ID   GU564450; SV 1; linear; genomic DNA; STD; PLN; 289 BP.
XX
AC   GU564450;
XX
DT   22-FEB-2011 (Rel. 107, Created)
DT   15-NOV-2011 (Rel. 110, Last updated, Version 2)
XX
DE   Rosa xanthina f. normalis psbA-trnH intergenic spacer, complete sequence;
DE   chloroplast.
XX
KW   .
XX
OS   Rosa xanthina f. normalis
OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
OC   Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae;
OC   rosids; fabids; Rosales; Rosaceae; Rosoideae; Rosoideae incertae sedis;
OC   Rosa.
OG   Plastid:Chloroplast
XX
RN   [1]
RP   1-289
RX   AGRICOLA; IND44817822.
RA   Meng J., Fougere-Danezan M., Zhang L.-B., Li D.-Z., Yi T.-S.;
RT   "Untangling the hybrid origin of the Chinese tea roses: evidence from DNA
RT   sequences of single-copy nuclear and chloroplast genes";
RL   Plant Syst. Evol. 297(3-4):157-170(2011).
XX
RN   [2]
RP   1-289
RA   Fougere-Danezan M., Zhang L.-B., Gao X.;
RT   "Phylogenetic relationships in the genus Rosa: what tell us the Chinese
RT   roses?";
RL   Unpublished.
XX
RN   [3]
RP   1-289
RA   Meng J., Fougere-Danezan M., Zhang L.-B., Li D., Yi T.;
RT   "Hybrid origin of three varieties of the double-petaled Rosa odorata
RT   (Rosaceae)";
RL   Unpublished.
XX
RN   [4]
RP   1-289
RA   Fougere-Danezan M., Zhang L.-B., Gao X.;
RT   ;
RL   Submitted (14-JAN-2010) to the INSDC.
RL   Chinese Academy of Sciences, Chengdu Institute of Biology, P.O. Box 416,
RL   Chengdu, Sichuan 610041, China
XX
DR   MD5; bc32ee29278097e8638cad894fee98d9.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..289
FT                   /organism="Rosa xanthina f. normalis"
FT                   /organelle="plastid:chloroplast"
FT                   /mol_type="genomic DNA"
FT                   /specimen_voucher="Maowen Rose Garden 230"
FT                   /PCR_primers="fwd_name: psbAF, fwd_seq:
FT                   gttatgcatgaacgtaatgctc, rev_name: trnHR, rev_seq:
FT                   cgcgcatggtggattcacaaatc"
FT                   /note="forma: normalis"
FT                   /db_xref="taxon:947068"
FT   misc_feature    1..289
FT                   /note="psbA-trnH intergenic spacer"
XX
SQ   Sequence 289 BP; 97 A; 23 C; 39 G; 130 T; 0 other;
     gactttggtc ttagtatata tgagttcgtg aaagttttga aagtaaagaa aggagcaata        60
     ctaaatttct tgttatatca agaggtttgg tgttgctcct ttaccatatt actataatta       120
     ttaattataa ttaatactat aattaaatta gtattttagt actctttttt tttttttttt       180
     actaaaagat taaaatataa agggtttcta tttatgttgt attctctttt acaagtaatg       240
     ataaatggtg gaaatatttg taatttctat ttttatttaa atagtacaa                   289
//