The ENA genome assembly submission system

What is the ENA Genome Assembly Submission System?

The ENA Genome Assembly Submission System is a system that has been designed to support transfers of large data sets. Submissions of one to several hundred assemblies are well supported and most genome assemblies can be submitted to ENA via the new system. For exceptions see below. The new system aims to remarkably decrease the processing time of this type of sequences. If all submission steps are correctly performed, accession numbers can be released within a week. However, if errors are detected at any stage, the whole process can take weeks, depending on the errors. Taking into account that our processing time for genome assemblies before the launch of the new system was about 30-40 days, we are still able to offer a faster processing route through the new system.

What type of sequences can I submit to the ENA Genome Assembly Submission System?

Only genome assemblies that require Study & Sample registration should be submitted using the ENA Genome Assembly Submission System.

How do I submit my non-study genome assemblies?

For instructions please see the non-study submissions page

How does the ENA Genome Assembly Submission System work?

The ENA Genome Assembly Submission System will automatically create the database entries based on the information you provide during the different submission steps. Briefly, adding:

  • Information provided during the study registration;
  • Information provided during the sample registration; and
  • Information extracted from the files in the dropbox (AC* lines, annotation and sequences).

What are "the layers" of an assembly?

We refer to different layers of an assembly when we speak about

reads -> contigs -> scaffolds -> chromosome(s)

How long does it take to get the accession numbers for my genome assembly sequences submitted to ENA?

The time varies and will depend on the submission flow and the errors of each particular submission. If a submission is successful without any types of error (files and metadata are both fully correct), accession numbers can be provided within a week.

The submission process of genome assemblies to ENA

How can I submit a genome assembly to ENA?

To submit a new genome assembly you first need a submission account with us. If you don't have a submission account with ENA already, please register at https://www.ebi.ac.uk/ena/submit/sra/#home. Once you have the account, a genome assembly submission can be done in 4 steps:

  1. Preparing and uploading the corresponding files to your drop box with us (Webin box or era-drop-box)
  2. Study (project) registration
  3. Sample registration
  4. Assembly type definition

To a new submitter, we would recommend to follow the above submission steps in order to get familiar with the system. Nevertheless, we would like to remark that the order and timing of the above steps could be rather flexible. There are actually two restrictions only:

  • Step 1 can be done at any time but strictly before step 4
  • Steps 2, 3 and 4 must be done in this order although the study and sample registration steps can be saved and the submission process continued at any time.

Note: if you have all your files prepared and uploaded you can simply do steps 2-4 at the same time by loging into Webin, selecting the New Submission tab and then selecting ‘Submit assemblies’ option.

How can I register a STUDY for my genome assembly and get the PRJEBXXX requested?

To register a study, log into Webin and follow the steps below.

  1. Select tab "New Submission"
  2. Click "Register study (project)" or Click "Submit assemblies" if you have all data files ready
  3. Click "Next"
  4. Provide the requested information in each field. Since you are submitting an assembly, please click "yes" in "In this study, will you describe a genome assembly?" This will lead you to the definition of the organism associated with the study.
  5. Click "Submit".

A PRJEBXXXX identifier will be created and added to the list of your studies. This list can be seen and edited in the "Study" tab at any time.

I have already submitted raw data (reads) of my assembly to ENA. Can I use the same PRJEBXXX to submit the assembly (either contigs or scaffolds or chromosome)?

Yes, you must use the same PRJEBXXX since it is the same sequenced organism although they are different level of the genome assembly.

At the study registration, the name of my sequenced organism is requested. At what taxonomy level should I provide the organism name?

Please provide the species level scientific name. For prokaryotes, if you do not know the species, please provide <genus> sp. <strain>, e.g. Clostridium sp. strain_33. If a strain-level name/taxon id is already available, this may still be used.

I enter the organism details in the organism field but the organism can not be found. What do I do?

Please visit this page.

Should I register a study for each sequenced organism?

You should register a study for each different SPECIES that is sequenced. You should not register different studies for multi-strains of the same sequenced species.

I have sequenced multiple strains of the same organism. Should I register one study for all strains or should I register each strain individually?

If you have sequenced multiple strains of the same species, you should register only one study since genome assemblies of multiple strains of the same organism can be associated to the same study. You will be able to specify the individual strains in the sample registration step.

