FASTA file format

FASTA files are commonly used when submitting sequences to ENA.  The header must hold the entry name when the sequence is being submitted as part of a genome assembly submission, however the header content is not important for non-assembly sequence submissions.

Genome assembly submission example

The entry_name used in the header must be unique in a genome assembly submission.  The FASTA file then follows the format:

>entry_name 
{SEQUENCE} 

 

Example:

>contig1 OR scaffold1 OR chromosome1
GATCAACGCAAAGGACTAAGCACTGCTGCCAAAAGCCACCAGCCCCAGAGACAACAGAGG
CTCCCAAATTTCTAGCCTCTGATCTCTGCCTCGGAACATTCTTGGGTCAAAATAAATGTG

Latest ENA news

11 Oct 2017: Read data download issues resolved

Read data download issues previously affecting ftp.sra.ebi.ac.uk and fasp.sra.ebi.ac.uk services now resolved.

06 Oct 2017: ENA read data download issues

Issues with read data download from ftp.sra.ebi.ac.uk and fasp.sra.ebi.ac.uk

04 Oct 2017: ENA Release 133

Release 133 of ENA's assembled/annotated sequences now available