ID W22040; SV 1; linear; mRNA; EST; HUM; 614 BP. XX AC W22040; XX DT 09-MAY-1996 (Rel. 47, Created) DT 04-MAR-2000 (Rel. 63, Last updated, Version 2) XX DE 60E3 Human retina cDNA Tsp509I-cleaved sublibrary Homo sapiens cDNA not DE directional, mRNA sequence. XX KW EST. XX OS Homo sapiens (human) OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; OC Homo. XX RN [1] RP 1-614 RA Macke J., Smallwood P., Nathans J.; RT "Adult Human Retina cDNA"; RL Unpublished. XX DR MD5; 1207a89c5656b433f1530312a18a468e. DR UNILIB; 542; 432. XX CC On Apr 14, 1993 this sequence version replaced gi:785648. CC Contact: Dr. Jeremy Nathans CC Dr. Jeremy Nathans, Dept. of Molecular Biology and Genetics CC Johns Hopkins School of Medicine CC 725 North Wolfe Street, Baltimore, MD 21205 CC Tel: 410 955 4678 CC Fax: 410 614 0827 CC Email: jeremy_nathans@qmail.bs.jhu.edu CC Clones from this library are NOT available. CC PCR PRimers CC FORWARD: CTTTTGAGCAAGTTCAGCCTGGTTAAGT CC BACKWARD: GAGGTGGCTTATGAGTATTTCTTCCAGGGTAA CC Seq primer: GGGTAAAAAGCAAAAGAATT. XX FH Key Location/Qualifiers FH FT source 1..614 FT /organism="Homo sapiens" FT /lab_host="E. coli strain K802" FT /mol_type="mRNA" FT /sex="mixed (males and females)" FT /dev_stage="adult" FT /clone_lib="Human retina cDNA Tsp509I-cleaved sublibrary" FT /tissue_type="retina" FT /note="Organ: eye; Vector: lambda gt10; Site_1: EcoRI; FT Site_2: EcoRI; The library used for sequencing was a FT sublibrary derived from a human retina cDNA library. FT Inserts from retina cDNA library DNA were isolated, cleaved FT with Tsp509I, size selected, and cloned into lamda gt10. FT Individual plaques were arrayed and used as templates for FT PCR amplification and these PCR products were used for FT sequencing." FT /db_xref="taxon:9606" FT /db_xref="UNILIB:542" XX SQ Sequence 614 BP; 125 A; 136 C; 188 G; 148 T; 17 other; aagtccaagg tgaattggct ggaaaatgtc cctgaagnct ggatngacac ctgagcannc 60 ttccnagtcc tgggaaatgt ggctgctcca tatttggaca gagcatggag agccaccact 120 gtgtcctggg tggaggagaa accgccctgg gcattctgct gcttcgtgat ccacttcacg 180 atgttggttg cagaggtcag gtcctccgag gttggggctg gctgggccgt gagataagcg 240 aggagcacat aggatgtcat ctccacctca gcagagggag cctggggttc gtaaaaatgc 300 cccactgggg ccttgggttt cttgagggcg ctcccatggn aaagagttgt ctttcttcac 360 agcttcctca ttaagtgact tgagtacttc cttcctcttg tcctggttac ctgccagggc 420 aaaaagcata ggccagcang tgctttgggt ttattcatng gttgccatgg tccccttctt 480 ggtgttgtct tccccagggc ttgattccca ggnaaaaaca ggggaattgg ggacaacagg 540 ggtgantgga ttgtganang gatcntccag aagggngatg ggggattttg ggggggaggg 600 gcaaacactn cnnc 614 //