I plan to submit annotation of the genome assembly. Where can I select my preferred locus tag prefix during the study registration?

If you plan to submit annotation, you must define a locus tag prefix during the study registration step. During the study registration, by selecting 'Yes' in "In this study, will you provide functional genome annotation?" you will be able to create a preferred locus tag or one will automatically be created for you. You must use only this locus tag prefix if functional annotation is provided. Otherwise, the system won't be able to process the files during the submission.

Locus tag annotation: /locus_tag="prefix_identifier"

Examples:

  • /locus_tag="ANAT_1104"
  • /locus_tag="ANAT_1105"
  • /locus_tag="ANAT_p1104" (plasmids)

For more information about the /locus_tag qualifier, visit here.

How can I register a SAMPLE for the genome assembly?

After you have registered a study, you can link one or more sequenced samples to it.

The basic steps for the registration of the sequenced sample(s) are:

  1. Log into https://www.ebi.ac.uk/ena/submit/sra/#home
  2. Select the "New Submission" tab
  3. Click "Submit assemblies"
  4. Click "Next"
  5. Select the study associated to this submission
  6. Click "Next"
  7. Select the checklist that you wish to use for your sample submission (the ENA default sample checklist is the minimum information required for the sample)
  8. Click "Next"
  9. Provide the requested information in each field. Note that you can expand the menus on the left (Pointer to physical materials, organism characteristics, etc).
    Note:
    • Provide the species level scientific name
    • To create the database entries, both organism name and strain information will be taken exclusively from this step so you must provide the strain name(s) here in order to be included in the entries.
  10. Click "Next"
  11. Click "Add" and check/edit all information provided
  12. Click "Next" and you will be ready for assembly submission.

How can I make the ASSEMBLY DEFINITION of the genome to be submitted?

Once you have uploaded your files to your drop box (Webin-NNNN or era-drop-XXX) and finished the study & sample registration, you will be automatically directed to the assembly definition & submission page. In the case that you had registered the sample a while ago, you have to log in again and confirm the sample information previously provided to be able to go to the assembly submission page (start selecting the corresponding PRJEBXXX in the Study tab).

During this step, you will define the assembly to be submitted and the files that the genome submission system should look for and pick up from your drop box. So the files must already be there at this stage. The assembly submission page consists of a number of questions for the system to understand what type of assembly you are submitting (contigs/scaffolds/chromosomes). The basic steps here are:

  1. Answer the questions carefully in order to define the assembly type to be submitted. Please note that mistakes in the assembly definition will lead to system errors so be careful when defining the assembly type and the file(s) that the system should look for in your drop box. At this stage you will also need to provide the md5 checksum of each uploaded file in your drop box. For each file, the system will compare it with the md5 checksum of the file we receive to make sure it is exactly the same.
  2. Click "Next"
  3. Click "Add" and check/edit all information provided
  4. Click "SUBMIT". Your assembly has now been submitted to ENA!

If the metadata validates successfully a "Congratulations" page will be displayed with a summary of the following accessions: Study, Sample and Analysis ID. After the validation of the data (submitted files) is completed, you will receive an e-mail with the contigs/scaffolds/chromosome(s) accession numbers. For further communication with us regarding each submission, please refer to the ANALYSIS_ID provided at the end of the assembly submission (ERZXXXXX).

During the submission, I’ve been asked to select a checklist for my sample. Which one should I select?

Sample checklists have been developed tailored to and compliant with minimum reporting requirements of different scientific communities ENA collaborates with. The aim is to work with communities on standardised data models so that sequence data discoverability and utility is enhanced for the scientific community.

ENA recommends that submitters use the checklist closest to the standard of their interest but if you don’t need to make your sample standard compliant, please select the last checklist “ENA default sample checklist”.

What can I do to minimise the errors during the processing of my genome assembly submitted to ENA in order to get the accession numbers as soon as possible?

The preparation of the files is a critical step to avoid errors during the processing of your genome assembly submission. Please take the necessary time in this step. Please also validate your flat files and AGP files.

The preparation of the files to be submitted to ENA

What type of files should I prepare to submit a genome assembly to ENA?

