Trace format

Capillary electrophoresis trace data are presented in fasta and fastq formats and the metadata in XML format. The fastq and fasta formats are described in detail below and are available through the ENA Browser. For more details about the metadata please refer to the Trace Archive RFC.

Fastq format

The fastq file format is defined below with field descriptions:

@ENA<trace accession>|<trace name>
<bases>
+
<phred qualities, ASCII encoded starting with '!'>
Field Description
<trace accession> The Trace accession.
<trace name> The submitted provided trace name.

Example:
http://www.ebi.ac.uk/ena/data/view/TI1&display=fastq

@ENA|TI1|G10P69425RC6.T0
GGTAGGTTGTATTGGGGGNGGNGCTACNNCTTGTGTTTNGGTAGGTCTGAACTTCGGGGN
AATTNTACACAACCTAGNAAANAGTCTACCTTAAAGGTGTTTCATCTCCACCTCTGATTT
TGCAAAACTCAGATTCCTTCTCAGCAACCCAAAGGTGGAGCCCGGACTAGATCGCTAGAT
TGACCTTATACGGGATGGCCAACACTCCTGATGTGCCCCACTAGAGGATCTATCTGCCTG
GACATACATATGGGCGAACTGCAACTGACCAAAGACAGCACTCGCGGGAGTATACTGCTA
TGGACACCTGTGCAATATGTATAAGCTCTACGGAAAGTGTGCATTGTTCAATACTACCTT
ATTTCACCCAACTAACTTATTGTGCTTTCTGATACATCACTAATAAGGATATTTGGGATA
ACTGGAAATTCCTATAACTTGCTTTTCTCACACATCAGAACAAAGGAGCTCTCTGGTCTA
CGTTACAAAGACAGTGCTGAGGGCCAGAGATTACCTTCACATTTTCATGAAACAAACTCA
TACATGCTTCTTTTTTATATATCCGGTCTGCGATCCCACATGACTCTGAACGTATGAATC
ATTAAACAAGAATTCTAAAGCGCTCTTGCTTTACTAATAACAGGAGCTCGAACGTGCATC
TACTAGTTTGGTCTGACTAAGAGAGATTCTACCTCAGGGATGAGAACCGACAGCTNTGAG
TGAAGAGGCATTATCAAAAGGACACAAGCGTTACGCTGTCCTCTGACAT
+
''%''')%%%%(.%!%!%'(%!!%,)))%'%!%%%%%%'''%%++%!
%))%!%(%%%%)%!%/%!%)0/,)')0))''))''(')+/******-))))))++
*-)))***1+--3+*))***+-()***,./))''))-3883/-***2*+--,/--...++
**,,2/.,)))**-6..-+*,+..,+..**'')*111++)))))),+-+++..33NNN=.
.***-+++33-,++++++,6/0/8/***,,/.1.--**++.*+.++,,+++*/***/0,+
*--088/-----,,3/316,-+++,,+++****,,,++++**+**-+++++0+--///.-
..1*))0*,,,-**+++2,,--.1-*****//4,+-+++,/355.+,+//33331++,-+
./0+.+-0+++*,+++5/++/5655+))*45==<3++**))))(()+++))))))***))
'')))''(-2*******)*++.+,++*****''),----.,+*))*))''))+)**,**1
+++++*++/,--.4-.,,,,,..-.--++++++3-,/-++++****)0,*))+86++)))
+)*++-/)).)*05(())*))((/0+**++*)))))**((-*('''))*+)*,,,,((()
***))**671**))))**+-28+**(((,+,++**(((*('''**(*(((*,,/%!%-%(
(*)(**((()))-(((((((*,,,,)),*)***'',''(()(((,,)))

 

Fasta format

The fasta file format is defined below with field descriptions:

ENA<trace accession>|<trace name>
<bases>
Field Description
<trace accession> The Trace accession.
<trace name> The submitted provided trace name.

Example:
http://www.ebi.ac.uk/ena/data/view/TI1&display=fasta

>ENA|TI1|G10P69425RC6.T0
GGTAGGTTGTATTGGGGGNGGNGCTACNNCTTGTGTTTNGGTAGGTCTGAACTTCGGGGN
AATTNTACACAACCTAGNAAANAGTCTACCTTAAAGGTGTTTCATCTCCACCTCTGATTT
TGCAAAACTCAGATTCCTTCTCAGCAACCCAAAGGTGGAGCCCGGACTAGATCGCTAGAT
TGACCTTATACGGGATGGCCAACACTCCTGATGTGCCCCACTAGAGGATCTATCTGCCTG
GACATACATATGGGCGAACTGCAACTGACCAAAGACAGCACTCGCGGGAGTATACTGCTA
TGGACACCTGTGCAATATGTATAAGCTCTACGGAAAGTGTGCATTGTTCAATACTACCTT
ATTTCACCCAACTAACTTATTGTGCTTTCTGATACATCACTAATAAGGATATTTGGGATA
ACTGGAAATTCCTATAACTTGCTTTTCTCACACATCAGAACAAAGGAGCTCTCTGGTCTA
CGTTACAAAGACAGTGCTGAGGGCCAGAGATTACCTTCACATTTTCATGAAACAAACTCA
TACATGCTTCTTTTTTATATATCCGGTCTGCGATCCCACATGACTCTGAACGTATGAATC
ATTAAACAAGAATTCTAAAGCGCTCTTGCTTTACTAATAACAGGAGCTCGAACGTGCATC
TACTAGTTTGGTCTGACTAAGAGAGATTCTACCTCAGGGATGAGAACCGACAGCTNTGAG
TGAAGAGGCATTATCAAAAGGACACAAGCGTTACGCTGTCCTCTGACAT

Latest ENA news

11 Oct 2017: Read data download issues resolved

Read data download issues previously affecting ftp.sra.ebi.ac.uk and fasp.sra.ebi.ac.uk services now resolved.

06 Oct 2017: ENA read data download issues

Issues with read data download from ftp.sra.ebi.ac.uk and fasp.sra.ebi.ac.uk

04 Oct 2017: ENA Release 133

Release 133 of ENA's assembled/annotated sequences now available