCCTCcg
hsa-miR-634 15.2825 -16.35 8.060520e-02 7.744220e-02 7.234240e-03 554 575
cagguuucaacccCACGACCAa
             ||||||||
ggcagtgtcctccGTGCTGGTg
hsa-miR-560 14.2665 -30.6 9.454300e-02 9.021140e-02 1.060340e-02 118 137
CCGCCGGCCGGCCGCGUGCG
|| ||||| | ||| |:||:
GGAGGCCGCCGGGCTCGCGT
Features
AFFY_Bovine Bt.1667.1.S1_at
EntrezGene 616156
GO GO:0005515
RefSeq_dna_predicted XM_868121
RefSeq_peptide_predicted XP_873214
spacer
spacer