Which files to prepare will depend on the layer of the assembly you plan to submit (contigs, scaffolds or chromosomes) and whether or not you have functional annotation. Briefly:

  • contigs, scaffolds or chromosome(s) with NO annotation: prepare either a fasta file or a flat file.
  • contigs, scaffolds or chromosome(s) WITH annotation: a flat file must be prepared.

In addition to the above, you can also submit the relevant AGP file(s) and we will build the next layer of the assembly.

Should I prepare fasta or flat files to submit to the ENA Genome Assembly Submission System?

If you have annotation, you must submit flat files. If you do not have annotation, you can submit either flat files or fasta files with the sequences.

What different type of genome assemblies can I submit to ENA and what files for each submission?

During step IV of the submission process (assembly definition), we provide an interactive way to tell you what files you must upload depending on the assembly information you have. In the Assembly tab during the submission process, you will be asked to answer the following questions:


Does the assembly contain contigs? Yes/No
Are the contigs annotated? Yes/No
Please choose one of the following format for the contig submission: Flatfile/Fasta
Are you submitting unlocalised contigs? Yes/No

Does the assembly contain scaffolds? Yes/No
Are the scaffolds functionally annotated? Yes/No
Are you submitting unlocalised scaffolds? Yes/No

Does the assembly contain chromosomes? Yes/No
Are the chromosome functionally annotated? Yes/No

Once you have answered the questions and clicked NEXT, the system will tell you exactly what files you must upload. At this point, you have to state as well the file names and the MD5 checksum to check their integrity. Please note that the files must satisfy certain standards (either flatfiles or Fasta files) to be successfully processed. We strongly encourage our submitters to check 'The preparation of the files to be submitted to ENA' section in order to avoid delays in the processing.
You have a wide range of choices how to do a genome assembly submission depending on the sequencing files you have. Below are some examples of assembly types that can be submitted to ENA. Each case describes only one submission to ENA (one Analysis ID=ERZXXXX identifier will be provided at the end of the submission).


• You can submit only the contigs of a WGS. Files to submit: one file with all the sequences.
• You can submit the contigs of a WGS and the scaffold AGP file so we will build the scaffolds. Files to submit: one file with all the sequences + one scaffold AGP file.
• You can submit the scaffolds only. Files to submit: one file with all the sequences.
• You can submit the contigs, the scaffold AGP to build the scaffolds and the chromosome AGP file to build the chromosome. Files to submit: one file with all the sequences + one scaffold AGP file + one chromosome AGP file + one chromosome list file.
• You can submit the scaffolds and the chromosome(s) for the same organism. Files to submit: one file with all the sequences.
• You can submit one or more than one chromosome (i.e. replicons, including plasmids) for the same organism. Files to submit: one file with the sequence(s) + one chromosome list file.


Special cases:
• You have a main prokaryote chromosome at WGS level (contigs) and one or more plasmids for the same organism that is/are fully assembled/completed.  Files to submit: ONE file with all contigs for the main chromosome AND the contigs for plasmid(s) + one AGP file for each plasmid so we can build the complete plasmid(s). This way, both the main chromosome and the plasmid(s) will be connected to the same genome assembly.
• You have the full sequence of a main prokaryote chromosome and one or more plasmids for the same organism which is/are also fully assembled/completed.  Files to submit: ONE file with all the sequences (main chromosome and plasmid(s)).
• If you have a query about your genome assembly submission that is not covered on our webpage, you can contact us on datasubs@ebi.ac.uk.

I want accession numbers for the contigs and for the scaffolds of my assembly? Shall I start two different submissions to ENA?

No. If you wish to have accession numbers for contigs as well as scaffolds, please submit a contig file and a scaffold AGP file during the same submission process and we will build the scaffolds based on the submitted AGP file.

I have the sequences ready to submit and I plan to submit the annotation in the future. Can I submit the sequences now and the annotation later on?

Yes, you can. However, if the annotation will be ready soon you should consider delaying the submission of the sequences and prepare & submit sequences and annotation together. The genome assembly system is designed only for submissions and not for updates. Therefore, if you use it to submit only the sequences, the annotation submitted at a later date will considered as an update and will be processed manually which will take longer.

How do I prepare a correct flat file to be submitted to the ENA Genome Assembly Submission System?

