spacer

Target Detailed View


Hit information for ENSBTAT00000000558

Gene Name NP_001069146.1
Transcript ENSBTAT00000000558
Gene ENSBTAG00000000435
Description hypothetical protein LOC514674 [Source:RefSeq_peptide;Acc:NP_001069146]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-146b-3p 19.1021 -27.4 8.204270e-03 8.170710e-03 1.021160e-03 142 164
GGUCUU-GACUCAGGUGUCCCGu
| :||| | |:| |||||||||
CAGGAACCAGGGACCACAGGGCc
bta-let-7d 18.9884 -24.56 5.091670e-03 5.091670e-03 9.988510e-08 88 108
uugaUACGUUGGAUGAUGGAGA
    :||| |||| ||||||||
ggagGTGCCACCT-CTACCTCT
bta-miR-16 18.8608 -20.53 9.341260e-03 9.297770e-03 3.273110e-04 241 261
cGGUUAUAAAUGCACGACGAu
 || | ||  |:||||||||
cCCCAAATAAATGTGCTGCTt
bta-miR-15a 18.5179 -19.64 1.320710e-02 1.320710e-02 3.677620e-05 243 261
uGUUUGGUAAUACACGACGAu
 ||||: |  ||||||||||
cCAAATAA--ATGTGCTGCTt
bta-miR-195 18.1925 -19.84 1.691090e-02 1.676870e-02 4.075910e-03 240 261
acGGUUAUAAAGACACGACGAu
  || | ||   |||||||||
gcCCCAAATAAATGTGCTGCTt
bta-let-7e 18.1749 -20.76 1.442080e-02 1.442080e-02 9.988510e-08 89 108
ugaUAUGUUGGAGGAUGGAGu
   :|:| |||| |||||||
gagGTGCCACCT-CTACCTCt
hsa-miR-9 18.101 -20.38 1.553280e-02 1.541280e-02 1.541280e-02 187 211
AGUAUGUCGAU--CUAUUGGUUUCU
| ||::| ||:  |||:|||||:|:
TGATGTAACTGGTGATGACCAAGGG
bta-let-7a 18.0788 -20.76 1.362040e-02 1.362040e-02 9.988510e-08 88 108
uugaUAUGUUGGAUGAUGGAGu
    :|:| |||| |||||||
ggagGTGCCACCT-CTACCTCt
bta-let-7c 18.0788 -20.63 1.435380e-02 1.435380e-02 9.988510e-08 88 108
uuggUAUGUUGGAUGAUGGAGu
    :|:| |||| |||||||
ggagGTGCCACCT-CTACCTCt
bta-miR-15b 17.8514 -18.28 2.269780e-02 2.244210e-02 3.677620e-05 242 261
acaUUUGGUACUACACGACGAu
   |||: |  ||||||||||
cccAAATAA--ATGTGCTGCTt
bta-miR-497 17.7377 -17.05 2.845550e-02 2.805450e-02 1.040860e-03 241 261
auGUUUGGUGUCACACGACGAc
  | || :| | |||||||||
ccCCAAATA-AATGTGCTGCTt
bta-let-7b 17.7377 -18.47 2.187030e-02 2.187030e-02 9.988510e-08 88 108
uuggUGUGUUGGAUGAUGGAGu
    :::| |||| |||||||
ggagGTGCCACCT-CTACCTCt
mmu-miR-322 17.624 -16.81 3.178170e-02 3.128200e-02 5.264060e-05 241 261
aGGUUUUGUACUUA-ACGACGAc
 || |||:|  ||| |||||||
cCCCAAATA--AATGTGCTGCTt
hsa-miR-612 17.5957 -28.05 4.190640e-02 4.104050e-02 4.104050e-02 51 74
uuccUCGAGUCUUCGGGACGGGUCG
    :|| :: : | ||||||||||
gcccGGCCTGTGCG-CCTGCCCAGC
hsa-miR-328 17.5103 -30.6 3.798320e-02 3.727090e-02 3.727090e-02 123 144
