ID JX999984; SV 1; linear; genomic DNA; STD; FUN; 234 BP. XX AC JX999984; XX DT 12-FEB-2013 (Rel. 115, Created) DT 12-FEB-2013 (Rel. 115, Last updated, Version 1) XX DE Sarcodon sp. NH-2013a isolate J16 internal transcribed spacer 1 and 5.8S DE ribosomal RNA gene, partial sequence. XX KW . XX OS Sarcodon sp. 'pseudoglaucopus' OC Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; OC Thelephorales; Thelephoraceae; Sarcodon; unclassified Sarcodon. XX RN [1] RP 1-234 RA Hogberg N., Nitare J.; RT "Swedish species of butchered Sarcodon-a preliminary report"; RL Sven Mykol Tidskr 0:0(2013). XX RN [2] RP 1-234 RA Hogberg N., Nitare J.; RT ; RL Submitted (24-OCT-2012) to the INSDC. RL Forest Mycology & Plant Pathology, Swedish University of Agricultural RL Sciences, Biocentre, Uppsala SE75000, Sweden XX DR MD5; 224ed5863a7a7ab60893f9d0dd52163b. DR Unite; 371638. XX CC ##Assembly-Data-START## CC Assembly Method :: DNA STAR v. 2009 CC Sequencing Technology :: Sanger dideoxy sequencing CC ##Assembly-Data-END## XX FH Key Location/Qualifiers FH FT source 1..234 FT /organism="Sarcodon sp. 'pseudoglaucopus'" FT /isolate="J16" FT /mol_type="genomic DNA" FT /PCR_primers="fwd_name: its1f, fwd_seq: FT cttggtcatttagaggaagtaa, rev_name: its4, rev_seq: FT tcctccgcttattgatatgc" FT /db_xref="taxon:1284402" FT misc_RNA <1..>234 FT /note="contains internal transcribed spacer 1 and 5.8S FT ribosomal RNA" XX SQ Sequence 234 BP; 44 A; 52 C; 59 G; 79 T; 0 other; cgtttgggtt aagttggggg ttgttgctgg ttcttttggg catgtgcaca ccttgactcc 60 aagcgttccg agttctttct tcacaccctt gtgcaccatc tgtagctggg gatgatcacg 120 aagcctttgg gtttcgaatg cctcggctac gaagttttgc tacacccccc tttgtaaaag 180 tttattggaa tgtttgtaaa tgcgtcttcg atggcgcgaa tcgaatacaa cttt 234 //