Comment[ArrayExpressAccession]	E-GEOD-39275
MAGE-TAB Version	1.1			
Public Release Date	2013-04-03
Investigation Title	tRNA fragment profiling in CLP1 mutant (kinase-dead) mice			
Comment[Submitted Name]	tRNA fragment profiling in CLP1 mutant (kinase-dead) mice
Experiment Description	Loss of CLP1 activity results in the accumulation of novel sets of small RNA fragments derived from aberrant processing of tyrosine pre-tRNA. Such tRNA fragments sensitize cells to oxidative stress-induced p53 activation and p53-dependent cell death. 2 samples, Wt and Clp1(k/k), no replicates			
Term Source Name	ArrayExpress	EFO
Term Source File	http://www.ebi.ac.uk/arrayexpress/	http://www.ebi.ac.uk/efo/efo.owl		
Person Last Name	Martinez	Hanada	Weitzer	Martinez
Person First Name	Javier	Toshikatsu	Stefan	Javier
Person Email	geo@ncbi.nlm.nih.gov			
Person Affiliation	IMBA			
Person Address	IMBA, Dr. Bohr-Gasse 3, Vienna, Austria			
Person Roles	submitter			
Protocol Name	P-GSE39275-3	P-GSE39275-2	P-GSE39275-1	
Protocol Description	basecalling: RTA 1.7.48.0 trimming: cutadapt 1.0 -a GATCGGAAGAGCACACGTCT -a GTTCAGAGTTCTACAGTCCGACGATC -a TCGTATGCCGTCTTCTGCTTG -a AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG -a AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG -a AGATCGGAAGAGCGGTTCAGTAGGAATGCCGAGACCG alignment: bowtie 0.12.5 bedtools annotation by http://gtrnadb.ucsc.edu/Mmusc/ Genome_build: mm9 Supplementary_files_format_and_content: summary table of read count per tRNA	~50 M-NM-<g of total RNA from primary MEFs was separated alongside with a radiolabeled RNA decade marker (Ambion) on a preparative 10% denaturing polyacrylamide gel (20 M-CM-^W 25 cm, 1 mm thick) containing 8 M urea (Sequagel, National Diagnostics). The gel region comprising sizes of 37-50 nucleotides was excised and passively eluted overnight into 0.4 M NaCl. The RNA was precipitated by adding three volumes of ethanol, the pellet was washed once in 85 % ethanol and dissolved in 16 M-NM-<L H2O. 2 M-NM-<L (10 U/M-NM-<L) tobacco acid pyrophosphatase (TAP, Epicentre; in order to hydrolyze the terminal 5' triphosphate group of tRNAs to generate a 5' monophosphate terminus; alternatively RNA 5' polyphosphatase (Epicentre) was used to produce 5M-^RM-bM-^@M-^Y monophosphate termini) and 2 M-NM-<L 10x TAP reaction buffer was added followed by incubation for 1 hour at 37M-0C. The reaction was deproteinized, and the RNA was extracted with phenol/chloroform and subsequently precipitated with ethanol. Adaptor ligation for high- throughput sequencing was essentially performed as described in Hafner, M. et al. (Methods 44, 3-12 2007.09.009 [2008]) except that the 5' adapter ligation step was performed prior to the 3' adapter ligation. 5' adapter oligonucleotides (5'- GUU CAG AGU UCU ACA GUC CGA CGA UC-3') were ligated using T4 RNA ligase I (NEB) including 15 % polyethylene glycol 8000 on ice overnight. After separation by a preparative 10% denaturing polyacrylamide gel, the gel region corresponding to 60-74 nucleotides was excised, the RNA passively eluted and ethanol precipitated as described above. The RNA was ligated to 3' adapter oligonucleotides (5'- App-UCG UAU GCC GUC UUC UGC UUG UidT-3') using T4 RNA ligase 2 (truncated, NEB) including 15% polyethylene glycol 8000 on ice overnight. RNA was again separated on a 10% denaturing polyacrylamide gel, and RNA was eluted from the gel region corresponding to 80-100 nucleotides. For cDNA preparation, Illumina Rev primer (5'-CAA GCA GAA GAC GGC ATA CGA-3') and Superscript II Reverse Transcriptase kit (Invitrogen) was used. PCR amplification was performed using Phusion High Fidelity Polymerase (NEB) and Illumina Forward (5'- AAT GAT ACG GCG ACC ACC GAC AGG TTC AGA GTT CTA CAG TCC GA-3') and Reverse primers. PCR products were subsequently sequenced on an Illumina G2 platform.	Primary MEFs were obtained from day 13.5 embryos and grown in complete medium (Dulbecco's modified Eagle's medium) supplemented with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, and 100 M-NM-<g/ml streptomycin (GIBCO-BRL).	
Protocol Type	normalization data transformation protocol	nucleic acid library construction protocol	growth protocol	
Experimental Factor Name	GENOTYPE			
Experimental Factor Type	genotype			
Publication Title	CLP1 links tRNA metabolism to progressive motor-neuron loss.			
Publication Author List	Hanada T, Weitzer S, Mair B, Bernreuther C, Wainger BJ, Ichida J, Hanada R, Orthofer M, Cronin SJ, Komnenovic V, Minis A, Sato F, Mimata H, Yoshimura A, Tamir I, Rainer J, Kofler R, Yaron A, Eggan KC, Woolf CJ, Glatzel M, Herbst R, Martinez J, Penninger JM			
PubMed ID	23474986			
Publication DOI	10.1038/nature11923			
Comment[SecondaryAccession]	GSE39275			
Comment[GEOReleaseDate]	2013-04-03			
Comment[ArrayExpressSubmissionDate]	2012-07-11			
Comment[GEOLastUpdateDate]	2013-04-18			
Comment[AEExperimentType]	RNA-seq of non coding RNA			
Comment[SecondaryAccession]	SRP014197			
Comment[SequenceDataURI]	http://www.ebi.ac.uk/ena/data/view/SRR520466-SRR520467			
SDRF File	E-GEOD-39275.sdrf.txt