Header

Below is an example of a correct flat file header to be submitted to the ENA Genome Assembly Submission System. Regarding the flat file header format, please note:

  1. The header of the flat file must be correctly formatted in order for the system to accept it. However, note that the ONLY information extracted from the flat file header to create the final entries is the AC * line and the topology (circular or linear). The Study (Project) and Sample registration steps provide the additional information that will be linked to your sequences (i.e. source information such as organism, strain, etc.).
  2. The sections between {} in the example below must be changed and the {} symbols then deleted.
  3. After completed the {} sections, the rest of the header can be left as it is in the example.
  4. XXX does not mean free text, it has to be retained as XXX.
  5. The first XXX of the ID line must be XXX, otherwise the system will fail since it is the future location of the accession number.
  6. The AC * line is MANDATORY in each flat file and it must contain the unique entry name for each sequence.
  7. There should be a AC line and a AC * line. Note in the example below the strict format of each one of them.
  8. Entry names (in AC * line) must not include spaces, dots or |.
    • Valid examples:
      • contig_TRWS-Ecoli_101
      • scaffold100
      • Chr_1
    • Examples of wrong contig/scaffold/chromosome names that stop the system:
      • contig TRWS-E.coli_101 (note presence of spaces and dots)
      • Strept|str_AB7|contig2 (note presence of |)
      • chr 1 (note presence of spaces)
  9. The format of the submission date DD-MON-YYYY, eg 01-JAN-2014
  10. If you wish to add a citation title to your entries, contact update@ebi.ac.uk, preferably after it is published (see Updates Section).

Example of a flat file header:

ID   XXX; XXX; {circular OR linear}; XXX; XXX; XXX; XXX.
XX
AC   ;
XX
AC * _{name of each contig or scaffold or chromosome here are MANDATORY}
XX
PR   Project:PRJEB1234;
XX
DE   Brief description of the sequence
XX
KW   .
XX
XX
RN   [1]
RP   1-{seqlength}
RA   XXX;
RT   ;
RL   Submitted (DD-MON-YYYY) to the INSDC.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..{seqlength}
FT                   /mol_type="genomic DNA"
FT                   /organism="{scientific name}"

 

Annotation

For annotation guidelines please refer to our online documentation. Please validate the flat files you have prepared using the ENA flat file validator prior to uploading.

How do I prepare a correct fasta file to be submitted to ENA Genome Assembly Submission System?

Below is an example of the correct format for a fasta file to be submitted to ENA Genome Assembly Submission System. Please note:

  1. The {entry_name} is a UNIQUE and MANDATORY name for each contig or scaffold or chromosome sequence submitted in a fasta file.
  2. The sections between {} in the multi fasta file example provided below must be changed and the {} symbols then deleted.
  3. No empty lines should be present between each fasta file. Otherwise, the system fails.
  4. Entry names must not include spaces, dots or |.
    • Valid examples:
      • contig_TRWS-Ecoli_101
      • scaffold100
      • Chr_1
    • Examples of wrong contig/scaffold/chromosome names that stop the system:
      • contig TRWS-E.coli_101 (note presence of spaces and dots)
      • Strept|str_AB7|contig2 (note presence of |)
      • chr 1 (note presence of spaces)

Example for a multiple sequence fasta file:

>{entry_name}
aaattggccaattggccaaattggccaattggccaaattggccaattggccaaattggccaattggcc
tgtgggccttcccaattggccaattggcccccaaattaattggccaaattggtattggccaaattgggg
aaattggccaattggccaaattggccaattggccaaattggccaattggccaaattggccaattggcc
>{entry_name}
aaattggccaattggccaaattggccaattggccaaattggccaattggccaaattggccaattggcc
tgtgggccttcccaattggccaattggcccccaaattaattggccaaattggtattggccaaattgggg
aaattggccaattggccaaattggccaattggccaaattggccaattggccaaattggccaattggcc
>{entry_name}
aattggccaattggccaaattggccaattggccaaattggccaattggccaaattggccaattggcc
tgtgggccttcccaattggccaattggcccccaaattaattggccaaattggtattggccaaattgggg
aaattggccaattggccaaattggccaattggccaaattggccaattggccaaattggccaattggcc

 

When should I submit an Unlocalised.txt file?

You have to submit an unlocalised.txt file (see assembly description submission) if your assembly has at least one chromosome defined and you have at least one unlocalised contig or scaffold (i.e. you don't know the exact location of the contigs(s)/scaffold(s) on the chromosome but they certainly belong to that chromosome).

