ID   AQ861758; SV 1; linear; genomic DNA; GSS; PLN; 461 BP.
XX
AC   AQ861758;
XX
DT   09-NOV-1999 (Rel. 61, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 2)
XX
DE   nbeb0017D07f CUGI Rice BAC Library (EcoRI) Oryza sativa genomic clone
DE   nbeb0017D07f, genomic survey sequence.
XX
KW   GSS.
XX
OS   Oryza sativa (rice)
OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
OC   Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade;
OC   Oryzoideae; Oryzeae; Oryzinae; Oryza.
XX
RN   [1]
RP   1-461
RA   Wing R.A., Dean R.A.;
RT   "A BAC End Sequencing Framework to Sequence the Rice Genome";
RL   Unpublished.
XX
DR   MD5; a4db5359cf48f4e0d5180703122bb7b6.
XX
CC   On Sep 10, 1998 this sequence version replaced gi:3554605.
CC   Contact: Wing RA
CC   Clemson University Genomics Institute
CC   Clemson University
CC   100 Jordan Hall, Clemson, SC 29634, USA
CC   Tel: 864 656 7288
CC   Fax: 864 656 4293
CC   Email: rwing@clemson.edu
CC   Seq primer: TAATACGACTCACTATAGGG
CC   Class: BAC ends
CC   High quality sequence start: 26
CC   High quality sequence stop: 425.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..461
FT                   /organism="Oryza sativa"
FT                   /lab_host="E. coli DH10B"
FT                   /strain="Japonica"
FT                   /cultivar="Nipponbare"
FT                   /mol_type="genomic DNA"
FT                   /clone_lib="CUGI Rice BAC Library (EcoRI)"
FT                   /clone="nbeb0017D07f"
FT                   /tissue_type="Leaf"
FT                   /note="Vector: pBACIndigo; Site_1: EcoRI; Site_2: EcoRI;
FT                   Rice is the most important food crop in the world. Half of
FT                   the world population, especially those inhabiting highly
FT                   populated areas of the humid tropics and subtropics, rely
FT                   on rice as their primary source of carbohydrate.
FT                   Monocotyledonous rice is a diploid plant (2n=24) with a
FT                   haploid genome equivalent of 431 Mbp (Arumuganathan and
FT                   Earle, 1991). The relatively small genome of rice, three
FT                   times larger than that of Arabidopsis, makes it suitable
FT                   for genomic studies. In order to facilitate positional
FT                   cloning, physical mapping and genome sequencing of rice, we
FT                   have constructed a BAC library from Oryza sativa,
FT                   Nipponbare variety using EcoRI as the cloning enzyme. The
FT                   library contains 55,296 clones with an average insert size
FT                   of 121 Kb providing approximatley 15 haploid genome
FT                   equivalents. The deep coverage allows the isolation a
FT                   particular sequence with a probability of 99.9 %. Three
FT                   high density filters, each containing 18,432 clones (doubly
FT                   spotted), represent the whole library for colony screening
FT                   and can be requested from the Clemson University BAC/EST
FT                   Resource Center (www.genome.clemson.edu)."
FT                   /db_xref="taxon:4530"
XX
SQ   Sequence 461 BP; 132 A; 91 C; 60 G; 177 T; 1 other;
     ttggatttac gtatccgact cactatacgc gaattctccg aactgcttcg agatctcctt        60
     tttagtttct aatcattaga ggtttgtgta ctcattattc tatttctctt tctttccaac       120
     caactgatct ttcattccat ccttctttct ttcctcttcg atatccttga gtttctattt       180
     tttcccctat catctaattc ataataaaag gtgaaataga ggaagaaccc ctatggaaat       240
     cgacctaatc cagatccaat aggaattaaa tcaagatatc ccatttgata caatatgctg       300
     catcgaattg gatatggaat ccgattccat atatcggatt agataatgaa tctaacttgg       360
     gaatatataa tatcccatat caatttgttt cttctatttt gtttgtgtat tttctcattt       420
     tctattgaat cggattcaaa aaaaattcct taaagtggaa n                           461
//