Comment[ArrayExpressAccession]	E-GEOD-57029
MAGE-TAB Version	1.1			
Public Release Date	2014-08-01
Investigation Title	Profiling and comparison of miRNA populations in male and female tissues from Drosophila melanogaster at various stages			
Comment[Submitted Name]	Profiling and comparison of miRNA populations in male and female tissues from Drosophila melanogaster at various stages
Experiment Description	By surveying miRNA populations in each sex, we identified sets of miRNAs differentially expressed in male and female tissues across various stages of development. Small RNAs cloning of dissected male and female tissues from Drosophila melanogaster at various stages			
Term Source Name	ArrayExpress	EFO
Term Source File	http://www.ebi.ac.uk/arrayexpress/	http://www.ebi.ac.uk/efo/efo.owl		
Person Last Name	Fagegaltier	Fagegaltier	Hannon	Gingeras
Person First Name	Delphine	Delphine	Gregory	Thomas
Person Mid Initials			J	R
Person Email	geo@ncbi.nlm.nih.gov			
Person Affiliation	Cold Spring Harbor Lab			
Person Address	Genomics Division, Cold Spring Harbor Lab, One Bungtown Rd, Cold Spring Harbor, NY, USA			
Person Roles	submitter			
Protocol Name	P-GSE57029-4	P-GSE57029-1	P-GSE57029-3	P-GSE57029-2
Protocol Description	The 3' linker (CTGTAGGCACCATCAATCGTATGCCGTCTTCTGCTTG) sequence is clipped from the sequenced reads with fastx-clipper. Only reads with a minimum length of 16nt are kept for further processing. Sequencing artifacts (reads with all but 3 identical bases) are filtered out. Identical reads are collapsed with fastq_collapser; Reads sequence and count are provided in Read_Count_Table processed files. Genome_build: dm3 BDGP release 5 Supplementary_files_format_and_content: Processed data text files contain processed Read_ID, processed Read_Sequence and Read_Count	Tissues from wild-type flies were manually dissected in cold PBS to exclude contamination with other tissues, then quickly frozen in liquid nitrogen to preserve RNA integrity.	Total RNAs were prepared with Trizol reagent (Invitrogen). After 2S rRNA removal,18-30nt small RNAs were size selected on a 15% polyacrylamide, 7M urea gel. Small RNA libraries were prepared according to Malone et al. Cold Spring Harb Protoc. 2012. In short, size selected RNAs are ligated with a 3' adaptor (Modban) with mutant T4 RNA ligase 2, truncated (home made) and ligated products extracted from a 15% polyacrylamide, 7M urea gel. A 5’ adaptor is then added with T4 RNA ligase (Ambion) and selected ligated products reverse transcribed with Superscript lll reverse transcriptase (Invitrogen). Amplification of the cDNA using Illumina primers results in a final library sequenced on an Illumina GAIIX platform.	Flies were reared on standard food at 24oC and staged according to regular procedures.
Protocol Type	normalization data transformation protocol	sample treatment protocol	nucleic acid library construction protocol	growth protocol
Experimental Factor Name	DEVELOPMENTAL STAGE	SEX	ORGANISM PART	
Experimental Factor Type	developmental stage	Sex	organism part	
Publication Title	A Genome-Wide Survey of Sexually Dimorphic Expression of Drosophila miRNAs Identifies the Steroid Hormone-Induced miRNA let-7 as a Regulator of Sexual Identity.			
Publication Author List	Fagegaltier D, K�nig A, Gordon A, Lai EC, Gingeras TR, Hannon GJ, Shcherbata HR			
PubMed ID	25081570			
Publication DOI	10.1534/genetics.114.169268			
Comment[SecondaryAccession]	GSE57029			
Comment[GEOReleaseDate]	2014-08-01			
Comment[ArrayExpressSubmissionDate]	2014-04-23			
Comment[GEOLastUpdateDate]	2014-08-04			
Comment[AEExperimentType]	RNA-seq of non coding RNA			
Comment[SecondaryAccession]	SRP041399			
Comment[SequenceDataURI]	http://www.ebi.ac.uk/ena/data/view/SRR1259518-SRR1259523			
SDRF File	E-GEOD-57029.sdrf.txt