If there is no chromosome (submitted directly or by an AGP file), do not submit an Unlocalised.txt file.

How can I prepare a correctly formatted Unlocalised.txt file?

Briefly, this has a list of the unlocalised contigs or scaffolds and a second column to indicate to what chromosome they belong to. For details and examples, please visit the assembly description submission page

When should I submit a chromosome list file?

You have to submit a chromosome list file if your assembly has at least one chromosome defined. If there is no chromosome, do not submit a chromosome list file.

How can I prepare a correctly formatted chromosome list?

Briefly, this is a full list of the names of chromosome(s) defined in the assembly. The first column must list the “entry names” that are in the AC * line of flat files or in the sequence names of the fasta files. Note that the entry names also have to be identical to the ones used in a chromosome AGP file if there is one. The second column of the chromosome list file simply enumerates the chromosome(s) (either Latin or Roman numbers), and finally the third column indicates the chromosome type (chromosome, plasmid). For details and examples, please go here.

When should I submit an AGP file?

You should submit an AGP file if you want to create more than one level of an assembly. For example: submission of contigs and a scaffold AGP file will lead to build and accession of contigs and scaffolds records; submission of scaffolds and a chromosome AGP file will lead to build and accession of scaffolds and chromosome(s).

How can I prepare a correct AGP file?

For AGP description and specifications please visit NCBI.

Please note that you must validate the AGP file with the validator provided. Also note that AGP files where all scaffolds are made from single contigs are NOT accepted by the system. Please do not submit AGP with these characteristics since it will delay the processing of your assembly and the release of the accession numbers.

Uploading the genome assembly files to be submitted to ENA

Where should I upload the files?

Data files need to be uploaded to our ftp area. To do so, you need to use your submission account name (Webin-NNNN or era-drop-XXX) and your password that will allow you to upload files into your drop box in the ENA ftp area. Please note that former era-drop-XXX boxes have now a Webin-NNNN associated with but you can still use the era-drop-box if you have one.

How can I upload the files?

You can upload the files to your drop box (Webin-NNNN or era-drop-XXX) by using different protocols. For more details visit http://www.ebi.ac.uk/ena/about/sra_data_upload.

I have problems uploading the files to my drop box. Where can I get help?

If you have IT issues uploading your files, please contact directly your IT department. We can only advise about issues at our end.

I have uploaded the files of my genome assembly to my drop box or my era-drop-box. Is that all I have to do to submit my genome assembly to ENA?

No. Uploading the files to your drop box or era-drop-box is NOT equivalent to submitting the assembly to ENA. After you have a) registered the study and the sample b) defined the type of the assembly and c) specified what files the genome assembly system should look for and pick up from your drop box, then the genome assembly system will create automatically the database entries, extracting information from the files you have uploaded to your drop box (Webin-NNNN or era-drop-XXX) and from the study & sample registration.

For this, files must be already in the drop box when submitting. Please note once again that uploading the files to your drop box (Webin-NNNN or era-drop-XXX) is NOT equivalent to submitting the assembly.

Following up a genome assembly submission to ENA

I have submitted a genome assembly to ENA using the ENA Genome Assembly Submission System and I have not received any news on the status of my submission for some days. What should I do?

The processing time is very variable depending on how many submissions we have received at the time of your submission. After the submission, if you do not receive any e-mails with either a request to correct the error(s) detected by us or with the accession numbers, please wait 7 days before contacting us about your submission. Do not forget to add the ERZXXXXX identifier in the subject line of your e-mail to datasubs@ebi.ac.uk.

I have submitted a genome assembly and I have received an e-mail with the message error "Invalid file checksum". What should I do?

The error message points out that the md5 checksum you have stated during the assembly submission for the involved file(s) is different from the one we calculate in the received file(s). This could be to either corrupted file(s) during the uploading process or due to wrong md5 checksum(s) provided. To resolve this:

  1. Check both the sequence file(s) involved and the corresponding md5 files mentioned in the error message and make the necessary corrections.
  2. Re-upload the affected file(s) (both sequence and md5 files) into your Webin box (Webin-NNNN or era-drop-XXX) with the same file name(s).
  3. E-mail datasubs@ebi.ac.uk and let us know that you have done this:
    • To: datasubs@ebi.ac.uk
    • Subject line: Invalid file checksum: files re-uploaded for ERZXXXXX (cite the ERZ identifier)

The system will automatically pick up the new uploaded file(s) from the drop box/era-drop box used and if they are now OK, the pipeline will be able to continue the process. Please DO NOT re-submit by logging into the assembly submission system (where you have project and sample registration and assembly submission).

