Comment[ArrayExpressAccession]	E-GEOD-28537
Public Release Date	2011-12-01				
Investigation Title	AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana				
Comment[Submitted Name]	AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana
Experiment Description	RNA-directed DNA methylation (RdDM) is a small interfering RNA (siRNA)-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of AROGONAUTE (AGO) proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing (TGS) of homologous promoter sequences. AGO proteins act in silencing effector complexes by anchoring the 3’ and 5’ ends of the guide siRNAs at their N-terminal PAZ domain and MID domain, respectively. In addition, many AGO proteins cleave complementary target RNAs through an endonuclease (‘slicer’) activity in their C-terminal PIWI domain. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and TGS in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points and the preferential association of Pol V with AGO6. Examination of siRNA abundance in the trasngenic wild type plant (contains trigger and silencer transgenes) and the ago6-4 mutant.				
Date of Experiment					
Term Source Name	EFO
Term Source Version					
Term Source File	http://www.ebi.ac.uk/efo/efo.owl				
Person Last Name	Meyers	Daxinger	Matzke	Simon	Meyers
Person First Name	Blake	Lucia	Marjori	Stacey	Blake
Person Mid Initials	C.			A	C
Person Email	meyers@dbi.udel.edu				
Person Affiliation	University of Delaware				
Person Phone	302-831-3418				
Person Fax	302-831-4841				
Person Address	Plant and Soil Sciences, University of Delaware, Delaware Biotechnology Institute, 15 Innovation Way, Room #230, Newark, DE, USA				
Person Roles	submitter				
Person Roles Term Source REF					
Person Roles Term Accession Number					
Normalization Type					
Normalization Term Accession Number					
Normalization Term Source REF					
Replicate Type					
Replicate Term Accession Number					
Replicate Term Source REF					
Experimental Design					
Experimental Design Term Accession Number					
Experimental Design Term Source REF					
Quality Control Type					
Quality Control Term Accession Number					
Quality Control Term Source REF					
Protocol Name	P-GSE28537-1	P-GSE28537-3	P-GSE28537-2	P-GSE28537-5	P-GSE28537-4
Protocol Description	SEQUENCE = <br>COUNT = 	Total RNA was isolated from mixed stage inflorescence tissues of the transgenic wild type and the ago6-4 mutant using TRIzol reagent (Invitrogen). Total RNA (200 ug) for each sample was used to construct the small RNA libraries as described previously (Lu et al., 2007) but with different adapters. The RNA oligos (Dharmacon) used for small RNA ligations were as follows: 5' RNA Adapter (5'OH-GUUCAGAGUUCUACAGUCCGACGAUC-OH 3') and 3' RNA Adapter: (5'pUCGUAUGCCGUCUUCUGCUUGUidt 3'; p, phosphate; idT, inverted deoxythymidine). Libraries were sequenced on an Illumina GAII following the manufacturer's protocols at the Delaware Biotechnology Institute.	Seeds were germinated on soil and grown for approximately 5 weeks at 22-23°C under a light cycle of 8 hours dark, 16 hours light. Mixed stage floral inflorescences (inflorescence meristem and floral buds to stage 12) were harvested between 9 and 12 AM and stored in 50 ml Falcon tubes at -80°C.	Adapter sequences were removed using a Perl script, generating small RNA sequences plus abundances. The data were matched to the Arabidopsis genome (TAIR v9) as well as the transgenes described in Kanno et al. (2008). Of the 4,510,985 total reads from transgenic wild type and 2,327,100 from the ago6-4 mutant, 2,846,684 (wt) and 1,261,189 (ago6-4) reads matched the genome, excluding 362,400 (wt) and 207,909 (ago6-4) that matched tRNA, rRNA, snRNA or snoRNAs.	Library selection: PCR
Protocol Software					
Protocol Hardware					
Protocol Contact					
Protocol Type	bioassay_data_transformation	nucleic_acid_extraction	grow	feature_extraction	feature_extraction
Protocol Term Source REF					
Protocol Term Accession Number					
Experimental Factor Name	GENOTYPE/VARIATION				
Experimental Factor Type	genotype/variation				
Experimental Factor Term Source REF					
Experimental Factor Term Accession Number					
Publication Title					
Publication Author List					
PubMed ID					
Publication DOI					
Publication Status					
Publication Status Term Source REF					
Publication Status Term Accession Number					
Comment[SecondaryAccession]	GSE28537				
Comment[GEOLastUpdateDate]	2011-12-01
Comment[AEExperimentType]	RNA-seq of non coding RNA				
Comment[GEOReleaseDate]	2011-12-01
Comment[ArrayExpressSubmissionDate]	2011-04-11
SDRF File	E-GEOD-28537.sdrf.txt