Comment[ArrayExpressAccession]	E-GEOD-37125
MAGE-TAB Version	1.1				
Public Release Date	2012-06-06
Investigation Title	non-coding RNA sequencing of upland cotton fiber and ovule				
Comment[Submitted Name]	non-coding RNA sequencing of upland cotton fiber and ovule
Experiment Description	Three samples of cotton fiber harvested 3, 7 and 15 days post anthesis (DPA) and a sample of cotton ovule harvestd 0 DPA were used for non-coding RNA extraction and seloxa sequencing experiments, respectively.Cotton plants (Gossypium hirsutum cv. Xuzhou 142) were grown in a soil mixture in fully automated walk-in growth rooms with 300 M-BM-5mol mM-bM-^@M-^S2 sM-bM-^@M-^S1 average light intensity, 60% relative humidity and temperatures set to 30C during the light period and 28C during the dark (12-h light/dark cycle). These conditions were consistent throughout the year. Small RNA molecules under 30 bases were amplified and isolated from an agarose gel. The purified DNA was used directly for cluster generation and sequencing analysis using the Illumina Genome Analyzer IIx according to the manufacturer's instructions. The 38nt sequence tags from sequencing went through data cleaning first, which included getting rid of the low-quality tags and clipping adapter sequences. Three samples of cotton fiber harvested 3, 7 and 15 days post anthesis (DPA) and a sample of cotton ovule harvestd 0 DPA were used for non-coding RNA extraction and seloxa sequencing experiments, respectively.				
Term Source Name	ArrayExpress	EFO
Term Source File	http://www.ebi.ac.uk/arrayexpress/	http://www.ebi.ac.uk/efo/efo.owl			
Person Last Name	Zhu	Li	Jin	Xiao	Zhu
Person First Name	Yu-Xian	Qin	Xiang	Guang-hui	Yu-xian
Person Email	zhuyx@water.pku.edu.cn				
Person Affiliation	College of life sciences, Peking University				
Person Phone	86-10-62751193				
Person Fax	86-10-62754427				
Person Address	College of life sciences, Peking University, 5# Summer Palace Road, Beijing, China				
Person Roles	submitter				
Protocol Name	P-GSE37125-2	P-GSE37125-1	P-GSE37125-3		
Protocol Description	Briefly, after PAGE purification of small RNA molecules under 30 bases and ligation of a pair of adaptors to their 5' and 3' ends, the small RNA molecules were amplified using the adaptor primers for 17 cycles and the fragments around 90 bp (small RNA+adaptors) were isolated from agarose gel. The purified DNA was used directly for cluster generation and sequencing analysis using the Illumina GA according to the manufacturer's instructions.	Cotton plants (Gossypium hirsutum cv. Xuzhou 142) were grown in a soil mixture in fully automated walk-in growth rooms with 300 M-5mol mM-bM-^@M-^S2 sM-bM-^@M-^S1 average light intensity, 60% relative humidity and temperatures set to 30C during the light period and 28C during the dark (12-h light/dark cycle). These conditions were consistent throughout the year.	base-calling, Illumina sequencing control software filtering, FASTX-Toolkit, quality cut-off: 20, clipping adapter: TGGAATTCTCGGGTGCCAAGG Supplementary_files_format_and_content: fasta		
Protocol Type	nucleic acid library construction protocol	grow	feature_extraction		
Experimental Factor Name	DEVELOPMENTAL STAGE	ORGANISM PART			
Experimental Factor Type	developmental stage	organism part			
Comment[SecondaryAccession]	GSE37125				
Comment[GEOReleaseDate]	2012-06-06				
Comment[ArrayExpressSubmissionDate]	2012-04-09				
Comment[GEOLastUpdateDate]	2012-06-07				
Comment[AEExperimentType]	RNA-seq of non coding RNA				
Comment[SecondaryAccession]	SRP012138				
Comment[SequenceDataURI]	http://www.ebi.ac.uk/ena/data/view/SRR473422-SRR473425				
SDRF File	E-GEOD-37125.sdrf.txt