IMPORTANT NOTE: We strongly recommend to upload file(s) using our Webin uploader because it minimizes the “Invalid file checksum” error.

Update/corrections to ENA genome assembly submissions

I have to update a genome assembly previously submitted to ENA. Can I use the ENA Genome Assembly Submission System for that?

No. The ENA Genome Assembly Submission System is only for new submissions.

How can I update a genome assembly I have previously submitted to ENA?

For ENA genome assemblies updates, please e-mail update@ebi.ac.uk with the update request under the following format:

Accession Numbers (contigs/scaffolds/chromosomes):
Current text:
Reason for change:
Proposed new text:

 

If your update involves a large number of entries/features, please copy all the involved entries from the database, make the necessary changes in each file and send them in only one flat file (PRJEBXXX_update.embl) to update@ebi.ac.uk. If the file is too large to be sent by e-mail, please upload it to your ENA drop box (Webin-NNNN or era-drop-XXX) AND notify us by e-mailing update@ebi.ac.uk.

I would like to change the release date of a study (PRJEBXXXX) and the associated entries submitted to ENA. What should I do?

The status of a study and its associated sequence records is coupled in ENA and controlled by the status of the study. Whether you wish to release confidential data into the public domain or extend the release date of confidential data, you need to edit the status of your study (PRJEBXXXX; ERPXXXXXX) in Webin. This change will automatically affect all associated sequences under the study. Please note that the change will be visible in the ENA browser within 24h.

  1. Log into your Webin submission account: https://www.ebi.ac.uk/ena/submit/sra/#home
  2. Go to the 'Studies' tab and select your study of interest
  3. Click on the 'pencil' next to the date in the 'Release data' column, this will open a calendar to allow you modify the date
  4. Change the date to the new release date (this can be the same day which will change the 'Status' from 'confidential' to 'public' or it can be set to another date in the future to extend the release date).
  5. Press the 'Update' button to save the change

The manuscript where the genome assembly submitted to ENA was described has been accepted in a journal. I would like the entries to display the full journal citation. How should I proceed?

After you have the full reference of the published paper, please edit your PRJEBXXXX information and add the pubmed reference there. In addition, e-mail update@ebi.ac.uk with the text shown below so we can add the information to the entries associated to that PRJEB.

E-mail TO: update@ebi.ac.uk
SUBJECT LINE: Adding a published citation to a Genome Assembly Submission - PRJEBXXXX
E-MAIL BODY:
Please add the following citation to the listed accession numbers.
Paper title:
Study accession number: PRJEBXXXX
Accession number range for contigs: (if relevant)
Accession number range for scaffolds: (if relevant)
Accession number range for chromosome(s): (if relevant)

 

I have realised that I made a mistake in the file(s) of a genome assembly that I have just submitted to ENA (I have already received the ERZXXXX identifier of the submission). Can I upload the file(s) again?

No. Since the system process starts immediately after the submission has been received, uploaded files to the drop box must not be changed once the submission has been done. If eventually we detect errors in the file(s), we may contact you to correct them. Only in these cases, you are allowed to make changes in the files of your drop box related to this submission.

I have realised that I made a mistake during the sample registration of a genome assembly that I have already submitted to ENA (I received the ERZXXXX identifier of the submission). Can I go to the sample tab and edit it in order to correct the sample registration?

No. Please do not make changes in the sample registration after submission if you have not been asked by us to do so. There are two possible case scenarios:

  1. You have not received the accession numbers of the contigs/scaffolds/chromosomes yet. Please e-mail datasubs@ebi.ac.uk describing the situation and depending on the stage the submission process we will advise.
  2. You have already received the accession numbers of the contigs/scaffolds/chromosomes. In this case, the change in the sample information is considered as an update of the submission. Please e-mail update@ebi.ac.uk with the update request under the following format:

     

    Accession Numbers (contigs/scaffolds/chromosome(s)):
    Current text:
    Reason for change:
    Proposed new text: