Comment[ArrayExpressAccession]	E-MTAB-1915
MAGE-TAB Version	1.1
Investigation Title	Salmonella 14028s AraC ChIP-Seq
Comment[Submitted Name]	Salmonella 14028s AraC ChIP-Seq
Experiment Description	We mapped the genome-wide binding of C-terminally FLAG-tagged AraC in S. enterica subsp. enterica serovar Typhimurium strain 14028s using ChIP coupled with deep sequencing (ChIP-seq). We identified five putative target loci for AraC: upstream of araB/araC, araE, araJ, STM14_0178, and within sseD.
Experimental Design	strain or line design	in_vivo_design
Comment[AEExperimentType]	ChIP-seq
Comment[AEExperimentDisplayName]	ChIP-seq of C-terminally FLAG-tagged AraC in Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Experimental Factor Name	immunoprecipitate
Experimental Factor Type	immunoprecipitate
Public Release Date	2013-10-09
Person Last Name	Wade
Person First Name	Joseph
Person Mid Initials	T
Person Email	jwade@wadsworth.org
Person Phone	518-474-5727
Person Address	CMS 5227, 120 New Scotland Ave, Albany, NY  12208
Person Affiliation	Wadsworth Center, NY DOH
Person Roles	submitter
PubMed ID	24272778
Publication Author List	Anne M. Stringer, Salvatore Currenti, Richard P. Bonocora, Catherine Baranowski, Brianna L. Petrone, Michael J. Palumbo, Andrew E. Reilly, Zhen Zhang, Ivan Erill, Joseph T. Wade.
Publication Title	Genome-Scale Analyses of Escherichia coli and Salmonella enterica AraC Reveal Noncanonical Targets and an Expanded Core Regulon
Publication Status
Protocol Name	P-MTAB-35019	P-MTAB-35020	P-MTAB-35021	P-MTAB-35022
Protocol Type	growth protocol	nucleic acid extraction protocol	nucleic acid library construction protocol	nucleic acid sequencing protocol
Protocol Description	40 ml cells expressing C-terminally FLAG-tagged AraC were grown in LB + 0.2% arabinose at 37 degrees Celsius to an OD600 of 0.6-0.8. 	Cells were crosslinked for 20 minutes with formaldehyde (1% final concentration), pelleted by centrifugation and washed once with Tris-buffered saline (TBS). Cell pellets were resuspended in 1 ml FA lysis buffer (50 mM Hepes-KOH, pH 7, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS) with 2 mg/ml lysozyme and incubated at 37 degrees Celsius for 30 minutes. Samples were then chilled and sonicated for 30 minutes in a Bioruptor sonicator (Diagenode) with 30 s on/30 s off pulsing at maximum amplitude. Samples were pelleted in a microcentrifuge to remove debris and supernatants (chromatin) were saved, 1 ml FA lysis buffer was added, and samples were stored indefinitely at -20 degrees Celsius.	For the immunoprecipitation (IP), 500 ul chromatin was incubated with 300 ul FA lysis buffer, 20 ul Protein A Sepharose slurry (50%) in TBS and 2 ul M2 anti-FLAG antibody (Sigma) for 90 minutes at room temperature with gentle mixing on a rotisserie rotator.  Following the 90 min incubation, beads were washed twice with FA lysis buffer and twice with 10 mM Tris-HCl, pH 7.5 (please note: all wash steps involved incubation of samples with the wash solution for 3 min with gentle mixing on a rotisserie rotator before pelleting beads at 1,500 x g in a microcentrifuge for 1 min).  Beads were resuspended in 100 uL 1X Quick Blunting Buffer (NEB) containing dNTPs (concentration specified by NEB Quick Blunting kit) and 1 uL Quick Blunting enzyme mix (NEB), and incubated at room temperature for 30 min with gentle mixing. Beads were washed twice with FA lysis buffer and twice with 10 mM Tris-HCl, pH 8.0. Beads were resuspended in 100 uL Buffer 2 (NEB) containing 2 mM dATP and 2 uL Klenow DNA polymerase (NEB), and incubated for 30 min at 37 degrees Celsius with gentle mixing. Beads were washed twice with FA lysis buffer and twice with 10 mM Tris-HCl, pH 7.5. Barcoded adapter oligonucleotides ACACTCTTTCCCTACACGACGCTCTTCCGATCTgctT + /5Phos/agcAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG (barcoded pair) were annealed by boiling a mixture of 100 uM each in 10 mM Tris, pH 7.5, 50 mM NaCl, 1 mM EDTA, and cooling slowly. The adapter oligonucleotide mix was then diluted 10-fold in water. Beads were resuspended in 1X DNA Quick Ligase buffer (NEB), 1 uL adapter oligonucleotide mix and 2 uL Quick DNA Ligase (NEB), and incubated at room temperature for 15 min with gentle mixing. Beads were washed twice with FA lysis buffer, and once each with high salt FA lysis buffer (50 mM Hepes-KOH, pH 7, 500 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS), ChIP wash buffer (10 mM Tris-HCl, pH 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% Nonidet-P40, 0.5% sodium deoxycholate) and TE (10 mM Tris-HCl, pH 7.5, 1 mM EDTA). After the TE wash, beads were transferred to a fresh Spin-X column and eluted with 100 ul ChIP elution buffer (50 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1% SDS) for 10 minutes at 65 degrees Celsius with occasional agitation. Samples were decrosslinked by boiling for 10 minutes. DNA was extracted with phenol/chlorofom/isoamyl alcohol, ethanol precipitated, and resuspended in 11 uL H2O. 1 uL DNA was used for real time PCR amplification with oligonucleotides JW1169 + JW2327 using an ABI 7500 Fast real time PCR machine. The number of cycles required to reach a Delta Rn score of 0.1 was recorded. 8 uL of the remaining DNA was amplified using conventional PCR with oligonucleotides AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT + CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT for X+3 cycles with an annealing temperature of 60 degrees Celsius. PCR products were purified using Ampure XP magnetic beads (Ampure) and resuspended in 20 uL H2O. Purified PCR products between 200 bp and 600 bp were gel purified from an 8% non-denaturing polyacrylamide gel, eluted overnight in 0.4 M NaCl, and ethanol precipitated to generate the final ChIP-seq library. The library was resuspended in 10 uL H2O and quantified using a Qubit fluorimeter (Invitrogen). The library was sequenced using a HiSeq 2000 sequencer (Illumina; University at Buffalo Next Generation Sequencing Core Facility). 	HiSeq 51 nucleotide single end read, using a HiSeq2000 instrument.
Protocol Term Source REF	EFO	EFO	EFO	EFO
Protocol Hardware				Illumina HiSeq 2000
Term Source Name	EFO
Term Source File	http://www.ebi.ac.uk/efo
Comment[SecondaryAccession]	ERP003985
Comment[SequenceDataURI]	http://www.ebi.ac.uk/ena/data/view/ERR348423
SDRF File	E-MTAB-1915.sdrf.txt