UGCCUUCCCGUCUCUCCCGGUC
:| ||:| | : | ||||:|||
GCTGAGGAGGGCACAGGGTCAG
hsa-miR-211 17.5103 -21.94 3.833340e-02 3.760800e-02 3.760800e-02 192 214
uccGCUUCCUACU-GUUUCCCUU
   | :: ||||| |||:|||||
taaCTGGTGATGACCAAGGGGAA
bta-let-7g 17.5103 -16.83 2.193770e-02 2.193770e-02 9.988510e-08 88 108
uugaCAUGUUUGAUGAUGGAGu
    ||:| | || |||||||
ggagGTGCCACCT-CTACCTCt
bta-let-7i 17.5103 -15.03 2.393070e-02 2.393070e-02 9.988510e-08 88 108
UUGUCGUGUUUGAUGAUGGAGu
:: :|::| | || |||||||
GGAGGTGCCACCT-CTACCTCt
bta-miR-98 17.5103 -15.53 2.283400e-02 2.257530e-02 4.985180e-07 88 108
UUGUUAUGUUGAAUGAUGGAGu
:: ::|:| || | |||||||
GGAGGTGCCACCT-CTACCTCt
hsa-miR-765 17.4891 -17.81 7.172690e-02 6.921490e-02 8.481660e-03 28 48
GUAGUGGAAGGAAGAGGAGGu
| ||  || ||| |||:|||
CCTCTGCTCCCTGCTCTTCCt
hsa-miR-424 17.2829 -13.29 4.055000e-02 3.973880e-02 4.833850e-05 239 261
aaguuuUGUACUUA-ACGACGAc
      | || ||| |||||||
agccccAAATAAATGTGCTGCTt
hsa-miR-622 17.2605 -23.83 3.108320e-02 3.060510e-02 5.863720e-04 97 120
cGAGGUUGGAGUC---GUCUGACa
 | :| ||||| |   |||||||
aCCTCTACCTCTGACACAGACTGc
hsa-miR-760 17.2423 -27.22 6.841190e-02 6.612430e-02 2.590630e-03 145 165
aggGGUGUCUGG-GUCUCGGc
   ||| :|||| |||:|||
gaaCCAGGGACCACAGGGCCt
hsa-miR-939 17.2262 -21.76 8.170840e-02 7.845940e-02 8.270100e-03 17 40
guggggGUCUCGGAGUCGAGGGGU
      :| | |||| ||||||::
atgaaaTACATCCTCTGCTCCCTG
hsa-miR-149 17.196 -29.02 5.378360e-02 5.236280e-02 2.470830e-02 124 145
ccCUCACUUCUGUGCCUCGGUCU
  ||| ||:|:||| |:|:|||:
ctGAG-GAGGGCACAGGGTCAGG
bta-let-7f 17.1692 -14.3 3.097850e-02 3.050360e-02 9.988510e-08 88 108
uugaUAUGUUAGAUGAUGGAGu
    :|:| | || |||||||
ggagGTGCCACCT-CTACCTCt
bta-miR-204 17.1692 -23.31 4.783380e-02 4.670780e-02 2.181620e-03 192 214
uccguaucCUACU-GUUUCCCUU
        ||||| |||:|||||
taactggtGATGACCAAGGGGAA
hsa-miR-924 17.1274 -14.86 3.380910e-02 3.324400e-02 3.324400e-02 1 17
cguUCUGUAGUGUUCUGAGa
   || ||  |||:|||||
---AGCCACGACAGGACTCa
hsa-miR-520a-5p 17.0319 -16.16 4.803390e-02 4.689850e-02 1.271770e-02 248 268
ucUUUCAUGAAGGGAGACCUc
  || ||:|| |::|:||||
taAATGTGCTGCTTTTTGGAt
mmu-miR-682 16.9176 -18.18 3.487020e-02 3.426920e-02 3.426920e-02 102 122
gucugaAGUGACACUGACGUC
      | ||   ||||||||
tacctcTGACACAGACTGCAG
hsa-miR-504 16.8281 -23.09 4.650460e-02 4.543980e-02 4.543980e-02 122 143
CUAUCUCACGUCUGGUCCCAGa
|:  |||   :|  |||||||
GGCTGAGGAGGGCACAGGGTCa
gga-miR-757 16.8033 -19.36 5.628550e-02 5.473080e-02 1.711280e-03 57 79
cuuaggGUAGAC--GUCGAGACg
      |: |||  ||||||||
cctgtgCGCCTGCCCAGCTCTGg
bta-miR-103 16.7435 -20.19 4.491930e-02 4.392540e-02 1.056530e-03 235 260
AGUAUCGGGACAUGU---UACGACGA
|:| |||||   |:|   :|||||||
TTAGAGCCCCAAATAAATGTGCTGCT
hsa-miR-296-5p 16.6889 -25.52 6.263560e-02 6.071430e-02 2.163200e-03 208 230
UGUCCUAAC--UCCCCCCCGGGA
| :||| ||  |  ||||||:||
AGGGGAATGAAACTGGGGGCTCT
hsa-miR-935 16.6303 -18.28 2.241670e-02 2.216730e-02 2.216730e-02 175 198
cgCCAUCGC-CUUCGCCAUUGACC
  |||  :|  | |  ||||||||
caGGTTCTGCCATGATGTAACTGG
hsa-miR-631 16.5746 -19.95 3.902900e-02 3.827720e-02 3.827720e-02 161 181
cgacuccaGACCCGGUCCAGa
        |||| ||||||:
ggcctcagCTGGCCCAGGTTc
hsa-miR-663 16.487 -26.86 8.272450e-02 7.939530e-02 3.232670e-03 38 59
cGCCAGGGCGCCGCGGGGCGGA
 :| ||:: | |||||| ||||
cTGCTCTTCCTGCGCCCGGCCT
mmu-miR-540-3p 16.3227 -21.88 6.786610e-02 6.561440e-02 1.957260e-04 94 113
gguccuAGCUGGAGACUGga
      || |||||||||
gccaccTCTACCTCTGACac
bta-miR-361 16.2596 -17.94 4.931940e-02 4.812290e-02 3.503820e-03 60 82
CAUGGGGACCUCU-AAGACUAUu
||:| ||||   |  ||||:||
GTGCGCCTGCCCAGCTCTGGTAc
hsa-miR-490-3p 16.2596 -19.43 4.933700e-02 4.813970e-02 4.813970e-02 160 181
gUCGUACCUCAGGAGGUCCAAc
 :|| |  : |   |||||||
gGGCCTCAGCTGGCCCAGGTTc
hsa-miR-619 16.2129 -22.15 6.414930e-02 6.213500e-02 1.044280e-02 157 180
UGACCCGUGUUUGUACAGGUCCAG
|| |||| : |:|  | ||||||:
ACAGGGCCTCAGCTGGCCCAGGTT
mmu-miR-763 16.1459 -18.23 8.420250e-02 8.075490e-02 2.761060e-02 56 77
CGGUGACCAAGAAGGGUCGAcc
|||  ||   || |||||||
GCCTGTGCGCCTGCCCAGCTct
hsa-miR-592 16.1459 -10.59 5.429230e-02 5.284480e-02 4.572800e-03 94 115
uguaguagcguauaACUGUGUU
              |||||||:
gccacctctacctcTGACACAG
hsa-miR-509-5p 16.1174 -12.8 7.150890e-02 6.901200e-02 8.437300e-03 104 124
acuaACGGUGACAGACGUCau
    || ||| | ||||||
cctcTGACACAGACTGCAGgc
bta-miR-17-3p 16.0929 -11.71 8.087270e-02 7.768890e-02 1.114050e-04 104 123
uguucacggaagUGACGUCa
            |||||||
cctctgacacagACTGCAGg
hsa-miR-562 16.0929 -12.66 5.954320e-02 5.780520e-02 1.050550e-02 243 262
cGUUUACCAUGUCGAUGAAA
 |||||      |||:||||
cCAAATAAATGTGCTGCTTT
hsa-miR-635 16.0647 -22.59 5.860130e-02 5.691730e-02 3.484040e-02 155 179
ccUGUAACAAAGUC-A-CGGGUUCA
  |||  |  |||| | |||||:||
ccACAGGGCCTCAGCTGGCCCAGGT
bta-miR-107 16.0322 -20.19 7.875850e-02 7.573690e-02 5.457200e-04 236 260
cUAUCGGGACAUGU---UACGACGA
 | |||||   |:|   :|||||||
tAGAGCCCCAAATAAATGTGCTGCT
hsa-miR-658 16.0266 -18.75 9.971800e-02 9.490740e-02 3.476310e-02 13 35
UGGUUGCCUGGAUGAAGGGAGGCGG
||: |: ||  ||| | ||||:||:
ACTCAT-GAAATACAT-CCTCTGCT
hsa-miR-596 16.0031 -18.97 8.774590e-02 8.400640e-02 9.405990e-03 106 126
gggcuccucggccCGUCCGAa
             |||||||
tctgacacagactGCAGGCTg
bta-miR-10a 15.9515 -16.45 4.988790e-02 1.203780e-03 1.203780e-03 142 164
GUGUUUAAGCCUAGAUGUCCCau
|| :||   ||: | ||||||
CAGGAACCAGGGACCACAGGGcc
hsa-miR-518d-5p 15.9185 -15.38 8.855970e-02 8.475150e-02 3.067730e-02 247 268
gucUUUCACGAAGGGAGAUCUc
   || ||||| |::|:|:||
ataAATGTGCTGCTTTTTGGAt
hsa-miR-599 15.863 -14.23 8.036110e-02 7.721690e-02 3.639880e-03 97 116
caaacuauuuGACUGUGUUg
          ||||||||:
acctctacctCTGACACAGa
bta-miR-10b 15.8384 -14.91 4.661810e-02 1.203780e-03 1.203780e-03 120 142
guguuuaagccaagaUGUCCCAu
               |||||||
caggctgaggagggcACAGGGTc
hsa-miR-933 15.8047 -22.05 4.073720e-02 3.991860e-02 1.940970e-03 34 55
cccucuCCAGAGGGACGCGUGU
      | |||:||||||| |:
ctccctGCTCTTCCTGCGCCCG
hsa-miR-598 15.8047 -11.06 3.632570e-02 3.567380e-02 3.567380e-02 172 193
acugcuacuGUUGCUACUGCAU
         | :| ||||:|||
gcccaggttCTGCCATGATGTA
hsa-miR-556-3p 15.691 -11.87 5.847240e-02 5.679570e-02 2.808320e-03 182 204
uuucUACUCGAUU-ACCAUUAUa
    ||||  ||| ||||:||:
tgccATGATGTAACTGGTGATGa
hsa-miR-492 15.6121 -18.62 8.782470e-02 8.407860e-02 1.236280e-02 160 182
UUCUUAGAACAGGGCGUCCAGGA
::|  ||   |  | |||||:||
GGGCCTCAGCTGGCCCAGGTTCT
hsa-miR-560 15.5181 -29.78 3.535520e-02 3.473750e-02 2.512440e-03 48 67
cCGCCGGCCGGCCGCGUGcg
 ||| |||||| |:||:|
tGCGCCCGGCCTGTGCGCct
hsa-miR-591 15.5181 -15.41 8.277990e-02 7.944630e-02 1.084980e-02 124 143
uGUUACUCUUGGGUACCAGa
 ::| |||::| || ||||
cTGAGGAGGGCACAGGGTCa
hsa-miR-589 15.3499 -16.82 9.651080e-02 9.199990e-02 1.172910e-02 164 184
GAGUCUCGUCUGCACCAAGAgu
|||||  ::| |  ||||||
CTCAG-CTGGCCCAGGTTCTgc
hsa-miR-652 15.0886 -21.44 6.147640e-02 5.962490e-02 2.064810e-03 79 99
guguugGGAUCACCGCGGUaa
      |||:| ||:||||
gtaccgCCTGGAGGTGCCAcc
Features
AFFY_Bovine Bt.4728.1.S1_at
EMBL BC122653
EntrezGene 514674
GO GO:0005622
GO GO:0005515
GO GO:0003725
GO GO:0003723
protein_id AAI22654
RefSeq_dna NM_001075678
RefSeq_peptide NP_001069146
UniGene Bt.4728
Uniprot/SPTREMBL Q0IIG6
spacer
spacer