Array Design Name RIKEN Arabidopsis 7K cDNA array version 2.5.16
Version 2.5.16
Provider Motoaki Seki (mseki@gsc.riken.jp)
Comment[ArrayExpressAccession] A-MEXP-147
Comment[Description] RIKEN Arabidopsis 7K cDNA microarrays are based on the RIKEN Arabidopsis Full-Length (RAFL) cDNA clone sets (Seki et al. (2002) Science 296:141-145) isolated in RIKEN Genomic Sciences Center (GSC).
The RAFL cDNA clones are available from RIKEN Bioresource Center (BRC).
Preparation of the cDNA microarray was carried out as reported previously (Seki et al. (2002) Plant J. 31:279-292). PCR products were arrayed from 384-well microtiter plates onto a micro slide glass (model SuperAldehyde Substrates; Telechem International Inc., Sunnyvale, CA) using the microarray stamping machine (model SPBIO2000; Hitachi Software Engineering Co., Ltd., Tokyo, Japan).
PCR-amplified fragments from lambda control template DNA fragment (TX803; Takara, Kyoto, Japan) as spiked controls and two DNAs derived from the mouse nicotinic acetylcholine receptor epsilon-subunit (nAChRE) gene and the mouse glucocorticoid receptor homolog gene as negative controls were spotted on the microarrays.
Comment[SubmittedName] RIKEN Arabidopsis 7K cDNA array version 2.5.16
Comment[Organism] Arabidopsis thaliana
Printing Protocol :Preparation of cDNA microarrays:
cDNA clones:
We prepared a 7K RAFL cDNA microarray (2) to study the expression profiles of Arabidopsis genes under various conditions. In the 7K RAFL cDNA microarray, ca. 7000 RAFL cDNA clones isolated from the full-length cDNA libraries, the drought- and cold-inducible genes, responsive to dehydration (rd) and early responsive to dehydration (erd), PCR-amplified fragment from lambda control template DNA fragment (TX803; Takara, Kyoto, Japan) as external controls, and two DNAs derived from the mouse nicotinic acetylcholine receptor epsilon-subunit (nAChRE) gene and the mouse glucocorticoid receptor homolog gene as negative controls are included.
Amplification of cDNA inserts:
1. Amplify the inserts of cDNA clones by PCR using primers complementary to vector sequences flanking both sides of the cDNA insert, as described previously (1). Add plasmid templates (1 to 10 ng) to 50 ?l of a PCR mixture containing 0.25 mM of each nucleotide, 0.2 ?M of each primer, 1 X Ex Taq buffer (Takara, Kyoto, Japan), and 1.25 units of Ex Taq polymerase (Takara, Kyoto, Japan). Perform the PCR as follows: at 95?C for 3 min; 35 cycles at 95?C for 30 sec; 60?C for 1 min; and 72?C for 3 min.
2. Precipitate the PCR products in isopropanol and resuspend the DNA at ca. 2 ?g/?l in TE.
3. Electrophorese one aliquot of each reaction product on a 0.7% agarose gel to confirm amplification quality and quantity.
4. Mix 2 ?l of DNA with 2 ?l of 2 x polymer (FUJI PHOTO FILM Co., Kanagawa, Japan) and 4 ?l dimethyl sulfoxide (DMSO) (Kishida Chemical Co., Osaka, Japan) at least 10 times using an automatic dispenser (model EDS-384S; Biotech Co., Ltd., Tokyo, Japan).
Printing on glass slides:
1. Array the PCR products from 384-well microtiter plates onto micro-slides (model SuperAldehyde Substrates; Telechem International Inc., Sunnyvale, CA) using a microarray stamping machine (model SPBIO2000; Hitachi Software Engineering Co., Ltd., Tokyo, Japan). The tip loads 2 ?l of PCR products (500 to 1000 ng/?l) from 384-well microtiter plates and deposits 0.5 nl per slide on 48 slides with spacing of 300 ?m in our system (2).
2. Postprocess the slides according to the manufacturer's protocol (Telechem International Inc., Sunnyvale, CA). Dry the slides for more than 12 hr in a desiccator (relative humidity <30%). This period may facilitate binding of the printed DNA and slide coating. Irradiate the slides with 65 mJ UV to obtain cross-linked DNA.
3. Rock them in 0.2% SDS for 2 min twice and then rock in distilled water for 2 min twice vigorously.
4. Transfer the slide racks into a chamber containing boiling water and leave for 2 min. Remove the slide racks to a clean glass container and leave them at room temperature for 5 min to cool. Pour the blocking solution, containing 1 g of sodium borohydride, 300 ml of phosphate-buffered saline (PBS) (Invitrogen, Carlsbad, CA), and 90 ml of 100% ethanol, into the glass chamber.
5. Shake the slide racks gently for 5 min, transfer into a chamber containing 0.2% SDS and shake gently for 1 min 3 times.
6. Transfer them into a chamber containing distilled water, shake gently for 1 min, and dry by centrifugation for 20 min to remove any residual solution from the slides. Store the slides in a desiccator.
Reference:
1. Seki et al. (2001) Plant Cell 13:61-72
2. Seki et al. (2002) Plant J. 31:279-292
Technology Type spotted_ss_DNA_features
Technology Type Term Source REF mo
Surface Type aldehyde
Substrate Type glass
Term Source Name mo embl tair
Term Source File http://mged.sourceforge.net/ontologies/MGEDontology.php http://www.ebi.ac.uk/embl/ http://arabidopsis.org
Term Source Version
Comment[AdditionalFile:txt] A-MEXP-147_comments.txt
[main]
Block Column Block Row Column Row Reporter Name Reporter Database Entry[embl] Reporter Database Entry[tair] Reporter Sequence Reporter Group[role] Control Type Composite Element Name Composite Element Database Entry[embl] Composite Element Database Entry[tair] Composite Element Comment
1 1 1 1 RAFL02-07-H03 AF372885 Experimental RAFL02-07-H03 AF372885 AtAGP4
1 1 1 2 RAFL02-08-E13 AY037187 Experimental RAFL02-08-E13 AV781472;AY037187 unknown protein
1 1 1 3 RAFL02-09-F24 AY065058 Experimental RAFL02-09-F24 AV781511;AV821197;AY065058 senescence-associated protein sen1-like protein
1 1 1 4 RAFL02-07-N05 AV781453 Experimental RAFL02-07-N05 AV781453;AF372908
1 1 1 5 RAFL02-08-M10 AY037203 Experimental RAFL02-08-M10 AV781490;AV821185;AY037203 putative transcription factor BHLH6
1 1 1 6 RAFL02-09-C19 AY078971 Experimental RAFL02-09-C19 AV781504;AV821192;AY078971 cobalamin biosynthesis protein
1 1 1 7 RAFL02-07-N15 AV821166 Experimental RAFL02-07-N15 AV821166;AF372884 unknown protein
1 1 1 8 RAFL02-08-G24 AY037188 Experimental RAFL02-08-G24 AV781479;AV821179;AY037188 unknown protein
1 1 1 9 RAFL02-06-O21 AV821155 Experimental RAFL02-06-O21 AV781432;AV821155;AF372912 unknown protein
1 1 1 10 RAFL02-08-C02 AV821172 Experimental RAFL02-08-C02 AV821172;AF372909 dehydration-induced protein (ERD15)
1 1 1 11 RAFL02-08-D12 AV821174 Experimental RAFL02-08-D12 AV781468;AV821174;AF372899 putative protein
1 1 1 12 RAFL02-07-N19 AV781454 Experimental RAFL02-07-N19 AV781454;AF372893 unknown protein
1 1 1 13 RAFL02-06-P14 AY037193 Experimental RAFL02-06-P14 AV781435;AV821156;AY037193 unknown protein
1 1 1 14 RAFL02-07-D08 AV781439 Experimental RAFL02-07-D08 AV781439;AF372873 unknown protein
1 1 2 1 RAFL04-13-N21 AY035150 Experimental RAFL04-13-N21 AV782087;AV821584;AY035150 myo-inositol monophosphatase like protein
1 1 2 2 RAFL04-12-B09 AV821473 Experimental RAFL04-12-B09 AV781935;AV821473;AF370245 20S proteasome subunit PAE2
1 1 2 3 RAFL04-12-P04 AV821517 Experimental RAFL04-12-P04 AV782005;AV821517 squalene monooxygenase
1 1 2 4 RAFL04-13-O10 AY035128 Experimental RAFL04-13-O10 AV782093;AV821589;AY035128 putative enolase (2-phospho-D-glycerate hydroylase)
1 1 2 5 RAFL03-05-M10 AV821279 Experimental RAFL03-05-M10 AV781635;AV821279;AF372915 geranylgeranyl pyrophosphate synthase-related protein
1 1 2 6 RAFL03-05-E06 AV821269 Experimental RAFL03-05-E06 AV781623;AV821269;AF372911 aldehyde dehydrogenase (NAD+)-like protein
1 1 2 7 RAFL03-02-D07 AV821245 Experimental RAFL03-02-D07 AV781591;AV821245;AF372901 unknown protein (At1g23490)
1 1 2 8 RAFL03-06-D05 AV821286 Experimental RAFL03-06-D05 AV781645;AV821286;AF372897 Oxygen-evolving enhancer protein 3 precursor - like protein
1 1 2 9 RAFL03-04-E02 AV821258 Experimental RAFL03-04-E02 AV781610;AV821258;AF372881 putative protein
1 1 2 10 RAFL03-06-F08 AV821288 Experimental RAFL03-06-F08 AV821288;AF372874
1 1 2 11 RAFL03-03-L03 AY037213 Experimental RAFL03-03-L03 AV781606;AV821256;AY037213 unknown protein
1 1 2 12 RAFL03-02-D01 AV821243 Experimental RAFL03-02-D01 AV781589;AV821243;AF372906 unknown protein
1 1 2 13 RAFL02-08-F07 AY037202 Experimental RAFL02-08-F07 AV781475;AV821177;AY037202 unknown protein
1 1 2 14 RAFL02-08-J03 AV781484 Experimental RAFL02-08-J03 AV781484;AF372892 unknown protein
1 1 3 1 RAFL04-13-K03 AY039946 Experimental RAFL04-13-K03 AV782066;AV821566;AY039946 aluminium-induced protein - like
1 1 3 2 RAFL04-13-D02 AY035007 Experimental RAFL04-13-D02 AV782032;AV821539;AY035007 unknown
1 1 3 3 RAFL04-12-F21 BP560584 Experimental RAFL04-12-F21 AV781958;BP560584;AY035153 putative glutathione peroxidase
1 1 3 4 RAFL04-12-B20 AY039932 Experimental RAFL04-12-B20 AV781939;AY039932 aldose 1-epimerase, putative
1 1 3 5 RAFL04-12-O17 AV782003 Experimental RAFL04-12-O17 AV782003;AF370232 ribosomal protein S1
1 1 3 6 RAFL04-13-A22 AV821531 Experimental RAFL04-13-A22 AV782022;AV821531;AF370214 unknown protein
1 1 3 7 RAFL04-14-C15 AY080745 Experimental RAFL04-14-C15 AV782117;AV821609;AY080745 putative GATA-type zinc finger transcription factor
1 1 3 8 RAFL04-14-E10 AV782123 Experimental RAFL04-14-E10 AV782123;AF370281 dihydropyrimidinase like protein
1 1 3 9 RAFL04-14-C02 AV821604 Experimental RAFL04-14-C02 AV782110;AV821604 unknown protein
1 1 3 10 RAFL04-12-E12 AV821483 Experimental RAFL04-12-E12 AV781952;AV821483;AF370246 putative protein
1 1 3 11 RAFL04-12-J09 AV821498 Experimental RAFL04-12-J09 AV781977;AV821498;AF370230 putative protein
1 1 3 12 RAFL04-13-C15 AV821536 Experimental RAFL04-13-C15 AV782029;AV821536;AF370213 unknown protein
1 1 3 13 RAFL04-14-C09 AY035104 Experimental RAFL04-14-C09 AV782113;AV821605;AY035104 60S ribosomal protein L35
1 1 3 14 RAFL04-14-B02 AV821602 Experimental RAFL04-14-B02 AV782107;AV821602;AF370279 unknown protein
1 1 4 1 RAFL04-16-K22 AV821807 Experimental RAFL04-16-K22 AV782355;AV821807;AF370546 putative galactinol synthase
1 1 4 2 RAFL04-16-B18 AY042826 Experimental RAFL04-16-B18 AV821764;AY042826 glycine-rich RNA binding protein
1 1 4 3 RAFL04-15-O12 AY042832 Experimental RAFL04-15-O12 AV782282;AV821744;AY042832 ATP-dependent Clp protease-like protein
1 1 4 4 RAFL04-16-M10 BT002015 Experimental RAFL04-16-M10 AV782369;AV821817;BT002015 ABC transporter protein, putative
1 1 4 5 RAFL04-16-P03 AY059809 Experimental RAFL04-16-P03 AV782379;AV821825;AY059809 calmodulin 1 (CAM1)
1 1 4 6 RAFL04-16-G22 AY054597 Experimental RAFL04-16-G22 AV782328;AV821788;AY054597
1 1 4 7 RAFL04-15-M12 BT002012 Experimental RAFL04-15-M12 AV782268;AV821731;BT002012 NAC2-like protein
1 1 4 8 RAFL04-16-L12 AY065195 Experimental RAFL04-16-L12 AV782363;AV821811;AY065195 GTP-binding protein-like
1 1 4 9 RAFL04-13-I11 AY046007 Experimental RAFL04-13-I11 AV782054;AV821557;AY046007 putative squamosa-promoter binding protein
1 1 4 10 RAFL04-13-C05 AV821534 Experimental RAFL04-13-C05 AV782027;AV821534 ATP sulfurylase precursor (gb|AAD26634.1)
1 1 4 11 RAFL04-13-L03 AV821570 Experimental RAFL04-13-L03 AV782070;AV821570;AF370268 serine/arginine-rich protein, putative
1 1 4 12 RAFL04-13-G02 AV821546 Experimental RAFL04-13-G02 AV782041;AV821546;AF370251 putative violaxanthin de-epoxidase precursor (U44133)
1 1 4 13 RAFL04-14-A21 AY035177 Experimental RAFL04-14-A21 AV782106;AY035177 ubiquitin-like protein
1 1 4 14 RAFL04-12-C20 AY045782 Experimental RAFL04-12-C20 AV781945;AV821480;AY045782 hypothetical protein
1 1 5 1 RAFL04-17-P13 AY081265 Experimental RAFL04-17-P13 AV782499;AV821915;AY081265 putative carbonic anhydrase
1 1 5 2 RAFL04-17-I12 AY042876 Experimental RAFL04-17-I12 AV782454;AV821881;AY042876
1 1 5 3 RAFL04-19-A05 AY054602 Experimental RAFL04-19-A05 AV821961;AY054602 unknown protein
1 1 5 4 RAFL04-19-B03 AV821965 Experimental RAFL04-19-B03 AV782558;AV821965 photosystem I subunit VI precursor
1 1 5 5 RAFL04-17-E12 AY081264 Experimental RAFL04-17-E12 AV782416;AV821854;AY081264 unknown protein (At1g71810)
1 1 5 6 RAFL04-17-E10 AV821853 Experimental RAFL04-17-E10 AV821853 similar to ATP-dependent RNA helicase
1 1 5 7 RAFL04-18-J23 AY054692 Experimental RAFL04-18-J23 AV821942;AY054692 ATP-dependent RNA helicase (At1g27900)
1 1 5 8 RAFL04-18-F20 BT002023 Experimental RAFL04-18-F20 AV782521;AV821934;BT002023 isp4 like protein
1 1 5 9 RAFL04-18-D17 BP560671 Experimental RAFL04-18-D17 AV782511;BP560671;AY128340 phosphoserine aminotransferase
1 1 5 10 RAFL04-18-J12 AV821941 Experimental RAFL04-18-J12 AV782530;AV821941;AF387009 Unknown protein (MCI2.1)
1 1 5 11 RAFL04-17-C08 AV821839 Experimental RAFL04-17-C08 AV782395;AV821839;AF370553 unknown protein
1 1 5 12 RAFL04-17-H05 AY065083 Experimental RAFL04-17-H05 AV782441;AV821873;AY065083
1 1 5 13 RAFL04-18-D20 AY042833 Experimental RAFL04-18-D20 AV782512;AV821926;AY042833 Similar to dTDP-D-glucose 4,6-dehydratase
1 1 5 14 RAFL04-15-N19 BT002019 Experimental RAFL04-15-N19 AV782278;AV821742;BT002019 putative protein
1 1 6 1 RAFL05-02-N23 AY094420 Experimental RAFL05-02-N23 AV782884;AV822194;AY094420 putative acyl CoA synthetase (At1g49430)
1 1 6 2 RAFL05-02-P04 AV822200 Experimental RAFL05-02-P04 AV782891;AV822200 subtilisin proteinase like protein
1 1 6 3 RAFL05-01-C15 AY037238 Experimental RAFL05-01-C15 AV782759;AV822108;AY037238 unknown protein
1 1 6 4 RAFL05-01-H08 AY039847 Experimental RAFL05-01-H08 AV782783;AV822123;AY039847 unknown protein
1 1 6 5 RAFL05-01-J03 AV822132 Experimental RAFL05-01-J03 AV782791;AV822132;AF375434 RNA-binding protein, putative
1 1 6 6 RAFL05-01-M18 AY037219 Experimental RAFL05-01-M18 AV782806;AV822142;AY037219 ammonium transport protein (AMT1)
1 1 6 7 RAFL05-01-P22 AV822151 Experimental RAFL05-01-P22 AV782820;AV822151;AF375456 putative protein
1 1 6 8 RAFL05-01-L16 AV782801 Experimental RAFL05-01-L16 AV782801;AF375449 putative protein
1 1 6 9 RAFL05-01-H10 AY037236 Experimental RAFL05-01-H10 AV782784;AV822124;AY037236 putative oxido reductase (At1g65560)
1 1 6 10 RAFL05-01-A05 AV822100 Experimental RAFL05-01-A05 AV782746;AV822100;AF375435 FAS2 like protein
1 1 6 11 RAFL05-01-E12 AV822113 Experimental RAFL05-01-E12 AV782769;AV822113;AF375433 putative protein
1 1 6 12 RAFL05-01-I04 AV822127 Experimental RAFL05-01-I04 AV782786;AV822127;AF375424 coproporphyrinogen III oxidase (LIN2)
1 1 6 13 RAFL04-17-P17 AV821916 Experimental RAFL04-17-P17 AV782500;AV821916
1 1 6 14 RAFL04-17-D16 AY042842 Experimental RAFL04-17-D16 AV782408;AV821847;AY042842 unknown protein
1 1 7 1 RAFL05-07-K11 AY034941 Experimental RAFL05-07-K11 AV783227;AV822454;AY034941 putative bHLH transcription factor (bHLH122)
1 1 7 2 RAFL05-08-I15 BT000653 Experimental RAFL05-08-I15 AV783333;AV822540;BT000653 putative proteasome regulatory subunit
1 1 7 3 RAFL05-03-A24 BP560749 Experimental RAFL05-03-A24 AV782904;BP560749;AY094424 vacuolar-type H+-ATPase subunit B1 (VHA-B1)
1 1 7 4 RAFL05-02-G23 AY039851 Experimental RAFL05-02-G23 AV822170;AY039851 ubiquitin-conjugating enzyme E2-17 kd 3 (ubiquitin-protein ligase 3) (ubiquitin carrier protein 3)-like protein (sp|P42746)
1 1 7 5 RAFL05-02-P19 AV822205 Experimental RAFL05-02-P19 AV782896;AV822205;AF375439 cellulose synthase
1 1 7 6 RAFL05-02-J09 AY037233 Experimental RAFL05-02-J09 AV782861;AV822180;AY037233 unknown protein
1 1 7 7 RAFL05-02-E04 BP560734 Experimental RAFL05-02-E04 AV782837;BP560734;AF375428 unknown protein
1 1 7 8 RAFL05-03-D22 AY039841 Experimental RAFL05-03-D22 AV782914;AY039841 putative cytoskeletal protein
1 1 7 9 RAFL05-03-E03 AY094422 Experimental RAFL05-03-E03 AV782916;AV822217;AY094422 heat shock like protein
1 1 7 10 RAFL05-02-A09 BP560728 Experimental RAFL05-02-A09 AV782821;BP560728 putative protein
1 1 7 11 RAFL05-03-E11 AY065041 Experimental RAFL05-03-E11 AV782917;AV822219;AY065041 unknown protein
1 1 7 12 RAFL05-02-O22 AY037234 Experimental RAFL05-02-O22 AV782889;AY037234 translation initiation factor
1 1 7 13 RAFL05-02-D19 AV822159 Experimental RAFL05-02-D19 AV782833;AV822159 cinnamyl-alcohol dehydrogenase - like protein
1 1 7 14 RAFL05-02-P08 AY039843 Experimental RAFL05-02-P08 AV782892;AV822201;AY039843 thylakoid lumen rotamase like protein
1 1 8 1 RAFL05-09-F01 AY035141 Experimental RAFL05-09-F01 AV822600;AY035141 tubulin beta-4 chain (sp|P24636)
1 1 8 2 RAFL05-07-O21 AY039964 Experimental RAFL05-07-O21 AV783267;AV822488;AY039964 unknown protein
1 1 8 3 RAFL05-07-N19 AV822479 Experimental RAFL05-07-N19 AV783257;AV822479;AF370331 unknown protein
1 1 8 4 RAFL05-07-L16 AV822462 Experimental RAFL05-07-L16 AV783236;AV822462;AF370306 putative retroelement pol polyprotein
1 1 8 5 RAFL05-07-A16 BP560808 Experimental RAFL05-07-A16 AV783153;BP560808;AF370179 unknown protein
1 1 8 6 RAFL05-05-P01 BT006188 Experimental RAFL05-05-P01 AV783143;AV822391;BT006188 unknown protein
1 1 8 7 RAFL05-08-A04 AY080751 Experimental RAFL05-08-A04 AV783275;AV822495;AY080751 unknown protein
1 1 8 8 RAFL05-07-N16 AV822478 Experimental RAFL05-07-N16 AV783256;AV822478 putative protein
1 1 8 9 RAFL05-07-M20 AY034944 Experimental RAFL05-07-M20 AV783247;AV822470;AY034944 dolichyl-di-phosphooligosaccharide-protein glycotransferase (oligosaccharyltransferase)-like
1 1 8 10 RAFL05-08-O12 AV822564 Experimental RAFL05-08-O12 AV783365;AV822564;AF370305 6-phosphogluconolactonase-like protein
1 1 8 11 RAFL05-05-N18 AY040025 Experimental RAFL05-05-N18 AV783135;AV822385;AY040025 unknown protein
1 1 8 12 RAFL05-09-D10 AY035026 Experimental RAFL05-09-D10 AV783396;AV822592;AY035026 unknown protein
1 1 8 13 RAFL05-09-B19 AY035138 Experimental RAFL05-09-B19 AV783388;AY035138 ankyrin repeat protein
1 1 8 14 RAFL05-09-A10 AY034968 Experimental RAFL05-09-A10 AV783379;AV822575;AY034968 unknown protein
1 1 9 7 RAFL05-07-A19 AV822401 Experimental RAFL05-07-A19 AV783155;AV822401;AF370182 unknown protein
1 1 9 8 RAFL05-09-F03 BT000680 Experimental RAFL05-09-F03 AV783406;AV822601;BT000680 photosystem I subunit III precursor, putative
1 1 9 9 RAFL05-07-P04 AY039973 Experimental RAFL05-07-P04 AV783268;AV822489;AY039973 unknown protein
1 1 9 10 RAFL05-07-N24 AV822480 Experimental RAFL05-07-N24 AV783258;AV822480;AF370346 putative DNA-binding protein
1 1 9 11 RAFL05-07-N03 BP560822 Experimental RAFL05-07-N03 AV783248;BP560822;AF370333 betaine aldehyde dehydrogenase-like protein
1 1 9 12 RAFL05-07-L17 AY046011 Experimental RAFL05-07-L17 AV783237;AV822463;AY046011 unknown protein
1 1 9 13 RAFL05-08-D01 AY050859 Experimental RAFL05-08-D01 AV783295;AV822510;AY050859 putative poly(A) binding protein
1 1 9 14 RAFL05-08-B21 AY035028 Experimental RAFL05-08-B21 AV783286;AV822503;AY035028 unknown protein
1 1 13 1 RAFL05-19-L19 AY056220 Experimental RAFL05-19-L19 AV784467;AV823489;AY056220 unknown protein
1 1 13 2 RAFL05-19-E15 AY045948 Experimental RAFL05-19-E15 AV784409;AV823443;AY045948 unknown protein
1 1 13 3 RAFL05-19-K12 AY080791 Experimental RAFL05-19-K12 AV784456;AV823480;AY080791 HUA enhancer 2 (HEN2)
1 1 13 4 RAFL05-19-B08 AY045860 Experimental RAFL05-19-B08 AV784390;AV823429;AY045860 GTP binding protein beta subunit
1 1 13 5 RAFL05-19-J02 AY080772 Experimental RAFL05-19-J02 AV784447;AV823474;AY080772 putative beta-glucosidase
1 1 13 6 RAFL05-19-O23 AV823509 Experimental RAFL05-19-O23 AV784491;AV823509
1 1 13 7 RAFL05-19-N20 AY045973 Experimental RAFL05-19-N20 AV784486;AV823506;AY045973 putative protein
1 1 13 8 RAFL05-19-F17 AY045945 Experimental RAFL05-19-F17 AV784419;AY045945 inorganic pyrophosphatase - like protein
1 1 13 9 RAFL05-19-J04 AV823475 Experimental RAFL05-19-J04 AV784448;AV823475 mrp protein, putative
1 1 13 10 RAFL05-20-B01 AY080778 Experimental RAFL05-20-B01 AV784500;AV823516;AY080778 putative nematode-resistance protein
1 1 13 11 RAFL05-19-D22 AY045828 Experimental RAFL05-19-D22 AV784405;AY045828 dihydroxypolyprenylbenzoate methyltransferase
1 1 13 12 RAFL05-19-L18 AY059725 Experimental RAFL05-19-L18 AV784466;AV823488;AY059725 unknown protein
1 1 13 13 RAFL05-19-O11 AY045970 Experimental RAFL05-19-O11 AV784489;AV823507;AY045970 unknown protein
1 1 13 14 RAFL05-19-G04 AV823455 Experimental RAFL05-19-G04 AV784423;AV823455 unknown protein
1 1 14 1 RAFL06-10-B16 AY062821 Experimental RAFL06-10-B16 AV784973;AV823893;AY062821 unknown protein
1 1 14 2 RAFL06-11-F19 AY062819 Experimental RAFL06-11-F19 AV785073;AV823973;AY062819 unknown protein
1 1 14 3 RAFL06-11-A01 AV785049 Experimental RAFL06-11-A01 AV785049 putative protein
1 1 14 4 RAFL06-10-J22 AY072346 Experimental RAFL06-10-J22 AV785024;AV823935;AY072346 unknown protein
1 1 14 5 RAFL05-19-L05 AV823485 Experimental RAFL05-19-L05 AV784462;AV823485 putative protein
1 1 14 6 RAFL05-19-C01 AY050774 Experimental RAFL05-19-C01 AV784395;AV823432;AY050774 MEK1
1 1 14 7 RAFL05-19-H24 AY050790 Experimental RAFL05-19-H24 AV784442;AV823471;AY050790 unknown protein
1 1 14 8 RAFL05-19-G13 AY080767 Experimental RAFL05-19-G13 AV784427;AV823459;AY080767 unknown protein
1 1 14 9 RAFL05-19-J05 AY045979 Experimental RAFL05-19-J05 AV784449;AV823476;AY045979 unknown protein
1 1 14 10 RAFL05-20-K01 AY059721 Experimental RAFL05-20-K01 AV784506;AV823520;AY059721 unknown protein
1 1 14 11 RAFL05-19-N17 AV823504 Experimental RAFL05-19-N17 AV784484;AV823504 unknown protein
1 1 14 12 RAFL05-19-C13 AY056225 Experimental RAFL05-19-C13 AV784400;AV823435;AY056225 unknown protein
1 1 14 13 RAFL05-19-K06 BP561022 Experimental RAFL05-19-K06 AV784453;BP561022;AY090934 subtilisin-type serine endopeptidase XSP1
1 1 14 14 RAFL05-19-E24 AY045800 Experimental RAFL05-19-E24 AV784415;AV823447;AY045800 unknown protein
1 2 1 1 AtNCED1 AL021710 At4g18350 Experimental AtNCED1 AL021710 At4g18350 neoxanthin cleavage enzyme - like protein
1 2 1 2 AtGolS2 AB062849 Experimental AtGolS2 AB062849 putative galactinol synthase
1 2 1 3 ERD13 D17673 Experimental ERD13 D17673 glutathione S-transferase (erd13)
1 2 1 4 ERD10 D17714 Experimental ERD10 D17714 putative cold-acclimation protein
1 2 1 5 ERD8 Y11827 Experimental ERD8 Y11827 heat shock protein 90
1 2 1 6 ERD5 D83025 Experimental ERD5 D83025 proline oxidase, mitochondrial precursor (osmotic stress-induced proline dehydrogenase), 5' partial
1 2 1 7 ERD3 AB039927 Experimental ERD3 AB039927 ERD3 protein (ERD3)
1 2 1 8 ERD1 D17582 Experimental ERD1 D17582 Erd1 protein precursor (sp|P42762)
1 2 1 9 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
1 4 1 9 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
3 2 1 9 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
3 2 1 10 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
3 4 1 9 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
3 4 1 10 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
10 2 5 1 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
10 4 5 1 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
12 2 5 1 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
12 2 5 2 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
12 4 5 1 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
12 4 5 2 RD29A D13044 Experimental RD29A D13044 low-temperature-induced protein 78 (sp|Q06738)
1 2 1 10 Nega.*2 Control control_biosequence Nega.*2 Mouse glucocorticoid receptor (21B24002A23)
1 4 1 10 Nega.*2 Control control_biosequence Nega.*2 Mouse glucocorticoid receptor (21B24002A23)
3 4 1 11 Nega.*2 Control control_biosequence Nega.*2 Mouse glucocorticoid receptor (21B24002A23)
10 2 5 2 Nega.*2 Control control_biosequence Nega.*2 Mouse glucocorticoid receptor (21B24002A23)
10 4 5 2 Nega.*2 Control control_biosequence Nega.*2 Mouse glucocorticoid receptor (21B24002A23)
12 4 5 3 Nega.*2 Control control_biosequence Nega.*2 Mouse glucocorticoid receptor (21B24002A23)
1 2 1 11 Nega.*1 J04698 Control control_biosequence Nega.*1 J04698 Mouse nicotinic acetylcholine receptor epsilon subunit (nAChRE)
1 4 1 11 Nega.*1 J04698 Control control_biosequence Nega.*1 J04698 Mouse nicotinic acetylcholine receptor epsilon subunit (nAChRE)
3 2 1 11 Nega.*1 J04698 Control control_biosequence Nega.*1 J04698 Mouse nicotinic acetylcholine receptor epsilon subunit (nAChRE)
10 2 5 3 Nega.*1 J04698 Control control_biosequence Nega.*1 J04698 Mouse nicotinic acetylcholine receptor epsilon subunit (nAChRE)
10 4 5 3 Nega.*1 J04698 Control control_biosequence Nega.*1 J04698 Mouse nicotinic acetylcholine receptor epsilon subunit (nAChRE)
12 2 5 3 Nega.*1 J04698 Control control_biosequence Nega.*1 J04698 Mouse nicotinic acetylcholine receptor epsilon subunit (nAChRE)
1 2 1 12 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
1 4 1 12 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
3 2 1 12 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
3 2 1 13 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
3 4 1 12 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
3 4 1 13 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
10 2 5 4 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
10 4 5 4 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
12 2 5 4 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
12 2 5 5 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
12 4 5 4 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
12 4 5 5 lambda DNA Control control_spike_calibration lambda DNA Takara code TX803
1 2 1 13 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
1 2 1 14 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
1 4 1 13 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
1 4 1 14 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
3 2 1 14 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
3 4 1 14 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
10 2 5 5 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
10 2 5 6 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
10 4 5 5 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
10 4 5 6 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
12 2 5 6 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
12 4 5 6 alpha-tubulin M17189 Experimental alpha-tubulin M17189 tubulin alpha-5 chain-like protein
1 2 2 1 RAFL04-09-I10 BP560556 Experimental RAFL04-09-I10 AV781817;BP560556;AY039534 putative beta-galactosidase (BGAL9)
1 2 2 2 RAFL04-09-O05 AY039529 Experimental RAFL04-09-O05 AV781854;AV821412;AY039529
1 2 2 3 RAFL03-08-M06 AV821335 Experimental RAFL03-08-M06 AV781734;AV821335;AF378866 unknown protein
1 2 2 4 RAFL03-07-F12 AV821312 Experimental RAFL03-07-F12 AV781690;AV821312;AF378856 unknown protein
1 2 2 11 RAFL06-77-K06 AY052236 Experimental RAFL06-77-K06 AV787956;AV824825;AY052236 unknown protein
1 2 2 12 PR1 M59196 Experimental PR1 M59196 pathogenesis-related protein (PR-1)
10 2 6 2 PR1 M59196 Experimental PR1 M59196 pathogenesis-related protein (PR-1)
10 4 6 14 PR1 M59196 Experimental PR1 M59196 pathogenesis-related protein (PR-1)
1 2 2 13 AtNCED5 AB028621 At3g24220 Experimental AtNCED5 AB028621 At3g24220 9-cis-epoxycarotenoid dioxygenase, putative
1 2 2 14 AtNCED3 AY056255 At3g14440 Experimental AtNCED3 AY056255 At3g14440 9-cis-epoxycarotenoid dioxygenase, putative
1 2 3 1 RAFL04-09-B03 AV821356 Experimental RAFL04-09-B03 AV781778;AV821356 putative protein
1 2 3 2 RAFL04-09-O19 BP560568 Experimental RAFL04-09-O19 BP560568;AF378889 unknown protein
1 2 3 3 RAFL04-09-C14 AV821363 Experimental RAFL04-09-C14 AV781787;AV821363;AF378883 TRANSLATION INITIATION FACTOR 3 SUBUNIT 9-like protein
1 2 3 4 RAFL04-09-K09 AY039528 Experimental RAFL04-09-K09 AV781827;AV821394;AY039528 heat shock transcription factor like protein
1 2 3 5 RAFL04-09-B05 AY039520 Experimental RAFL04-09-B05 AV821357;AY039520 putative phytochrome A
1 2 3 6 RAFL04-09-L11 AV821397 Experimental RAFL04-09-L11 AV781832;AV821397;AF378857 unknown protein
1 2 3 7 RAFL04-09-N23 AY039541 Experimental RAFL04-09-N23 AV781853;AV821411;AY039541 SAR like DNA binding protein
1 2 3 8 RAFL04-09-C21 AV821367 Experimental RAFL04-09-C21 AV781791;AV821367;AF378894 unknown protein
1 2 3 9 RAFL04-09-E11 AV821375 Experimental RAFL04-09-E11 AV781800;AV821375;AF378885 nhp2-like protein
1 2 3 10 RAFL04-09-K07 AY039527 Experimental RAFL04-09-K07 AV781826;AV821393;AY039527 acyl carrier like protein
1 2 3 11 RAFL04-09-B02 AY039521 Experimental RAFL04-09-B02 AV781777;AV821355;AY039521 DNA gyrase subunit B - like protein
1 2 3 12 RAFL04-09-N16 BP560564 Experimental RAFL04-09-N16 AV781851;BP560564;AY075692
1 2 3 13 RAFL04-09-F23 AV821378 Experimental RAFL04-09-F23 AV781808;AV821378;AF378887 40S ribosomal protein; contains C-terminal domain
1 2 3 14 RAFL04-09-C15 AY039537 Experimental RAFL04-09-C15 AV781788;AV821364;AY039537 unknown protein
1 2 4 1 RAFL04-14-H12 AV821624 Experimental RAFL04-14-H12 AV782135;AV821624;AF370231 putative bHLH transcription factor (bHLH058)
1 2 4 2 RAFL04-15-C21 BP560618 Experimental RAFL04-15-C21 BP560618;AY039923
1 2 4 3 RAFL04-15-E10 AY039945 Experimental RAFL04-15-E10 AV782213;AV821686;AY039945 adenylate kinase
1 2 4 4 RAFL04-14-I22 AV821631 Experimental RAFL04-14-I22 AV782145;AV821631 putative DNA gyrase subunit A
1 2 4 5 RAFL04-15-J20 AV821713 Experimental RAFL04-15-J20 AV782246;AV821713;AF370267 unknown protein
1 2 4 6 RAFL04-15-B17 AY034979 Experimental RAFL04-15-B17 AV782192;AV821669;AY034979 chloroplast Cpn21 protein
1 2 4 7 RAFL04-15-C12 AV821671 Experimental RAFL04-15-C12 AV782195;AV821671;AF370228 unknown protein (F10O3.6)
1 2 4 8 RAFL04-15-J07 AY039922 Experimental RAFL04-15-J07 AV782243;AV821710;AY039922 unknown protein
1 2 4 9 RAFL04-09-G05 AY039543 Experimental RAFL04-09-G05 AV781809;AV821379;AY039543 unknown protein
1 2 4 10 RAFL04-09-O21 AY075698 Experimental RAFL04-09-O21 AV781859;AV821414;AY075698 putative APG protein
1 2 4 11 RAFL04-09-D16 AV821372 Experimental RAFL04-09-D16 AV781796;AV821372;AF378879 6-phosphogluconolactonase-like protein
1 2 4 12 RAFL04-09-B10 AV821358 Experimental RAFL04-09-B10 AV781780;AV821358;AF378871 putative protein
1 2 4 13 RAFL04-09-J03 BP560557 Experimental RAFL04-09-J03 AV781820;BP560557;AF378862 ARF1-binding protein
1 2 4 14 RAFL04-09-L21 AY039513 Experimental RAFL04-09-L21 AV781836;AV821400;AY039513 mitochondrial F1-ATPase, gamma subunit (ATP3_ARATH)
1 2 5 1 RAFL04-09-O24 AY035156 Experimental RAFL04-09-O24 AV781861;AV821416;AY035156 xyloglucan endo-1,4-beta-D-glucanase precursor
1 2 5 2 RAFL04-15-H14 AY063809 Experimental RAFL04-15-H14 AV782235;AV821705;AY063809 putative aspartate-tRNA ligase
1 2 5 3 RAFL04-15-G04 AV821700 Experimental RAFL04-15-G04 AV782230;AV821700;AF370236 DnaJ-like protein
1 2 5 4 RAFL04-14-P24 AY034919 Experimental RAFL04-14-P24 AV782177;AV821657;AY034919 cinnamyl alcohol dehydrogenase like protein
1 2 5 5 RAFL04-14-M12 AV782158 Experimental RAFL04-14-M12 AV782158;AF370290 unknown protein
1 2 5 6 RAFL04-14-M08 BP560612 Experimental RAFL04-14-M08 AV782157;BP560612;AY035008
1 2 5 7 RAFL04-14-K04 AY035154 Experimental RAFL04-14-K04 AV782149;AV821637;AY035154 actin depolymerizing factor 1 (ADF1)
1 2 5 8 RAFL04-15-E14 AV821687 Experimental RAFL04-15-E14 AV782214;AV821687;AF370248 unknown protein
1 2 5 9 RAFL04-15-B08 AV821668 Experimental RAFL04-15-B08 AV782189;AV821668;AF370233 unknown protein
1 2 5 10 RAFL04-15-A04 AY034917 Experimental RAFL04-15-A04 AV782179;AY034917 DEF (CLA1) protein
1 2 5 11 RAFL04-14-I04 BP560607 Experimental RAFL04-14-I04 AV782136;BP560607;AY142543 ribulose bisphosphate carboxylase small chain 1b precursor (RuBisCO small subunit 1b) (sp|P10796)
1 2 5 12 RAFL04-15-G17 AV821702 Experimental RAFL04-15-G17 AV782232;AV821702 putative ammonium transporter
1 2 5 13 RAFL04-15-A14 AV821662 Experimental RAFL04-15-A14 AV782182;AV821662 glyceraldehyde 3-phosphate dehydrogenase A, cholorplast precursor, putative
1 2 5 14 RAFL04-14-K23 BP560610 Experimental RAFL04-14-K23 AV782151;BP560610;AY096638 putative protein
1 2 6 1 RAFL04-18-D02 AV821924 Experimental RAFL04-18-D02 AV782508;AV821924;AF370524 Unknown protein (F15M7.14)
1 2 6 2 RAFL04-19-D21 AV821977 Experimental RAFL04-19-D21 AV782572;AV821977;AF386960 unknown protein
1 2 6 3 RAFL04-17-J19 AY128346 Experimental RAFL04-17-J19 AV782462;AY128346 putative protein
1 2 6 4 RAFL04-17-F17 BT002390 Experimental RAFL04-17-F17 AV782429;AV821863;BT002390 heat shock protein 70 like protein
1 2 6 5 RAFL04-19-P11 AY128360 Experimental RAFL04-19-P11 AV782636;AV822017;AY128360 putative lectin
1 2 6 6 RAFL04-19-L09 AY081267 Experimental RAFL04-19-L09 AV782619;AV822006;AY081267 putative protein
1 2 6 7 RAFL04-19-A16 AY092960 Experimental RAFL04-19-A16 AV782554;AV821963;AY092960 receptor-kinase isolog, 5' partial
1 2 6 8 RAFL04-17-N14 AV821904 Experimental RAFL04-17-N14 AV782488;AV821904 ERD3 protein (ERD3)
1 2 6 9 RAFL04-19-I09 AV821994 Experimental RAFL04-19-I09 AV782598;AV821994
1 2 6 10 RAFL04-19-K01 AV821998 Experimental RAFL04-19-K01 AV782608;AV821998 putative DnaJ protein
1 2 6 11 RAFL04-17-I02 AV821878 Experimental RAFL04-17-I02 AV782450;AV821878 arginine decarboxylase
1 2 6 12 RAFL04-18-N15 AY054693 Experimental RAFL04-18-N15 AV782544;AV821954;AY054693 beta tubulin
1 2 6 13 RAFL04-09-P22 AY090927 Experimental RAFL04-09-P22 AV821420;AY090927
1 2 6 14 RAFL04-09-P15 AY039940 Experimental RAFL04-09-P15 AV781863;AV821419;AY039940 putative pre-mRNA splicing factor PRP19
1 2 7 1 RAFL05-05-E23 BP560794 Experimental RAFL05-05-E23 AV783088;BP560794;AF385694
1 2 7 2 RAFL05-05-D20 AV822344 Experimental RAFL05-05-D20 AV783082;AV822344;AF385685 NAM (no apical meristem)-like protein
1 2 7 3 RAFL04-18-F12 AY081269 Experimental RAFL04-18-F12 AV782519;AV821932;AY081269 Rab GDP dissociation inhibitor
1 2 7 4 RAFL04-18-B08 AY059813 Experimental RAFL04-18-B08 AV782505;AV821921;AY059813 pEARLI 4 protein
1 2 7 5 RAFL04-19-D24 AY062631 Experimental RAFL04-19-D24 AV782574;AV821979;AY062631 putative casein kinase II catalytic (alpha) subunit
1 2 7 6 RAFL04-17-L21 BT002038 Experimental RAFL04-17-L21 AV782478;BP560665;BT002038 EID1 (Empfindlicher Im Dunkelroten Licht 1)
1 2 7 7 RAFL04-19-J16 BP560683 Experimental RAFL04-19-J16 AV782603;BP560683;AF386984 poly(A)-binding protein II-like
1 2 7 8 RAFL04-19-B12 AY054695 Experimental RAFL04-19-B12 AV782561;AV821968;AY054695 Unknown protein (At1g60230)
1 2 7 9 RAFL04-19-L23 AV822008 Experimental RAFL04-19-L23 AV782622;AV822008;AF386974 30S ribosomal protein S17, chloroplast precursor (CS17)
1 2 7 10 RAFL04-19-H21 AV782594 Experimental RAFL04-19-H21 AV782594 unknown protein
1 2 7 11 RAFL04-17-L19 BT002026 Experimental RAFL04-17-L19 AV782477;AV821897;BT002026 unknown protein
1 2 7 12 RAFL04-17-I17 BT000439 Experimental RAFL04-17-I17 AV782456;BP560663;BT000439 putative protein
1 2 7 13 RAFL04-17-G13 AV821867 Experimental RAFL04-17-G13 AV782435;AV821867;AF386972 putative protein
1 2 7 14 RAFL04-17-O11 AV821910 Experimental RAFL04-17-O11 AV782494;AV821910;AF386970 Unknown protein (At2g44650; F16B22.14)
1 2 8 1 RAFL05-04-F08 AV822287 Experimental RAFL05-04-F08 AV783008;AV822287;AF385719 60S ribosomal protein L7A
1 2 8 2 RAFL05-04-E03 AV822281 Experimental RAFL05-04-E03 AV783000;AV822281;AF385716 unknown protein
1 2 8 3 RAFL05-05-G03 AV822354 Experimental RAFL05-05-G03 AV783095;AV822354;AF385709
1 2 8 4 RAFL05-05-F06 AY039602 Experimental RAFL05-05-F06 AV783091;AV822350;AY039602 n-acetylglucosaminyl-phosphatidylinositol-like protein
1 2 8 5 RAFL05-04-E02 AV822280 Experimental RAFL05-04-E02 AV782999;AV822280;AF385736 translation initiation factor-like protein
1 2 8 6 RAFL05-05-G02 AV822353 Experimental RAFL05-05-G02 AV783094;AV822353;AF385729 heat shock protein, putative
1 2 8 7 RAFL05-05-F02 AV822349 Experimental RAFL05-05-F02 AV783090;AV822349;AF385726 unknown protein
1 2 8 8 RAFL05-05-A20 AV822334 Experimental RAFL05-05-A20 AV783068;AV822334;AF385717 putative protein
1 2 8 9 RAFL05-03-K03 AY039604 Experimental RAFL05-03-K03 AV782941;AV822239;AY039604 unknown protein
1 2 8 10 RAFL05-03-H07 AY039599 Experimental RAFL05-03-H07 AV782929;AV822228;AY039599 RNA-binding protein
1 2 8 11 RAFL05-03-J16 AY093780 Experimental RAFL05-03-J16 AV782940;AV822238;AY093780 unknown protein
1 2 8 12 RAFL05-04-K23 AV822309 Experimental RAFL05-04-K23 AV783032;AV822309;AF385734 NAM-like protein
1 2 8 13 RAFL05-04-I04 AV822296 Experimental RAFL05-04-I04 AV822296;AF385720 putative SET protein, phospatase 2A inhibitor
1 2 8 14 RAFL05-04-D24 AV822279 Experimental RAFL05-04-D24 AV782998;AV822279;AF385712 photosystem I subunit VI precursor
1 2 9 1 RAFL05-07-H04 AY045937 Experimental RAFL05-07-H04 AV783206;AV822439;AY045937 unknown protein
1 2 9 2 RAFL05-07-E13 AV822424 Experimental RAFL05-07-E13 AV783187;AV822424;AF370157 putative protein
1 2 9 3 RAFL05-07-D16 AY035139 Experimental RAFL05-07-D16 AV783177;AV822417;AY035139 putative aldehyde dehydrogenase NAD+
1 2 9 4 RAFL05-07-C09 AY046034 Experimental RAFL05-07-C09 AV783168;AV822410;AY046034
1 2 9 5 RAFL05-08-D16 AY034942 Experimental RAFL05-08-D16 AV783300;AV822515;AY034942 unknown protein
1 2 9 6 RAFL05-05-O15 AV822390 Experimental RAFL05-05-O15 AV783141;AV822390;AF370302 actin 11 like protein
1 2 9 7 RAFL05-04-E09 BP560773 Experimental RAFL05-04-E09 AV783002;BP560773;AF385739 lipase like protein
1 2 9 8 RAFL05-05-G05 AY070722 Experimental RAFL05-05-G05 AV783096;AV822355;AY070722 putative ATP-dependent CLPB protein
1 2 9 9 RAFL05-04-A19 AV822265 Experimental RAFL05-04-A19 AV782978;AV822265;AF385721
1 2 9 10 RAFL05-04-O11 AY093777 Experimental RAFL05-04-O11 AV783055;AV822327;AY093777 chaperonin subunit, putative
1 2 9 11 RAFL05-03-K10 AV822240 Experimental RAFL05-03-K10 AV782942;AV822240;AF385705 AT-hook DNA-binding protein (AHP1)
1 2 9 12 RAFL05-03-H11 AY093776 Experimental RAFL05-03-H11 AV782931;AV822230;AY093776 transport protein
1 2 9 13 RAFL05-04-M03 AV822316 Experimental RAFL05-04-M03 AV783039;AV822316;AF385740 glycine cleavage system H protein precursor, putative
1 2 9 14 RAFL05-04-I14 AV822298 Experimental RAFL05-04-I14 AV783023;AV822298;AF385732
1 2 10 1 RAFL05-09-K10 AY080749 Experimental RAFL05-09-K10 AV783437;AY080749 putative protein
1 2 10 2 RAFL05-09-H09 AY080747 Experimental RAFL05-09-H09 AV822615;AY080747 CONSTANS-like B-box zinc finger protein-like
1 2 10 3 RAFL05-09-N10 AV822643 Experimental RAFL05-09-N10 AV783455;AV822643;AF370181 putative protein
1 2 10 4 RAFL05-09-L06 AV822634 Experimental RAFL05-09-L06 AV822634 very-long-chain fatty acid condensing enzyme CUT1, putative
1 2 10 5 RAFL05-09-I15 AY035142 Experimental RAFL05-09-I15 AV783424;AY035142 avirulence induced gene (AIG) - like protein
1 2 10 6 RAFL05-09-P03 AY034970 Experimental RAFL05-09-P03 AV783463;AY034970 putative strictosidine synthase
1 2 10 7 RAFL05-09-M02 BP560850 Experimental RAFL05-09-M02 AV783447;BP560850;AF370332 NDR1/HIN1-like protein 3 (NHL3)
1 2 10 8 RAFL05-09-G15 AV822612 Experimental RAFL05-09-G15 AV783418;AV822612;AF370307 G-box binding bZIP transcription factor GBF3 / AtbZip55
1 2 10 9 RAFL05-09-G08 AY040026 Experimental RAFL05-09-G08 AV783414;AV822608;AY040026 LEA76 homologue type2
1 2 10 10 RAFL05-09-M22 AV783451 Experimental RAFL05-09-M22 AV783451;AF370158 60S RIBOSOMAL PROTEIN - like
1 2 10 11 RAFL05-09-J09 AY045915 Experimental RAFL05-09-J09 AV783430;AV822623;AY045915 putative transcription factor CKC protein
1 2 10 12 RAFL05-09-G07 AV783413 Experimental RAFL05-09-G07 AV783413;AF370345 unknown protein
1 2 10 13 RAFL05-09-M21 AY080748 Experimental RAFL05-09-M21 AV783450;AV822639;AY080748
1 2 10 14 RAFL05-09-G04 AY080746 Experimental RAFL05-09-G04 AV783412;AV822607;AY080746 putative protein
1 2 11 1 RAFL05-14-B01 AY065098 Experimental RAFL05-14-B01 AV783873;AV822988;AY065098 thioredoxin (clone GIF1) (pir||S58118)
1 2 11 2 RAFL05-14-F18 AV823012 Experimental RAFL05-14-F18 AV783900;AV823012 phosphoenolpyruvate carboxykinase (ATP) -like protein
1 2 11 3 RAFL05-14-E15 AY120714 Experimental RAFL05-14-E15 AV783892;AV823004;AY120714 putative cinnamoyl-CoA reductase
1 2 11 4 RAFL05-13-N03 AY042851 Experimental RAFL05-13-N03 AV783853;AV822973;AY042851 hemolysin, putative
1 2 11 5 RAFL05-12-N02 AV822888 Experimental RAFL05-12-N02 AV783753;AV822888;AF386947 NIMIN-3
1 2 11 6 RAFL05-12-D01 AV822830 Experimental RAFL05-12-D01 AV783684;AV822830 putative alpha NAC
1 2 11 7 RAFL05-11-O22 AY054671 Experimental RAFL05-11-O22 AV783657;AV822811;AY054671
1 2 11 8 RAFL05-13-F01 AY042887 Experimental RAFL05-13-F01 AV783807;AV822930;AY042887 putative flavonol sulfotransferase
1 2 11 9 RAFL05-12-E23 AY054634 Experimental RAFL05-12-E23 AV783697;AV822841;AY054634 unknown protein
1 2 11 10 RAFL05-12-F21 BP560896 Experimental RAFL05-12-F21 AV783705;BP560896;AY059822 NADH-cytochrome b5 reductase
1 2 11 11 RAFL05-09-N21 AY050978 Experimental RAFL05-09-N21 AV783460;AV822647;AY050978 oligopeptidase A - like protein
1 2 11 12 RAFL05-09-J06 BP560847 Experimental RAFL05-09-J06 AV783428;BP560847;AF370160 gamma-VPE (vacuolar processing enzyme)
1 2 11 13 RAFL05-09-N19 AY039974 Experimental RAFL05-09-N19 AV783459;AV822646;AY039974 nuclear poly(A) polymerase
1 2 11 14 RAFL05-09-N18 AY045908 Experimental RAFL05-09-N18 AV783458;AY045908 lipid-transfer protein-like, predicted GPI-anchored protein
1 2 12 1 RAFL05-14-A12 AV822984 Experimental RAFL05-14-A12 AV783868;AV822984
1 2 12 2 RAFL05-14-F02 AV823008 Experimental RAFL05-14-F02 AV783896;AV823008 myrosinase TGG2
1 2 12 3 RAFL05-13-M13 AY081283 Experimental RAFL05-13-M13 AV783850;AV822971;AY081283 feebly-like protein
1 2 12 4 RAFL05-14-A18 AY072327 Experimental RAFL05-14-A18 AV783871;AV822986;AY072327 S-adenosylmethionine synthase 2
1 2 12 5 RAFL05-14-A14 AY054678 Experimental RAFL05-14-A14 AV783869;AV822985;AY054678 Pto kinase interactor 1, putative
1 2 12 6 RAFL05-14-G05 AY120725 Experimental RAFL05-14-G05 AV783904;AV823015;AY120725 unknown protein
1 2 12 7 RAFL05-13-P19 AV822980 Experimental RAFL05-13-P19 AV783864;AV822980;AF386938 Unknown protein
1 2 12 8 RAFL05-14-D21 AY054675 Experimental RAFL05-14-D21 AV783888;AV823001;AY054675 unknown protein
1 2 12 9 RAFL05-14-C08 AY065099 Experimental RAFL05-14-C08 AV783879;AV822995;AY065099 unknown protein
1 2 12 10 RAFL05-13-O08 AY120715 Experimental RAFL05-13-O08 AV783856;AV822975;AY120715 putative sugar transporter
1 2 12 11 RAFL05-14-G11 BP560929 Experimental RAFL05-14-G11 AV783907;BP560929 60S ribosomal protein L23
1 2 12 12 RAFL05-14-B03 AY059807 Experimental RAFL05-14-B03 AV783874;AV822989;AY059807 putative [Mn] superoxide dismutase
1 2 12 13 RAFL05-13-L07 AY054636 Experimental RAFL05-13-L07 AV783845;AV822965;AY054636 Unknown protein
1 2 12 14 RAFL05-14-C13 BP560922 Experimental RAFL05-14-C13 AV783881;BP560922 unknown protein
1 2 13 1 RAFL05-17-G17 AY050328 Experimental RAFL05-17-G17 AV784217;AV823283;AY050328 photosystem II oxygen-evolving complex protein 3 - like
1 2 13 2 RAFL05-18-B19 BP560999 Experimental RAFL05-18-B19 AV784286;BP560999;AY050326 fatty acid hydroxylase (FAH1)
1 2 13 3 RAFL05-17-M15 BP560991 Experimental RAFL05-17-M15 AV784255;BP560991;AY050363 putative NifU-like metallocluster assembly factor
1 2 13 4 RAFL05-17-L11 AY050358 Experimental RAFL05-17-L11 AV784245;AV823305;AY050358 unknown protein
1 2 13 5 RAFL05-18-A12 BP560997 Experimental RAFL05-18-A12 AV784279;BP560997 putative protein
1 2 13 6 RAFL05-18-A09 AY050335 Experimental RAFL05-18-A09 AV784277;AV823330;AY050335 putative nucleotide repair protein
1 2 13 7 RAFL05-16-L22 AY050327 Experimental RAFL05-16-L22 AV784154;AV823223;AY050327 indole-3-glycerol phosphate synthase
1 2 13 8 RAFL05-16-N18 AY074561 Experimental RAFL05-16-N18 AV784165;AV823232;AY074561 flavin-containing amine oxidase
1 2 13 9 RAFL05-17-B17 AY050362 Experimental RAFL05-17-B17 AV784185;AV823251;AY050362 putative protein 1 photosystem II oxygen-evolving complex
1 2 13 10 RAFL05-17-B11 BP560980 Experimental RAFL05-17-B11 AV784182;BP560980;AY050359 unknown protein
1 2 13 11 RAFL05-17-F09 AY050350 Experimental RAFL05-17-F09 AV784208;AV823274;AY050350
1 2 13 12 RAFL05-17-G02 AY050336 Experimental RAFL05-17-G02 AV784214;AV823280;AY050336 unknown protein
1 2 13 13 RAFL05-16-L21 AV823222 Experimental RAFL05-16-L21 AV784153;AV823222 beta-amylase
1 2 13 14 RAFL05-16-L10 AV823217 Experimental RAFL05-16-L10 AV784149;AV823217 putative protein
1 2 14 1 RAFL05-21-E21 BP561042 Experimental RAFL05-21-E21 AV784571;BP561042;AY045829 Carboxylesterase-like protein
1 2 14 2 RAFL05-21-D14 AV823567 Experimental RAFL05-21-D14 AV784563;AV823567 putative Iron/Ascorbate oxidoreductase family protein
1 2 14 3 RAFL05-21-G07 AY045971 Experimental RAFL05-21-G07 AV784579;AV823581;AY045971
1 2 14 4 RAFL05-21-H02 AY080754 Experimental RAFL05-21-H02 AV784584;AV823587;AY080754 putative protein
1 2 14 5 RAFL05-17-E16 AY050366 Experimental RAFL05-17-E16 AV784203;AV823269;AY050366 unknown protein
1 2 14 6 RAFL05-17-C14 AV823254 Experimental RAFL05-17-C14 AV784188;AV823254 AMP-binding protein, putative
1 2 14 7 RAFL05-17-M09 AY050352 Experimental RAFL05-17-M09 AV784254;AV823314;AY050352 Eukaryotic peptide chain release factor subunit 1 (ERF1), 5' partial
1 2 14 8 RAFL05-17-H03 AY139760 Experimental RAFL05-17-H03 AV784222;AV823288;AY139760 unknown protein
1 2 14 9 RAFL05-17-H01 AV823287 Experimental RAFL05-17-H01 AV823287 putative protein
1 2 14 10 RAFL05-18-D02 AY095989 Experimental RAFL05-18-D02 AV784293;AV823344;AY095989 amine oxidase -like protein
1 2 14 11 RAFL05-16-H23 AY074574 Experimental RAFL05-16-H23 AV784125;AV823194;AY074574 putative DNA-binding protein
1 2 14 12 RAFL05-16-K11 BP560973 Experimental RAFL05-16-K11 AV784142;BP560973;AY050360 serine/threonine protein kinase-like protein
1 2 14 13 RAFL05-16-J08 AY074567 Experimental RAFL05-16-J08 AV784136;AV823204;AY074567 putative protein
1 2 14 14 RAFL05-16-K04 AY050345 Experimental RAFL05-16-K04 AV784140;AV823208;AY050345 unknown protein
1 3 1 1 RAFL02-07-F13 AY037194 Experimental RAFL02-07-F13 AV781443;AV821160;AY037194 unknown protein
1 3 1 2 RAFL02-08-I15 BP560463 Experimental RAFL02-08-I15 AV781483;BP560463;AF372876 unknown protein
1 3 1 3 RAFL02-06-L17 AY037216 Experimental RAFL02-06-L17 AV821151;AY037216
1 3 1 4 RAFL02-07-N23 AY037210 Experimental RAFL02-07-N23 AV781455;AV821167;AY037210 serine carboxypeptidase II like protein
1 3 1 5 RAFL02-07-O01 AY037205 Experimental RAFL02-07-O01 AV781456;AV821168;AY037205 putative NADP-dependent glyceraldehyde-3-phosphate dehydrogenase
1 3 1 6 RAFL02-06-J22 AV821150 Experimental RAFL02-06-J22 AV781425;AV821150;AF372891 unknown protein
1 3 1 7 RAFL02-09-N20 BP560469 Experimental RAFL02-09-N20 AV781521;BP560469;AF372888 unknown protein
1 3 1 8 RAFL02-07-B18 AY048204 Experimental RAFL02-07-B18 AV781437;AV821158;AY048204 oxidoreductase, putative
1 3 1 9 RAFL02-08-J13 AY102096 Experimental RAFL02-08-J13 AV781488;AV821184;AY102096 5-oxoprolinase -like protein
1 3 1 10 RAFL02-09-E22 AV821195 Experimental RAFL02-09-E22 AV781507;AV821195;AF372910 putative protein
1 3 1 11 RAFL02-09-H01 AY078973 Experimental RAFL02-09-H01 AV781512;AV821198;AY078973 senescence-associated protein sen1
1 3 1 12 RAFL02-07-M07 AY037198 Experimental RAFL02-07-M07 AV781452;AV821165;AY037198 putative amidase
1 3 1 13 RAFL02-06-M14 AY070473 Experimental RAFL02-06-M14 AV821152;AY070473 chlorophyll a/b-binding protein
1 3 1 14 RAFL02-10-I24 AV821222 Experimental RAFL02-10-I24 AV781556;AV821222;AF372877 putative protein
1 3 2 1 RAFL04-12-G23 AY034994 Experimental RAFL04-12-G23 AV781966;AV821491;AY034994 unknown protein
1 3 2 2 RAFL04-14-F18 AV821619 Experimental RAFL04-14-F18 AV782129;AV821619;AF370244 serine-type carboxypeptidase II-like protein
1 3 2 3 RAFL04-14-C14 AY045787 Experimental RAFL04-14-C14 AV782116;AV821608;AY045787 putative chlorophyll a/b binding protein
1 3 2 4 RAFL04-14-E08 AY035127 Experimental RAFL04-14-E08 AV782122;AV821614;AY035127 putative membrane transporter
1 3 2 5 RAFL03-05-F10 AY037215 Experimental RAFL03-05-F10 AV781627;AV821272;AY037215 receptor-like protein kinase
1 3 2 6 RAFL03-05-O03 AY037206 Experimental RAFL03-05-O03 AV781637;AV821281;AY037206 unknown protein
1 3 2 7 RAFL03-05-K01 AY070475 Experimental RAFL03-05-K01 AV781632;AV821277;AY070475 putative RNA-binding protein
1 3 2 8 RAFL03-02-I03 BP560492 Experimental RAFL03-02-I03 AV781596;BP560492;AF372896 60S ribosomal protein L12
1 3 2 9 RAFL03-05-L05 AV821278 Experimental RAFL03-05-L05 AV781634;AV821278;AF372887 unknown protein
1 3 2 10 RAFL03-05-B01 AY037189 Experimental RAFL03-05-B01 AV781618;AV821264;AY037189
1 3 2 11 RAFL02-09-C13 AV821191 Experimental RAFL02-09-C13 AV781503;AV821191;AF372913 putative wound induced protein
1 3 2 12 RAFL02-09-J10 AY078975 Experimental RAFL02-09-J10 AV781517;AV821200;AY078975 hypothetical protein
1 3 2 13 RAFL02-08-D13 AY070474 Experimental RAFL02-08-D13 AV781469;AV821175;AY070474 unknown protein
1 3 2 14 RAFL02-07-B16 AY048206 Experimental RAFL02-07-B16 AV781436;AV821157;AY048206 putative protein
1 3 3 1 RAFL04-12-M06 AY035105 Experimental RAFL04-12-M06 AV781990;AV821507;AY035105 acyltransferase-like protein
1 3 3 2 RAFL04-13-A09 AY080783 Experimental RAFL04-13-A09 AV782014;AV821523;AY080783 unknown protein
1 3 3 3 RAFL04-10-L18 AY080742 Experimental RAFL04-10-L18 AV781919;AV821462;AY080742 putative protein
1 3 3 4 RAFL04-10-L14 AY034980 Experimental RAFL04-10-L14 AV781918;AV821461;AY034980 unknown protein
1 3 3 5 RAFL04-13-B02 AV782023 Experimental RAFL04-13-B02 AV782023 phenylalanine ammonia lyase (PAL1)
1 3 3 6 RAFL04-12-L23 AY034916 Experimental RAFL04-12-L23 AV781988;AV821505;AY034916 zinc finger like protein
1 3 3 7 RAFL04-13-A13 AV821526 Experimental RAFL04-13-A13 AV782017;AV821526;AF370289 fructokinase 1
1 3 3 8 RAFL04-13-O08 AV821587 Experimental RAFL04-13-O08 AV782091;AV821587;AF370280 unknown protein
1 3 3 9 RAFL04-13-L04 BP560600 Experimental RAFL04-13-L04 AV782071;BP560600 putative protein
1 3 3 10 RAFL04-13-H03 AV821553 Experimental RAFL04-13-H03 AV782048;AV821553 unknown protein
1 3 3 11 RAFL04-13-A02 AY035175 Experimental RAFL04-13-A02 AV821521;AY035175 unknown protein
1 3 3 12 RAFL04-12-J23 BP560589 Experimental RAFL04-12-J23 AV781981;BP560589;AY080740 hypothetical protein
1 3 3 13 RAFL04-10-M13 AV821463 Experimental RAFL04-10-M13 AV781921;AV821463 LAX1 / AUX1 -like permease
1 3 3 14 RAFL04-10-L10 AY035004 Experimental RAFL04-10-L10 AV781917;AV821460;AY035004 putative protein kinase
1 3 4 1 RAFL04-17-B18 AV821838 Experimental RAFL04-17-B18 AV782394;AV821838 fatty acid elongase - like protein (cer2-like)
1 3 4 2 RAFL04-16-B20 AF386956 Experimental RAFL04-16-B20 AF386956 Unknown protein (MOK16.3)
1 3 4 3 RAFL04-16-G09 AY065194 Experimental RAFL04-16-G09 AV782325;AV821784;AY065194 putative U5 small nuclear ribonucleoprotein, an RNA helicase
1 3 4 4 RAFL04-16-K05 AY072310 Experimental RAFL04-16-K05 AV782350;AV821804;AY072310 putative protein
1 3 4 5 RAFL04-16-F01 AV821777 Experimental RAFL04-16-F01 AV782318;AV821777 cytoplasmatic aconitate hydratase (citrate hydro-lyase)(aconitase)(EC 4.2.1.3)
1 3 4 6 RAFL04-15-M15 AV821734 Experimental RAFL04-15-M15 AV782271;AV821734 ankyrin-like protein
1 3 4 7 RAFL04-15-L10 AV821724 Experimental RAFL04-15-L10 AV782260;AV821724;AF370548 putative 40S ribosomal protein S10
1 3 4 8 RAFL04-16-J12 AY072308 Experimental RAFL04-16-J12 AV782348;AV821802;AY072308 cytochrome P450 monooxygenase like protein
1 3 4 9 RAFL04-12-P17 AY035106 Experimental RAFL04-12-P17 AV782008;AV821519;AY035106 unknown protein
1 3 4 10 RAFL04-12-N15 AV821512 Experimental RAFL04-12-N15 AV781998;AV821512 regulator of chromosome condensation-like protein
1 3 4 11 RAFL04-12-J12 AY035155 Experimental RAFL04-12-J12 AV781978;AV821499;AY035155 unknown protein
1 3 4 12 RAFL04-13-G15 AV821550 Experimental RAFL04-13-G15 AV782045;AV821550;AF370249 unknown protein
1 3 4 13 RAFL04-13-E09 AV821542 Experimental RAFL04-13-E09 AV782035;AV821542;AF370234 unknown protein
1 3 4 14 RAFL04-10-H19 AV821448 Experimental RAFL04-10-H19 AV781904;AV821448;AF370215 predicted GPI-anchored protein
1 3 5 1 RAFL04-18-F04 AY128358 Experimental RAFL04-18-F04 AV782516;AV821930;AY128358 unknown protein
1 3 5 2 RAFL04-17-N23 AV821908 Experimental RAFL04-17-N23 AV782492;AV821908 putative protein
1 3 5 3 RAFL04-19-N16 AY054601 Experimental RAFL04-19-N16 AV782630;AY054601 unknown protein
1 3 5 4 RAFL04-17-L15 AY128341 Experimental RAFL04-17-L15 AV782475;AV821896;AY128341 unknown protein
1 3 5 5 RAFL04-18-D08 AV821925 Experimental RAFL04-18-D08 AV782509;AV821925;AF370552 thylakoid lumenal 17.4 kD protein, chloroplast precursor (P17.4) (sp|P81760)
1 3 5 6 RAFL04-18-P03 AV821957 Experimental RAFL04-18-P03 AV782547;AV821957 60S ribosomal protein L15 homolog
1 3 5 7 RAFL04-19-O21 AV822015 Experimental RAFL04-19-O21 AV782634;AV822015 fructose-bisphosphate aldolase like protein
1 3 5 8 RAFL04-19-K16 AY054599 Experimental RAFL04-19-K16 AV782612;AV822000;AY054599 unknown protein
1 3 5 9 RAFL04-17-K15 AV821892 Experimental RAFL04-17-K15 AV782470;AV821892;AF386961 mitogen-activated protein kinase 3
1 3 5 10 RAFL04-19-E10 AY128338 Experimental RAFL04-19-E10 AV782580;AV821983;AY128338
1 3 5 11 RAFL04-16-O14 AY059801 Experimental RAFL04-16-O14 AV782377;AV821822;AY059801 Unknown protein (MOP10.6)
1 3 5 12 RAFL04-16-O12 AY059810 Experimental RAFL04-16-O12 AV782376;AV821821;AY059810 peroxidase prxr1
1 3 5 13 RAFL04-16-D08 AY092957 Experimental RAFL04-16-D08 AV782312;AV821771;AY092957 phenylalanine ammonia-lyase
1 3 5 14 RAFL04-16-L01 BP560644 Experimental RAFL04-16-L01 AV782357;BP560644 putative aspartic proteinase
1 3 6 1 RAFL05-01-D08 AV822111 Experimental RAFL05-01-D08 AV782765;AV822111;AF375458 putative steroid sulfotransferase
1 3 6 2 RAFL05-01-F03 AY065044 Experimental RAFL05-01-F03 AV782773;AV822116;AY065044 putative protein
1 3 6 3 RAFL05-01-K18 AY065042 Experimental RAFL05-01-K18 AV782798;AV822137;AY065042 glucose-6-phosphate 1-dehydrogenase
1 3 6 4 RAFL05-01-M12 AY037227 Experimental RAFL05-01-M12 AV782804;AV822140;AY037227 dormancy-associated protein
1 3 6 5 RAFL05-01-I18 AV822130 Experimental RAFL05-01-I18 AV782788;AV822130 GDP-D-mannose-4,6-dehydratase (MUR1)
1 3 6 6 RAFL05-01-D05 BP560713 Experimental RAFL05-01-D05 AV782764;BP560713;AY126985 putative protein
1 3 6 7 RAFL05-01-L22 AY037242 Experimental RAFL05-01-L22 AV782802;AV822139;AY037242 putative carboxylesterase
1 3 6 8 RAFL05-01-D12 AY039852 Experimental RAFL05-01-D12 AV782766;AV822112;AY039852 similar to polygalacturonase-like protein
1 3 6 9 RAFL05-01-O06 AV822148 Experimental RAFL05-01-O06 AV782815;AV822148;AF375441 unknown protein
1 3 6 10 RAFL05-01-D02 AY037229 Experimental RAFL05-01-D02 AV782763;AV822110;AY037229
1 3 6 11 RAFL05-01-B14 AY039845 Experimental RAFL05-01-B14 AV822105;AY039845
1 3 6 12 RAFL05-01-P01 BP560727 Experimental RAFL05-01-P01 AV782817;BP560727;AF375422
1 3 6 13 RAFL04-18-N23 AV821956 Experimental RAFL04-18-N23 AV782546;AV821956;AF387016 putative protein
1 3 6 14 RAFL04-17-H01 AV821870 Experimental RAFL04-17-H01 AV782438;AV821870 putative protein
1 3 7 1 RAFL05-09-E17 AV822599 Experimental RAFL05-09-E17 AV783404;AV822599;AF370328 putative protein
1 3 7 2 RAFL05-07-O18 AY046026 Experimental RAFL05-07-O18 AV783265;AV822486;AY046026 putative protein kinase (T28I24.9/At2g24360)
1 3 7 3 RAFL05-02-I24 AV822178 Experimental RAFL05-02-I24 AV782857;AV822178;AF375446 translational inhibitor protein, putative
1 3 7 4 RAFL05-02-O13 AV822197 Experimental RAFL05-02-O13 AV782887;AV822197 unknown protein (At1g78830)
1 3 7 5 RAFL05-02-D04 AY039850 Experimental RAFL05-02-D04 AV782832;AV822158;AY039850 60S ribosomal protein L23A
1 3 7 6 RAFL05-02-G21 AY039846 Experimental RAFL05-02-G21 AV782848;AV822169;AY039846 reversibly glycosylated polypeptide-2 (AtRGP)
1 3 7 7 RAFL05-02-E09 AV822161 Experimental RAFL05-02-E09 AV782838;AV822161;AF375430 unknown protein
1 3 7 8 RAFL05-02-F02 AV822164 Experimental RAFL05-02-F02 AV782842;AV822164;AF375425 ribosomal protein L17 -like protein
1 3 7 9 RAFL05-02-M22 AY039854 Experimental RAFL05-02-M22 AV782878;AV822191;AY039854 unknown protein
1 3 7 10 RAFL05-02-K03 AV822181 Experimental RAFL05-02-K03 AV782863;AV822181;AF375445 light regulated protein, putative
1 3 7 11 RAFL05-02-L20 AV822186 Experimental RAFL05-02-L20 AV782870;AV822186;AF375442 dTDP-glucose 4-6-dehydratase - like protein
1 3 7 12 RAFL05-03-E09 AY037231 Experimental RAFL05-03-E09 AV822218;AY037231 4-alpha-glucanotransferase
1 3 7 13 RAFL05-02-H10 AY065040 Experimental RAFL05-02-H10 AV782851;AV822173;AY065040 phytochrome C (sp|P14714)
1 3 7 14 RAFL05-02-B05 AY037220 Experimental RAFL05-02-B05 AV782826;AV822154;AY037220 putative protein
1 3 8 1 RAFL05-07-G15 AY035140 Experimental RAFL05-07-G15 AV783200;AV822434;AY035140 unknown protein
1 3 8 2 RAFL05-08-H13 AY063813 Experimental RAFL05-08-H13 AV783327;AV822537;AY063813 ASH1-like protein 1 (ASHH1)
1 3 8 3 RAFL05-08-G05 AY034945 Experimental RAFL05-08-G05 AV783318;AV822527;AY034945 autophagy 7 (AtAPG7)
1 3 8 4 RAFL05-07-B18 AY034907 Experimental RAFL05-07-B18 AV783163;AY034907 unknown protein
1 3 8 5 RAFL05-07-I21 AY045938 Experimental RAFL05-07-I21 AV783218;AV822447;AY045938 unknown protein
1 3 8 6 RAFL05-07-H10 AY045923 Experimental RAFL05-07-H10 AV783210;AV822441;AY045923 putative protein
1 3 8 7 RAFL05-07-F03 AV783191 Experimental RAFL05-07-F03 AV783191
1 3 8 8 RAFL05-07-D21 BP560814 Experimental RAFL05-07-D21 AV783181;BP560814;AY034969 unknown protein
1 3 8 9 RAFL05-08-E01 AV783304 Experimental RAFL05-08-E01 AV783304;AF370330 putative disease resistance protein
1 3 8 10 RAFL05-08-C20 AV822509 Experimental RAFL05-08-C20 AV783293;AV822509;AF370303 putative protein
1 3 8 11 RAFL05-08-H09 AV822535 Experimental RAFL05-08-H09 AV783325;AV822535;AF370177 FH protein interacting protein FIP1
1 3 8 12 RAFL05-07-C14 AY045922 Experimental RAFL05-07-C14 AV783170;AV822412;AY045922 unknown protein
1 3 8 13 RAFL05-08-D22 AY090962 Experimental RAFL05-08-D22 AV783303;AV822517;AY090962
1 3 8 14 RAFL05-08-B11 AY034967 Experimental RAFL05-08-B11 AV783283;AY034967 unknown protein
1 3 9 7 RAFL05-08-N13 BP560839 Experimental RAFL05-08-N13 BP560839 unknown protein
1 3 9 8 RAFL05-08-M07 AY056195 Experimental RAFL05-08-M07 AV783350;AV822551;AY056195 unknown protein
1 3 9 9 RAFL05-08-K17 AY035143 Experimental RAFL05-08-K17 AV783343;AV822546;AY035143 lipoic acid synthase (LIP1)
1 3 9 10 RAFL05-07-D23 AY039965 Experimental RAFL05-07-D23 AV783183;AV822420;AY039965 26S proteasome AAA-ATPase subunit RPT6a - like protein
1 3 9 11 RAFL05-07-D07 AY063811 Experimental RAFL05-07-D07 AV783173;AV822414;AY063811 kinesin-like calmodulin-binding protein
1 3 9 12 RAFL05-08-E04 AY034908 Experimental RAFL05-08-E04 AV783305;AV822519;AY034908 26S proteasome p55 protein-like
1 3 9 13 RAFL05-08-N12 AY040027 Experimental RAFL05-08-N12 AV783357;AV822557;AY040027 TOM20, putative
1 3 9 14 RAFL05-08-M04 BP560838 Experimental RAFL05-08-M04 AV783349;BP560838 putative protein
1 3 13 1 RAFL05-19-P23 AY045975 Experimental RAFL05-19-P23 AV784498;AV823514;AY045975 unknown protein
1 3 13 2 RAFL05-19-G17 AY045946 Experimental RAFL05-19-G17 AV784428;AV823460;AY045946 unknown protein
1 3 13 3 RAFL05-19-I07 AY080876 Experimental RAFL05-19-I07 AV784445;AY080876 putative protein kinase
1 3 13 4 RAFL05-19-C02 AY050772 Experimental RAFL05-19-C02 AV784396;AV823433;AY050772 imbibition protein homolog
1 3 13 5 RAFL05-19-M20 BT000798 Experimental RAFL05-19-M20 AV784474;AV823496;BT000798 B-box zinc finger protein (STH)
1 3 13 6 RAFL05-19-E17 AY096491 Experimental RAFL05-19-E17 AV784410;AV823444;AY096491 pyruvate,orthophosphate dikinase
1 3 13 7 RAFL05-19-P11 AY045972 Experimental RAFL05-19-P11 AV784494;AV823511;AY045972 unknown protein
1 3 13 8 RAFL05-19-H07 AY050765 Experimental RAFL05-19-H07 AV784435;AY050765 aspartate aminotransferase (Asp3)
1 3 13 9 RAFL05-19-K18 AV823481 Experimental RAFL05-19-K18 AV784457;AV823481 putative ubiquitin activating enzyme E1 (ECR1)
1 3 13 10 RAFL05-19-L13 AV784464 Experimental RAFL05-19-L13 AV784464
1 3 13 11 RAFL05-18-N22 AV823411 Experimental RAFL05-18-N22 AV784370;AV823411 ferrodoxin precursor
1 3 13 12 RAFL05-18-D14 AY045799 Experimental RAFL05-18-D14 AV784296;AV823347;AY045799 putative homolog of transport inhibitor response 1
1 3 13 13 RAFL05-18-F07 AY045969 Experimental RAFL05-18-F07 AV784305;AV823356;AY045969 unknown protein
1 3 13 14 RAFL05-18-J03 AY050998 Experimental RAFL05-18-J03 AV784335;AV823380;AY050998 putative lipase
1 3 14 1 RAFL06-10-A06 AY065154 Experimental RAFL06-10-A06 AV784964;AV823887;AY065154 cytochrome P450 71B1 - like protein
1 3 14 2 RAFL06-11-H18 AY059936 Experimental RAFL06-11-H18 AV785084;AV823981;AY059936 putative oleosin
1 3 14 3 RAFL06-11-D08 AY062825 Experimental RAFL06-11-D08 AV785062;AV823963;AY062825 tyrosine aminotransferase like protein
1 3 14 4 RAFL06-10-P23 AY065143 Experimental RAFL06-10-P23 AV785048;AV823952;AY065143 L-ascorbate peroxidase
1 3 14 5 RAFL05-19-M22 AY080878 Experimental RAFL05-19-M22 AV784476;AY080878 cytochrome b5 (dbj|BAA74839.1)
1 3 14 6 RAFL05-19-P17 AY045864 Experimental RAFL05-19-P17 AV784496;AV823513;AY045864 unknown protein
1 3 14 7 RAFL05-19-E13 AV823442 Experimental RAFL05-19-E13 AV823442 hypothetical protein
1 3 14 8 RAFL05-19-N08 AY045802 Experimental RAFL05-19-N08 AV784481;AV823501;AY045802 translationally controlled tumor protein-like protein
1 3 14 9 RAFL05-20-J01 BT000792 Experimental RAFL05-20-J01 AV784505;AV823519;BT000792 unknown protein
1 3 14 10 RAFL05-19-F21 AY045949 Experimental RAFL05-19-F21 AV784420;AV823452;AY045949 senescence-associated protein (SAG29)
1 3 14 11 RAFL05-19-J10 AY080877 Experimental RAFL05-19-J10 AV784450;AV823477;AY080877 hypothetical protein
1 3 14 12 RAFL05-19-N02 BP561025 Experimental RAFL05-19-N02 BP561025;AY045862 unknown protein
1 3 14 13 RAFL05-19-H14 AY096492 Experimental RAFL05-19-H14 AV784437;AV823467;AY096492 hypothetical protein
1 3 14 14 RAFL05-19-M02 AY080766 Experimental RAFL05-19-M02 AV784470;AV823491;AY080766
1 4 1 1 CHS Y18602 Experimental CHS Y18602 chalcone synthase (naringenin-chalcone synthase) (testa 4 protein) (sp|P13114)
1 4 1 2 ERD15 D30719 Experimental ERD15 D30719 dehydration-induced protein (ERD15)
1 4 1 3 RD26 AB039926 Experimental RD26 AB039926 unknown protein
1 4 1 4 RD21 D13043 Experimental RD21 D13043 cysteine proteinase RD21A
1 4 1 5 RD19 D13042 Experimental RD19 D13042 drought-inducible cysteine proteinase RD19A precursor
1 4 1 6 RD2 AB039925 Experimental RD2 AB039925 RD2 protein (RD2)
1 4 1 7 kin2 X62281 Experimental kin2 X62281 cold-regulated protein COR6.6 (KIN2)
1 4 1 8 cor15A U01377 Experimental cor15A U01377 cold-regulated protein cor15a precursor
1 4 2 1 RAFL03-09-L13 AV821346 Experimental RAFL03-09-L13 AV781759;AV821346;AF378876 unknown protein
1 4 2 2 RAFL03-06-L19 AY039530 Experimental RAFL03-06-L19 AV781663;AV821296;AY039530 unknown protein
1 4 2 3 RAFL03-08-H14 AV821328 Experimental RAFL03-08-H14 AV781725;AV821328;AF378865
1 4 2 4 RAFL03-07-H24 BP560514 Experimental RAFL03-07-H24 BP560514;AY039515 unknown protein
1 4 2 12 RD29-B3-DNA AY081282 At5g52300 Experimental RD29-B3'-DNA AY081282 At5g52300 low-temperature-induced 65 kD protein (sp|Q04980)
1 4 2 13 ATMY-B2 D14712 Experimental ATMY-B2 D14712 MYB transcription factor (Atmyb2)
1 4 2 14 DREB-1A AB007787 Experimental DREB-1A AB007787 DREB1A
1 4 3 1 RAFL04-09-M06 BP560562 Experimental RAFL04-09-M06 AV781841;BP560562;AF378896 unknown protein
1 4 3 2 RAFL04-09-F02 BP560553 Experimental RAFL04-09-F02 AV781806;BP560553;AY102099
1 4 3 3 RAFL04-09-M19 AV821406 Experimental RAFL04-09-M19 AV781845;AV821406;AF378878 26S proteasome regulatory subunit S12 (MOV34 protein) (sp|O24412)
1 4 3 4 RAFL04-09-D17 AY039525 Experimental RAFL04-09-D17 AV781797;AV821373;AY039525 unknown protein
1 4 3 5 RAFL04-09-G11 AY039523 Experimental RAFL04-09-G11 AV781810;AV821380;AY039523 unknown protein
1 4 3 6 RAFL04-09-J04 AY039517 Experimental RAFL04-09-J04 AV781821;AV821389;AY039517 unknown protein
1 4 3 7 RAFL04-09-M01 AV821402 Experimental RAFL04-09-M01 AV781839;AV821402;AF378895 60S ribosomal protein L13
1 4 3 8 RAFL04-09-E22 AV821377 Experimental RAFL04-09-E22 AV781805;AV821377;AF378888 unknown protein
1 4 3 9 RAFL04-09-L16 AV821399 Experimental RAFL04-09-L16 AV781834;AV821399;AF378875 putative esterase D
1 4 3 10 RAFL04-09-H07 AY039524 Experimental RAFL04-09-H07 AV821382;AY039524
1 4 3 11 RAFL04-09-B22 AV821359 Experimental RAFL04-09-B22 AV781782;AV821359 histone H2B -like protein
1 4 3 12 RAFL04-09-M08 AY075695 Experimental RAFL04-09-M08 AV781842;AV821403;AY075695
1 4 3 13 RAFL03-06-M19 AY039544 Experimental RAFL03-06-M19 AV781667;AV821299;AY039544 unknown protein
1 4 3 14 RAFL03-07-F22 AV821313 Experimental RAFL03-07-F22 AV781691;AV821313;AF378893 putative protein
1 4 4 1 RAFL04-14-O07 AV821649 Experimental RAFL04-14-O07 AV782167;AV821649;AF370229 Sgt1 like protein
1 4 4 2 RAFL04-15-E15 AY035129 Experimental RAFL04-15-E15 AV782215;AV821688;AY035129 putative zinc finger protein
1 4 4 3 RAFL04-15-I01 AY035103 Experimental RAFL04-15-I01 AV782236;AY035103 ATP-dependent Clp protease regulatory subunit CLPX
1 4 4 4 RAFL04-14-N10 AY035005 Experimental RAFL04-14-N10 AV782164;AV821647;AY035005 predicted GPI-anchored protein
1 4 4 5 RAFL04-14-I07 AY035149 Experimental RAFL04-14-I07 AV782138;AV821626;AY035149 unknown protein
1 4 4 6 RAFL04-14-N02 AY080741 Experimental RAFL04-14-N02 AV782161;AV821644;AY080741 ubiquitin-protein ligase UBC9
1 4 4 7 RAFL04-15-A17 AV821663 Experimental RAFL04-15-A17 AV782183;AV821663;AF370226 chloroplast 50S ribosomal protein L31, putative
1 4 4 8 RAFL04-15-B12 BP560616 Experimental RAFL04-15-B12 AV782191;BP560616;AY091123 putative protein
1 4 4 9 RAFL04-09-C19 AV821366 Experimental RAFL04-09-C19 AV781790;AV821366;AF378900 putative translation initiation factor eIF-1A
1 4 4 10 RAFL04-09-L14 AV821398 Experimental RAFL04-09-L14 AV781833;AV821398;AF378886 unknown protein
1 4 4 11 RAFL04-09-E08 AY039533 Experimental RAFL04-09-E08 AV781799;AV821374;AY039533 ribosomal protein precursor - like
1 4 4 12 RAFL04-09-K21 AV821395 Experimental RAFL04-09-K21 AV781828;AV821395;AF378870 unknown protein
1 4 4 13 RAFL04-09-A19 AY039518 Experimental RAFL04-09-A19 AV781774;AV821353;AY039518 vacuolar-type H+-ATPase subunit B2 (VHA-B2)
1 4 4 14 RAFL04-09-O11 AY039514 Experimental RAFL04-09-O11 AV781857;AV821413;AY039514 similarity to myrosinase precursor
1 4 5 1 RAFL04-15-E16 AY039936 Experimental RAFL04-15-E16 AV782216;AV821689;AY039936 elongation factor G, putative
1 4 5 2 RAFL04-15-F11 AV821693 Experimental RAFL04-15-F11 AV782222;AV821693;AF370250 unknown protein
1 4 5 3 RAFL04-15-H06 AV821703 Experimental RAFL04-15-H06 AV782233;AV821703;AF370235 50S ribosomal protein L15, chloroplast precursor
1 4 5 4 RAFL04-15-B02 AY034918 Experimental RAFL04-15-B02 AV782185;AV821665;AY034918 RAN GTPase like protein
1 4 5 5 RAFL04-14-L12 AV821639 Experimental RAFL04-14-L12 AV782153;AV821639 unknown protein
1 4 5 6 RAFL04-14-L08 AY050854 Experimental RAFL04-14-L08 AV782152;AV821638;AY050854 60S ribosomal protein L13, BBC1 protein
1 4 5 7 RAFL04-15-F19 AY035152 Experimental RAFL04-15-F19 AV782225;AV821696;AY035152 putative spliceosome associated protein
1 4 5 8 RAFL04-15-J09 AV821711 Experimental RAFL04-15-J09 AV782244;AV821711;AF370247 phenylalanine-tRNA synthetase-like protein
1 4 5 9 RAFL04-14-O23 AY035176 Experimental RAFL04-14-O23 AV782173;AV821654;AY035176 putative tRNA pseudouridine synthase
1 4 5 10 RAFL04-14-I12 AY039924 Experimental RAFL04-14-I12 AV782141;AV821629;AY039924 nodulin-like protein
1 4 5 11 RAFL04-15-F17 AV821695 Experimental RAFL04-15-F17 AV782224;AV821695 unknown protein
1 4 5 12 RAFL04-15-F10 BP560622 Experimental RAFL04-15-F10 AV782221;BP560622;AY039938 endo-beta-1,4-glucanase, putative
1 4 5 13 RAFL04-15-E03 AY035151 Experimental RAFL04-15-E03 AV782211;AV821685;AY035151 unknown protein
1 4 5 14 RAFL04-14-O22 AY050853 Experimental RAFL04-14-O22 AV782172;AV821653;AY050853 cell division - like protein
1 4 6 1 RAFL04-17-K09 AY128359 Experimental RAFL04-17-K09 AV782468;AV821890;AY128359 hypothetical protein
1 4 6 2 RAFL04-17-O04 AV821909 Experimental RAFL04-17-O04 AV782493;AV821909 unknown protein
1 4 6 3 RAFL04-17-N02 AV782484 Experimental RAFL04-17-N02 AV782484 phosphoprotein phosphatase
1 4 6 4 RAFL04-18-F11 AY042825 Experimental RAFL04-18-F11 AV782518;AV821931;AY042825 lipid transfer protein; glossy1 homolog
1 4 6 5 RAFL04-19-H23 AV821992 Experimental RAFL04-19-H23 AV782596;AV821992 heat shock protein 70 (Hsc70-5)
1 4 6 6 RAFL04-19-M20 BP560687 Experimental RAFL04-19-M20 AV782626;BP560687;AF386958 unknown protein
1 4 6 7 RAFL04-20-D01 AV822034 Experimental RAFL04-20-D01 AV782656;AV822034;AF370528 nClpP3 protein
1 4 6 8 RAFL04-19-E23 AV821985 Experimental RAFL04-19-E23 AV782582;AV821985;AF370527
1 4 6 9 RAFL04-19-K20 AY054694 Experimental RAFL04-19-K20 AV782613;AV822001;AY054694 photoreceptor-interacting protein-like
1 4 6 10 RAFL04-17-C19 AY062630 Experimental RAFL04-17-C19 AV782400;AV821843;AY062630 caffeoyl-CoA O-methyltransferase - like protein
1 4 6 11 RAFL04-17-J16 AY065084 Experimental RAFL04-17-J16 AV782461;AV821885;AY065084 unknown protein
1 4 6 12 RAFL04-19-H09 BP560681 Experimental RAFL04-19-H09 AV782591;BP560681;AY054603 splicing factor-like protein
1 4 6 13 RAFL04-14-P12 BP560615 Experimental RAFL04-14-P12 AV782175;BP560615;AY046006 progesterone-binding protein-like
1 4 6 14 RAFL04-14-N04 AY039939 Experimental RAFL04-14-N04 AV782162;AV821645;AY039939 unknown protein
1 4 7 1 RAFL05-05-J20 BP560796 Experimental RAFL05-05-J20 AV783110;BP560796;AF385697 putative protein
1 4 7 2 RAFL05-04-D23 AY126986 Experimental RAFL05-04-D23 AV782997;AY126986 alcohol dehydrogenase (EC 1.1.1.1) class III (pir||S71244)
1 4 7 3 RAFL04-19-D10 AV782570 Experimental RAFL04-19-D10 AV782570 putative protein
1 4 7 4 RAFL04-19-C07 AY059812 Experimental RAFL04-19-C07 AV782567;AV821973;AY059812 multifunctional aminoacyl-tRNA ligase-like protein
1 4 7 5 RAFL04-17-L07 AY042883 Experimental RAFL04-17-L07 AV782473;AV821894;AY042883 protochlorophyllide reductase precursor
1 4 7 6 RAFL04-17-F05 BT002031 Experimental RAFL04-17-F05 AV782424;AV821860;BT002031 putative peptidyl-prolyl cis-trans isomerase
1 4 7 7 RAFL04-18-L19 AY128361 Experimental RAFL04-18-L19 AV782538;AV821949;AY128361 40S ribosomal protein S30 homolog (emb|CAB79697.1)
1 4 7 8 RAFL04-20-B10 BP560689 Experimental RAFL04-20-B10 AV782648;BP560689;AF387017 Unknown protein (MQK4.29)
1 4 7 9 RAFL04-17-L09 AV821895 Experimental RAFL04-17-L09 AV782474;AV821895 putative protein
1 4 7 10 RAFL04-17-K07 BP560664 Experimental RAFL04-17-K07 AV782467;BP560664;AY042839 putative protein
1 4 7 11 RAFL04-17-B05 BP560648 Experimental RAFL04-17-B05 AV782389;BP560648;AF370554 ABC transporter -like protein
1 4 7 12 RAFL04-20-C16 AY054607 Experimental RAFL04-20-C16 AV782655;AV822033;AY054607 unknown protein
1 4 7 13 RAFL04-20-A10 AV822022 Experimental RAFL04-20-A10 AV782641;AV822022 putative protein
1 4 7 14 RAFL04-18-B07 AV821920 Experimental RAFL04-18-B07 AV782504;AV821920;AF386964 ripening-related protein-like; contains similarity to pectinesterase (MMI9.18)
1 4 8 1 RAFL05-04-O09 AY039608 Experimental RAFL05-04-O09 AV783053;AV822325;AY039608 unknown protein
1 4 8 2 RAFL05-03-I20 AV822234 Experimental RAFL05-03-I20 AV822234;AF385715
1 4 8 3 RAFL05-03-H08 AV822229 Experimental RAFL05-03-H08 AV782930;AV822229;AF385707 unknown protein
1 4 8 4 RAFL05-04-I09 AY070717 Experimental RAFL05-04-I09 AV783022;AV822297;AY070717 unknown protein
1 4 8 5 RAFL05-03-G06 AV822223 Experimental RAFL05-03-G06 AV782923;AV822223;AF385737 unknown protein
1 4 8 6 RAFL05-04-G20 AY070723 Experimental RAFL05-04-G20 AV783014;AV822291;AY070723 putative 3-methylcrotonyl-CoA carboxylase
1 4 8 7 RAFL05-05-E24 AV822348 Experimental RAFL05-05-E24 AV783089;AV822348;AF385724 unknown protein
1 4 8 8 RAFL05-03-P12 AV822259 Experimental RAFL05-03-P12 AV822259;AF385714 xyloglucan endo-transglycosylase, putative
1 4 8 9 RAFL05-05-A18 AV822333 Experimental RAFL05-05-A18 AV783067;AV822333;AF385699 RING zinc finger like protein
1 4 8 10 RAFL05-03-M02 BP560759 Experimental RAFL05-03-M02 AV782950;BP560759;AY070718
1 4 8 11 RAFL05-05-A17 AV822332 Experimental RAFL05-05-A17 AV783066;AV822332;AF385741 unknown protein
1 4 8 12 RAFL05-03-L24 AY039614 Experimental RAFL05-03-L24 AV782949;AV822246;AY039614 60S ribosomal protein L12 - like
1 4 8 13 RAFL05-03-H05 AY070721 Experimental RAFL05-03-H05 AV782927;AV822227;AY070721 putative protein
1 4 8 14 RAFL05-03-G03 AV822222 Experimental RAFL05-03-G03 AV782922;AV822222;AF385710 calcium-dependent protein kinase (CDPK6)
1 4 9 1 RAFL05-09-E07 AY040024 Experimental RAFL05-09-E07 AV822597;AY040024 lycopene epsilon cyclase
1 4 9 2 RAFL05-09-D05 AV822588 Experimental RAFL05-09-D05 AV783394;AV822588;AF370156 putative protein
1 4 9 3 RAFL05-07-N10 AY045932 Experimental RAFL05-07-N10 AV783253;AV822475;AY045932 ABC transporter - like protein
1 4 9 4 RAFL05-07-M03 AV822467 Experimental RAFL05-07-M03 AV783242;AV822467;AF370343 putative short-chain dehydrogenase
1 4 9 5 RAFL05-07-J12 AV822451 Experimental RAFL05-07-J12 AV783224;AV822451;AF370329 fructokinase, putative
1 4 9 6 RAFL05-07-I02 AV822446 Experimental RAFL05-07-I02 AV783215;AV822446;AF370301 DNA-directed RNA polymerase II subunit-like protein
1 4 9 7 RAFL05-04-I18 AV822299 Experimental RAFL05-04-I18 AV783024;AV822299;AF385745 At1g67850/F12A21_2
1 4 9 8 RAFL05-04-E07 AV822282 Experimental RAFL05-04-E07 AV783001;AV822282;AF385728
1 4 9 9 RAFL05-04-B21 AY039609 Experimental RAFL05-04-B21 AV782986;AV822270;AY039609 formate dehydrogenase (FDH)
1 4 9 10 RAFL05-05-C04 AY070720 Experimental RAFL05-05-C04 AV783078;AV822342;AY070720 putative protein
1 4 9 11 RAFL05-05-A23 BP560790 Experimental RAFL05-05-A23 AV783070;BP560790;AF385698 unknown protein
1 4 9 12 RAFL05-04-O10 AY039600 Experimental RAFL05-04-O10 AV783054;AV822326;AY039600 unknown protein
1 4 9 13 RAFL05-03-P16 AV822260 Experimental RAFL05-03-P16 AV782971;AV822260;AF385735 histone H3.3
1 4 9 14 RAFL05-05-A21 AV822335 Experimental RAFL05-05-A21 AV783069;AV822335;AF385731 MADS-box protein (AGL20)
1 4 10 1 RAFL05-09-L07 AY039960 Experimental RAFL05-09-L07 AV783443;AV822635;AY039960 unknown protein (At1g70100)
1 4 10 2 RAFL05-09-I18 AV822619 Experimental RAFL05-09-I18 AV783425;AV822619;AF370308 CASEIN KINASE II, ALPHA CHAIN 2 (CK II)
1 4 10 3 RAFL05-09-L03 AV822633 Experimental RAFL05-09-L03 AV783441;AV822633;AF370180 unknown protein
1 4 10 4 RAFL05-09-G13 AV822611 Experimental RAFL05-09-G13 AV783417;AV822611;AF370159 peptidyl-prolyl cis-trans isomerase-like protein
1 4 10 5 RAFL05-09-L23 AV822637 Experimental RAFL05-09-L23 AV783446;AV822637 unknown protein
1 4 10 6 RAFL05-09-I02 AV822618 Experimental RAFL05-09-I02 AV783422;AV822618 putative protein
1 4 10 7 RAFL05-09-O03 BT000738 Experimental RAFL05-09-O03 AV783462;AV822649;BT000738
1 4 10 8 RAFL05-09-K21 AY050855 Experimental RAFL05-09-K21 AV822632;AY050855 CCR4-ASSOCIATED FACTOR -like protein
1 4 10 9 RAFL05-08-B08 AV822501 Experimental RAFL05-08-B08 AV783282;AV822501;AF370178 40S RIBOSOMAL PROTEIN S16
1 4 10 10 RAFL05-07-P18 AY045924 Experimental RAFL05-07-P18 AV783272;AV822492;AY045924 unknown protein
1 4 10 11 RAFL05-07-O11 AY050858 Experimental RAFL05-07-O11 AV783264;AV822485;AY050858 ATP citrate lyase, putative
1 4 10 12 RAFL05-09-A04 AV822573 Experimental RAFL05-09-A04 AV783377;AV822573;AF370344 putative thymidine kinase
1 4 10 13 RAFL05-08-O08 AY034943 Experimental RAFL05-08-O08 AV783361;AV822561;AY034943 unknown protein
1 4 10 14 RAFL05-08-N02 AV822556 Experimental RAFL05-08-N02 AV783356;AV822556;AF370304 unknown protein
1 4 11 1 RAFL05-13-M02 AY081280 Experimental RAFL05-13-M02 AV783848;AV822968;AY081280 putative protein
1 4 11 2 RAFL05-12-O10 AV822893 Experimental RAFL05-12-O10 AV783760;AV822893 9G8-like splicing factor / SRZ-21
1 4 11 3 RAFL05-13-E18 AY054673 Experimental RAFL05-13-E18 AV783805;AV822928;AY054673 unknown protein
1 4 11 4 RAFL05-12-A05 AV822815 Experimental RAFL05-12-A05 AV783663;AV822815 AtOXA1
1 4 11 5 RAFL05-12-O19 AY054669 Experimental RAFL05-12-O19 AV783764;AV822897;AY054669 sedoheptulose-bisphosphatase precursor
1 4 11 6 RAFL05-12-O17 AY072328 Experimental RAFL05-12-O17 AV783763;AV822896;AY072328 unknown protein
1 4 11 7 RAFL05-12-P13 AY054676 Experimental RAFL05-12-P13 AV822901;AY054676 unknown protein
1 4 11 8 RAFL05-11-N02 AY042846 Experimental RAFL05-11-N02 AV783648;AV822803;AY042846 putative DNA-binding protein
1 4 11 9 RAFL05-13-E21 AV822929 Experimental RAFL05-13-E21 AV783806;AV822929 putative protein
1 4 11 10 RAFL05-13-D18 AY042843 Experimental RAFL05-13-D18 AV783795;AV822919;AY042843 60S ribosomal protein L17
1 4 11 11 RAFL05-09-N17 BT000760 Experimental RAFL05-09-N17 AV783457;AV822645;BT000760 unknown protein
1 4 11 12 RAFL05-09-K09 AV822629 Experimental RAFL05-09-K09 AV783436;AV822629
1 4 11 13 RAFL05-09-H04 AY039972 Experimental RAFL05-09-H04 AV783419;AV822614;AY039972 putative ABC transporter
1 4 11 14 RAFL05-09-N13 AY039966 Experimental RAFL05-09-N13 AV783456;AV822644;AY039966 putative kinesin heavy chain
1 4 12 1 RAFL05-13-L11 AV822966 Experimental RAFL05-13-L11 AV783846;AV822966;AF386990 predicted GPI-anchored protein
1 4 12 2 RAFL05-14-B16 AV822991 Experimental RAFL05-14-B16 AV783875;AV822991 Rubisco activase
1 4 12 3 RAFL05-14-F05 AY065201 Experimental RAFL05-14-F05 AV783898;AV823010;AY065201 soluble inorganic pyrophosphatase, putative
1 4 12 4 RAFL05-13-M21 AV822972 Experimental RAFL05-13-M21 AV783852;AV822972;AF386934 unknown protein
1 4 12 5 RAFL05-14-F21 AV823014 Experimental RAFL05-14-F21 AV783902;AV823014 hypothetical protein
1 4 12 6 RAFL05-14-D08 AY042903 Experimental RAFL05-14-D08 AV783886;AV823000;AY042903 unknown protein
1 4 12 7 RAFL05-14-A21 AY054639 Experimental RAFL05-14-A21 AV783872;AV822987;AY054639 protein kinase-like protein
1 4 12 8 RAFL05-14-F09 AY128324 Experimental RAFL05-14-F09 AV783899;AV823011;AY128324 translation initiation factor eIF-2 beta chain - like protein
1 4 12 9 RAFL05-13-O17 AY054638 Experimental RAFL05-13-O17 AV783858;AV822976;AY054638 peroxiredoxin - like protein
1 4 12 10 RAFL05-14-F13 BT002380 Experimental RAFL05-14-F13 BT002380
1 4 12 11 RAFL05-14-F01 AV823007 Experimental RAFL05-14-F01 AV783895;AV823007;AF370539 unknown protein
1 4 12 12 RAFL05-13-O07 AY128323 Experimental RAFL05-13-O07 AV783855;AY128323 unknown protein
1 4 12 13 RAFL05-14-C15 AY065097 Experimental RAFL05-14-C15 AV783882;AV822997;AY065097
1 4 12 14 RAFL05-13-L23 AY092969 Experimental RAFL05-13-L23 AV783847;AV822967;AY092969 multicatalytic endopeptidase complex alpha subunit-like
1 4 13 1 RAFL05-17-I21 AY050331 Experimental RAFL05-17-I21 AV784230;AV823293;AY050331 unknown protein
1 4 13 2 RAFL05-17-B19 AY095988 Experimental RAFL05-17-B19 AV823252;AY095988
1 4 13 3 RAFL05-16-M07 BP560974 Experimental RAFL05-16-M07 AV784156;BP560974;AY125505 putative protein
1 4 13 4 RAFL05-16-I04 AV823196 Experimental RAFL05-16-I04 AV784127;AV823196 unknown protein
1 4 13 5 RAFL05-17-G13 BP560983 Experimental RAFL05-17-G13 BP560983;AY074570 unknown protein
1 4 13 6 RAFL05-17-B01 AY074566 Experimental RAFL05-17-B01 AV784181;AV823248;AY074566 unknown protein
1 4 13 7 RAFL05-18-B03 AV823333 Experimental RAFL05-18-B03 AV784282;AV823333 nucleotide pyrophosphatase - like protein
1 4 13 8 RAFL05-16-M10 AV823227 Experimental RAFL05-16-M10 AV784159;AV823227 unknown protein
1 4 13 9 RAFL05-17-P20 AY095996 Experimental RAFL05-17-P20 AV784274;AV823327;AY095996 splicing factor - like protein
1 4 13 10 RAFL05-17-M18 AY050357 Experimental RAFL05-17-M18 AV784256;AV823315;AY050357
1 4 13 11 RAFL05-17-D15 AY074569 Experimental RAFL05-17-D15 AV784194;AV823261;AY074569 lactoylglutathione lyase-like protein
1 4 13 12 RAFL05-17-O10 AY050341 Experimental RAFL05-17-O10 AV784263;AV823320;AY050341 unknown protein
1 4 13 13 RAFL05-16-P24 AY074564 Experimental RAFL05-16-P24 AV784174;AV823242;AY074564 DNAJ-like heatshock protein (At1g24120)
1 4 13 14 RAFL05-16-H17 BP560971 Experimental RAFL05-16-H17 AV784122;BP560971;AY050322 unknown protein
1 4 14 1 RAFL05-21-A10 AY045827 Experimental RAFL05-21-A10 AV784544;AV823550;AY045827 putative protein
1 4 14 2 RAFL05-20-L24 AV823529 Experimental RAFL05-20-L24 AV784515;AV823529 putative protein
1 4 14 3 RAFL05-20-P05 BP561037 Experimental RAFL05-20-P05 AV784535;BP561037;AY080724 phosphatidylinositol 3-kinase (AtVps34)
1 4 14 4 RAFL05-21-P20 AY063816 Experimental RAFL05-21-P20 AV784639;AV823635;AY063816 putative cis-Golgi SNARE protein
1 4 14 5 RAFL05-17-O23 AY095993 Experimental RAFL05-17-O23 AV784267;AV823324;AY095993 putative protein
1 4 14 6 RAFL05-17-N21 BP560992 Experimental RAFL05-17-N21 AV784260;BP560992;AY050355 transfactor like protein
1 4 14 7 RAFL05-17-H17 AV823290 Experimental RAFL05-17-H17 AV784227;AV823290 hypothetical protein
1 4 14 8 RAFL05-17-L09 AY050337 Experimental RAFL05-17-L09 AV784244;AV823304;AY050337 putative glycine-rich protein
1 4 14 9 RAFL05-17-L05 AY074565 Experimental RAFL05-17-L05 AV784242;AV823303;AY074565 uncharacterized protein
1 4 14 10 RAFL05-17-G01 AY050320 Experimental RAFL05-17-G01 AV784213;AV823279;AY050320 unknown protein
1 4 14 11 RAFL05-17-H07 BP560986 Experimental RAFL05-17-H07 AV784224;BP560986;AY095994 receptor kinase, putative
1 4 14 12 RAFL05-16-P22 AV823241 Experimental RAFL05-16-P22 AV784173;AV823241 unknown protein
1 4 14 13 RAFL05-16-L15 AY050349 Experimental RAFL05-16-L15 AV784151;AV823220;AY050349 heat shock protein 90
1 4 14 14 RAFL05-17-L23 AV823310 Experimental RAFL05-17-L23 AV784250;AV823310 threonine synthase
2 1 1 1 RAFL03-09-A18 BP560531 Experimental RAFL03-09-A18 BP560531;AY075684 unknown protein
2 1 1 2 RAFL03-08-G12 AV821327 Experimental RAFL03-08-G12 AV781722;AV821327;AF380627 unknown protein
2 1 1 3 RAFL03-06-E12 AY045698 Experimental RAFL03-06-E12 AV781646;AV821287;AY045698 beta-glucosidase
2 1 1 4 RAFL03-05-I09 AY039594 Experimental RAFL03-05-I09 AV781631;AV821276;AY039594 unknown protein
2 1 1 5 RAFL03-04-J10 AY075689 Experimental RAFL03-04-J10 AV781613;AV821260;AY075689 unknown protein
2 1 1 6 RAFL03-02-G06 AV781594 Experimental RAFL03-02-G06 AV781594;AF380645 unknown protein
2 1 1 7 RAFL03-02-F03 AY045682 Experimental RAFL03-02-F03 AV781593;AV821247;AY045682 alpha NAC-like protein, putative
2 1 1 8 RAFL03-05-E05 AY045676 Experimental RAFL03-05-E05 AV781622;AV821268;AY045676 WRKY DNA-binding protein 4 (WRKY4)
2 1 1 9 RAFL03-06-C11 AY045697 Experimental RAFL03-06-C11 AV781644;AY045697 unknown protein
2 1 1 10 RAFL03-05-A09 AY039595 Experimental RAFL03-05-A09 AV781617;AV821263;AY039595 protein phosphatase 2C like protein
2 1 1 11 RAFL03-05-O04 AY039588 Experimental RAFL03-05-O04 AV781638;AV821282;AY039588 initiation factor 5A-4, putative
2 1 1 12 RAFL03-03-I07 AY045684 Experimental RAFL03-03-I07 AV781604;AV821254;AY045684 unknown protein
2 1 1 13 RAFL03-02-F02 AV821246 Experimental RAFL03-02-F02 AV781592;AV821246;AF380638 phi-1-like protein
2 1 1 14 RAFL03-01-D08 AY039578 Experimental RAFL03-01-D08 AV781574;AV821233;AY039578 unknown protein
2 1 2 1 RAFL04-13-K15 AV821567 Experimental RAFL04-13-K15 AV821567;AF370263 GTP-binding protein, putative
2 1 2 2 RAFL04-13-A14 AV821527 Experimental RAFL04-13-A14 AV782018;AV821527;AF370241 unknown protein
2 1 2 3 RAFL04-13-D07 AY035169 Experimental RAFL04-13-D07 AV782034;AV821541;AY035169 unknown protein
2 1 2 4 RAFL04-13-N03 AY039919 Experimental RAFL04-13-N03 AV782083;AV821581;AY039919 putative protein
2 1 2 5 RAFL03-07-D12 AV821308 Experimental RAFL03-07-D12 AV781684;AV821308;AF380658 unknown protein
2 1 2 6 RAFL03-07-O21 AY039590 Experimental RAFL03-07-O21 AV781713;AV821322;AY039590 GSH-dependent dehydroascorbate reductase 1 like protein
2 1 2 7 RAFL03-09-J10 AY039585 Experimental RAFL03-09-J10 AV781754;AV821343;AY039585 DegP protease precursor, 5' partial
2 1 2 8 RAFL03-06-J14 AV821295 Experimental RAFL03-06-J14 AV781657;AV821295;AF380649 putative bHLH transcription factor (bHLH112)
2 1 2 9 RAFL03-07-A16 AY039581 Experimental RAFL03-07-A16 AV781675;AV821303;AY039581 arginine decarboxylase (spe2)
2 1 2 10 RAFL03-08-J20 AV781730 Experimental RAFL03-08-J20 AV781730;AF380629 unknown protein
2 1 2 11 RAFL03-06-N24 BP560509 Experimental RAFL03-06-N24 AV781672;BP560509;AY045696 unknown protein
2 1 2 12 RAFL03-08-P09 AY039591 Experimental RAFL03-08-P09 AV821339;AY039591 unknown protein
2 1 2 13 RAFL03-07-K11 AY045691 Experimental RAFL03-07-K11 AV781697;AV821315;AY045691 photosystem II stability/assembly factor HCF136 (sp|O82660)
2 1 2 14 RAFL03-08-O03 AY039583 Experimental RAFL03-08-O03 AV781739;AV821338;AY039583 elongation factor 1-alpha
2 1 3 1 RAFL04-14-G06 BP560606 Experimental RAFL04-14-G06 BP560606;AY035101 phosphoglyerate mutase like protein
2 1 3 2 RAFL04-15-K06 AY035001 Experimental RAFL04-15-K06 AV782250;AV821716;AY035001 putative SCARECROW transcriptional regulatory protein (F2O15.13)
2 1 3 3 RAFL04-15-E02 AV821684 Experimental RAFL04-15-E02 AV782210;AV821684
2 1 3 4 RAFL04-14-O19 AV821652 Experimental RAFL04-14-O19 AV782171;AV821652;AF370243
2 1 3 5 RAFL04-14-D24 BP560604 Experimental RAFL04-14-D24 AV782121;BP560604;AY035173 unknown protein
2 1 3 6 RAFL04-14-A06 AY035123 Experimental RAFL04-14-A06 AV782103;AV821599;AY035123 dnaK-type molecular chaperone hsc70.1
2 1 3 7 RAFL04-10-L08 AY063810 Experimental RAFL04-10-L08 AV781915;AV821458;AY063810 Phosphoglycerate dehydrogenase - like protein
2 1 3 8 RAFL04-14-D12 AV821612 Experimental RAFL04-14-D12 AV782120;AV821612;AF370275 putative protein
2 1 3 9 RAFL04-14-F04 AY034988 Experimental RAFL04-14-F04 AV782127;AV821617;AY034988 unknown protein
2 1 3 10 RAFL04-13-M22 AY034975 Experimental RAFL04-13-M22 AV782082;AV821580;AY034975 26S proteasome AAA-ATPase subunit RPT2a
2 1 3 11 RAFL04-13-A21 AY039927 Experimental RAFL04-13-A21 AV782021;AV821530;AY039927
2 1 3 12 RAFL04-13-I18 AV821558 Experimental RAFL04-13-I18 AV782055;AV821558;AF370212 unknown protein
2 1 3 13 RAFL04-12-P12 AY035099 Experimental RAFL04-12-P12 AV782006;AV821518;AY035099 unknown protein
2 1 3 14 RAFL04-12-G10 AV821487 Experimental RAFL04-12-G10 AV781961;AV821487 putative aspartate kinase
2 1 4 1 RAFL04-17-G24 AY054686 Experimental RAFL04-17-G24 AV782437;AV821869;AY054686 SNF1 related protein kinase (ATSRPK1)
2 1 4 2 RAFL04-17-E22 BP560655 Experimental RAFL04-17-E22 AV782419;BP560655;AY072307 NADP dependent malic enzyme - like protein
2 1 4 3 RAFL04-17-D22 AV821850 Experimental RAFL04-17-D22 AV782411;AV821850 unknown
2 1 4 4 RAFL04-17-H20 BP560661 Experimental RAFL04-17-H20 AV782448;BP560661;AF387000 unknown protein
2 1 4 5 RAFL04-17-C18 AY128329 Experimental RAFL04-17-C18 AV782399;AV821842;AY128329 putative protein
2 1 4 6 RAFL04-17-C14 AV821841 Experimental RAFL04-17-C14 AV782398;AV821841 putative reductase
2 1 4 7 RAFL04-19-C09 AV821974 Experimental RAFL04-19-C09 AV782568;AV821974
2 1 4 8 RAFL04-19-B05 AY072304 Experimental RAFL04-19-B05 AV782559;AV821966;AY072304 unknown protein (At1g26180)
2 1 4 9 RAFL04-15-G01 AY035102 Experimental RAFL04-15-G01 AV782229;AV821699;AY035102 nodulin-like protein
2 1 4 10 RAFL04-14-I15 AV821630 Experimental RAFL04-14-I15 AV782142;AV821630;AF370277 putative 40S ribosomal protein S19
2 1 4 11 RAFL04-14-H10 AV821623 Experimental RAFL04-14-H10 AV782134;AV821623 hypothetical protein
2 1 4 12 RAFL04-15-E20 AY091125 Experimental RAFL04-15-E20 AV782217;AV821690;AY091125 putative protein
2 1 4 13 RAFL04-15-B18 AY039928 Experimental RAFL04-15-B18 AV782193;AV821670;AY039928 unknown protein
2 1 4 14 RAFL04-15-A10 AY035126 Experimental RAFL04-15-A10 AV782181;AV821661;AY035126 unknown protein
2 1 5 1 RAFL04-18-P18 AY062627 Experimental RAFL04-18-P18 AV782550;AV821959;AY062627 mitochondrial F1-ATPase, gamma subunit (ATP3_ARATH)
2 1 5 2 RAFL04-20-D09 BT002392 Experimental RAFL04-20-D09 AV782657;BT002392 luminal binding protein (dbj|BAA13948.1)
2 1 5 3 RAFL04-20-D06 AV822035 Experimental RAFL04-20-D06 AV822035;AF370529 nucleoside-diphosphate kinase
2 1 5 4 RAFL04-20-B01 BP560688 Experimental RAFL04-20-B01 AV782643;BP560688;AY042879 Unknown protein
2 1 5 5 RAFL04-19-I03 BT002028 Experimental RAFL04-19-I03 AV782597;AV821993;BT002028 putative wound-induced basic protein
2 1 5 6 RAFL04-17-F02 AV821858 Experimental RAFL04-17-F02 AV782422;AV821858 putative fructose-bisphosphate aldolase, plastidic form
2 1 5 7 RAFL04-18-L18 AV821948 Experimental RAFL04-18-L18 AV782537;AV821948;AF387015 unknown protein
2 1 5 8 RAFL04-20-C09 AV822031 Experimental RAFL04-20-C09 AV782652;AV822031 unknown protein
2 1 5 9 RAFL04-20-B06 AV822025 Experimental RAFL04-20-B06 AV782645;AV822025;AF386971 unknown protein
2 1 5 10 RAFL04-19-P24 AV822019 Experimental RAFL04-19-P24 AV782637;AV822019;AF386969 RNA polymerase subunit (isoform B
2 1 5 11 RAFL04-19-H03 AY128331 Experimental RAFL04-19-H03 AV782589;AY128331 sigma factor SigC
2 1 5 12 RAFL04-19-E01 BT002021 Experimental RAFL04-19-E01 AV782575;AV821980;BT002021 hypothetical protein
2 1 5 13 RAFL04-20-B09 AV822027 Experimental RAFL04-20-B09 AV782647;AV822027 unknown protein
2 1 5 14 RAFL04-20-A06 AV822020 Experimental RAFL04-20-A06 AV782638;AV822020 putative ATPase
2 1 6 1 RAFL05-04-E13 AV822283 Experimental RAFL05-04-E13 AV783004;AV822283;AF462810
2 1 6 2 RAFL05-03-L16 AY037261 Experimental RAFL05-03-L16 AV782948;AV822245;AY037261 3-oxoacyl-[acyl-carrier-protein] synthase I precursor (beta-ketoacyl-acp synthase I) (KAS I) (sp|P52410)
2 1 6 3 RAFL05-03-J04 AY094429 Experimental RAFL05-03-J04 AV782937;AV822235;AY094429 unknown protein
2 1 6 4 RAFL05-04-H06 AY039880 Experimental RAFL05-04-H06 AV783017;AV822294;AY039880 unknown protein
2 1 6 5 RAFL05-05-J08 AY039867 Experimental RAFL05-05-J08 AV783109;AV822366;AY039867
2 1 6 6 RAFL05-04-A22 AY037247 Experimental RAFL05-04-A22 AV782979;AV822266;AY037247 unknown protein
2 1 6 7 RAFL05-02-O17 AY039906 Experimental RAFL05-02-O17 AV782888;AV822198;AY039906 lysine-ketoglutarate reductase/saccharopine dehydrogenase (LKR/SDH)
2 1 6 8 RAFL05-02-O09 AY039890 Experimental RAFL05-02-O09 AV782886;AV822196;AY039890
2 1 6 9 RAFL05-02-N02 BP560746 Experimental RAFL05-02-N02 AV782879;BP560746;AY037259 unknown protein
2 1 6 10 RAFL05-02-I23 AY039879 Experimental RAFL05-02-I23 AV782856;AV822177;AY039879 L-ascorbate peroxidase
2 1 6 11 RAFL05-02-D20 AY037255 Experimental RAFL05-02-D20 AV782834;AV822160;AY037255 glucosyltransferase like protein
2 1 6 12 RAFL05-02-M11 AY037248 Experimental RAFL05-02-M11 AV782876;AV822189;AY037248 14-3-3-like protein AFT1
2 1 6 13 RAFL04-19-L03 AV822004 Experimental RAFL04-19-L03 AV782616;AV822004 unknown protein
2 1 6 14 RAFL04-18-D22 AY059800 Experimental RAFL04-18-D22 AV782514;AV821928;AY059800 L-aspartate oxidase -like protein
2 1 7 1 RAFL05-09-F05 AV822602 Experimental RAFL05-09-F05 AV783407;AV822602;AF370325 coatomer-like protein, epsilon subunit
2 1 7 2 RAFL05-09-D16 AY034901 Experimental RAFL05-09-D16 AV783399;AV822594;AY034901 unknown protein
2 1 7 3 RAFL05-03-P09 AY039902 Experimental RAFL05-03-P09 AV782970;AV822258;AY039902 FKF1-like protein 2 (gb|AAF32300.1)
2 1 7 4 RAFL05-03-O06 AY037265 Experimental RAFL05-03-O06 AV782961;AV822252;AY037265 unknown protein
2 1 7 5 RAFL05-03-L01 AY039886 Experimental RAFL05-03-L01 AV782944;AV822242;AY039886 40S ribosomal protein S26 homolog
2 1 7 6 RAFL05-03-I04 AY039876 Experimental RAFL05-03-I04 AV782934;AV822232;AY039876 unknown protein
2 1 7 7 RAFL05-04-J06 AY039863 Experimental RAFL05-04-J06 AV822301;AY039863 phospholipid hydroperoxide glutathione peroxidase
2 1 7 8 RAFL05-05-G20 AY037243 Experimental RAFL05-05-G20 AV783099;AV822358;AY037243 unknown protein
2 1 7 9 RAFL05-04-H11 AY094432 Experimental RAFL05-04-H11 AV783019;AY094432 unknown protein
2 1 7 10 RAFL05-05-I08 AY037264 Experimental RAFL05-05-I08 AV783103;AV822361;AY037264
2 1 7 11 RAFL05-05-F21 AY123993 Experimental RAFL05-05-F21 AV783093;AV822352;AY123993
2 1 7 12 RAFL05-05-B16 AY039881 Experimental RAFL05-05-B16 AV783074;AV822338;AY039881 histidinol dehydrogenase
2 1 7 13 RAFL05-04-K07 AY037250 Experimental RAFL05-04-K07 AV783029;AV822306;AY037250 histone H3 like protein
2 1 7 14 RAFL05-03-F22 AY094431 Experimental RAFL05-03-F22 AV822221;AY094431 unknown protein
2 1 8 1 RAFL05-07-B02 AY035137 Experimental RAFL05-07-B02 AV783158;AV822404;AY035137 GTP binding protein, putative
2 1 8 2 RAFL05-07-A02 AY046032 Experimental RAFL05-07-A02 AV822394;AY046032 ribosomal protein S27
2 1 8 3 RAFL05-09-F14 AY034940 Experimental RAFL05-09-F14 AV783409;AV822604;AY034940 glucan endo-1,3-beta-glucosidase precursor, putative
2 1 8 4 RAFL05-09-D20 AY034904 Experimental RAFL05-09-D20 AV783400;AV822595;AY034904 unknown protein
2 1 8 5 RAFL05-07-D13 AY040020 Experimental RAFL05-07-D13 AV783175;AV822415;AY040020 protein phosphatase 2C, putative
2 1 8 6 RAFL05-07-C05 AY080752 Experimental RAFL05-07-C05 AV783166;AV822408;AY080752 unknown protein
2 1 8 7 RAFL05-07-A22 AY045913 Experimental RAFL05-07-A22 AV783157;AV822403;AY045913 putative cytosolic factor protein
2 1 8 8 RAFL05-05-P24 AY034962 Experimental RAFL05-05-P24 AV783146;AV822393;AY034962 unknown protein
2 1 8 9 RAFL05-05-O11 AY046016 Experimental RAFL05-05-O11 AV783139;AV822387;AY046016 unknown protein
2 1 8 10 RAFL05-08-A14 AY046025 Experimental RAFL05-08-A14 AV783279;AV822498;AY046025 disease resistance protein EDS1
2 1 8 11 RAFL05-08-H17 BP560832 Experimental RAFL05-08-H17 AV783328;BP560832;AF370173 unknown protein
2 1 8 12 RAFL05-07-D11 BP560811 Experimental RAFL05-07-D11 AV783174;BP560811;AF370150 putative HMG protein
2 1 8 13 RAFL05-07-C04 AY039971 Experimental RAFL05-07-C04 AV783165;AV822407;AY039971 unknown protein
2 1 8 14 RAFL05-08-D06 AY034959 Experimental RAFL05-08-D06 AV783296;AV822511;AY034959 putative No apical meristem (NAM) protein
2 1 9 1 RAFL05-12-I02 AY128313 Experimental RAFL05-12-I02 AV783722;AV822861;AY128313 homoserine kinase (HSK)
2 1 9 2 RAFL05-11-P23 BP560888 Experimental RAFL05-11-P23 AV783661;BP560888;AY042896 Unknown protein
2 1 9 3 RAFL05-13-B03 BT000432 Experimental RAFL05-13-B03 AV783781;AV822911;BT000432 putative protein
2 1 9 4 RAFL05-11-G18 AY081272 Experimental RAFL05-11-G18 AV783608;AV822773;AY081272 MAP kinase kinase 5
2 1 9 5 RAFL05-12-N20 AY042886 Experimental RAFL05-12-N20 AV783758;AV822891;AY042886 cinnamoyl-CoA reductase - like protein
2 1 9 6 RAFL05-12-F17 AY054615 Experimental RAFL05-12-F17 AV783704;AV822847;AY054615 unknown protein
2 1 9 7 RAFL05-08-J21 AV783338 Experimental RAFL05-08-J21 AV783338;AF370176 unknown protein
2 1 9 8 RAFL05-08-I06 AV822538 Experimental RAFL05-08-I06 AV783329;AV822538;AF370155 1-aminocyclopropane-1-carboxylate oxidase
2 1 9 9 RAFL05-08-G22 AY050856 Experimental RAFL05-08-G22 AV783322;AV822532;AY050856 unknown protein (At1g51610)
2 1 9 10 RAFL05-07-B03 AY046033 Experimental RAFL05-07-B03 AV783159;AY046033 RING zinc finger like protein
2 1 9 11 RAFL05-07-A03 AV822395 Experimental RAFL05-07-A03 AV783147;AV822395 hypothetical protein
2 1 9 12 RAFL05-05-O14 AY034906 Experimental RAFL05-05-O14 AV822389;AY034906 unknown protein
2 1 9 13 RAFL05-08-G19 AV822531 Experimental RAFL05-08-G19 AV783321;AV822531;AF370175 seven in absentia-like protein
2 1 9 14 RAFL05-07-C06 AY040009 Experimental RAFL05-07-C06 AV783167;AV822409;AY040009 unknown protein
2 1 10 1 RAFL05-12-C21 AY072320 Experimental RAFL05-12-C21 AV783681;AV822827;AY072320 putative protein
2 1 10 2 RAFL05-11-I11 AY059819 Experimental RAFL05-11-I11 AV783619;AV822782;AY059819 putative protein kinase
2 1 10 3 RAFL05-12-L02 AV822874 Experimental RAFL05-12-L02 AV783738;AV822874 unknown protein
2 1 10 4 RAFL05-13-B06 AY042865 Experimental RAFL05-13-B06 AV783784;AV822913;AY042865 putative trehalose-6-phosphate synthase
2 1 10 5 RAFL05-11-L18 AY072319 Experimental RAFL05-11-L18 AV783637;AV822794;AY072319 unknown protein
2 1 10 6 RAFL05-12-B21 AY120719 Experimental RAFL05-12-B21 AV783672;AV822819;AY120719 calmodulin-like protein
2 1 10 7 RAFL05-11-E11 AV822755 Experimental RAFL05-11-E11 AV783586;AV822755
2 1 10 8 RAFL05-11-F09 AY054623 Experimental RAFL05-11-F09 AV783593;AV822761;AY054623 putative elicitor-responsive gene
2 1 10 9 RAFL05-12-J02 BT000429 Experimental RAFL05-12-J02 AV783726;BT000429 putative protease SppA (SppA)
2 1 10 10 RAFL05-11-K24 AV822788 Experimental RAFL05-11-K24 AV783629;AV822788;AF370531 unknown protein
2 1 10 11 RAFL05-11-C22 AV822748 Experimental RAFL05-11-C22 AV822748;AF386943 lipase like protein
2 1 10 12 RAFL05-11-A20 BT000430 Experimental RAFL05-11-A20 AV783569;AV822741;BT000430 unknown protein
2 1 10 13 RAFL05-12-L22 AY042890 Experimental RAFL05-12-L22 AV783743;AV822879;AY042890 unknown protein
2 1 10 14 RAFL05-12-O20 AY065092 Experimental RAFL05-12-O20 AV783765;AV822898;AY065092 unknown protein
2 1 11 1 RAFL05-17-K01 AV823300 Experimental RAFL05-17-K01 AV823300 MAP kinase kinase 5
2 1 11 2 RAFL05-16-H20 AV823192 Experimental RAFL05-16-H20 AV784123;AV823192 hypothetical protein
2 1 11 3 RAFL05-16-O12 AY050385 Experimental RAFL05-16-O12 AV823235;AY050385 unknown protein
2 1 11 4 RAFL05-16-I09 AV823197 Experimental RAFL05-16-I09 AV784128;AV823197 sucrose-UDP glucosyltransferase
2 1 11 5 RAFL05-17-G24 BP560984 Experimental RAFL05-17-G24 AV784221;BP560984 carnitine racemase like protein
2 1 11 6 RAFL05-17-O21 AY050447 Experimental RAFL05-17-O21 AV784266;AV823323;AY050447 unknown protein
2 1 11 7 RAFL05-17-L19 AV823309 Experimental RAFL05-17-L19 AV784249;AV823309 ubiquitin-like protein SMT3-like
2 1 11 8 RAFL05-16-C24 AV823165 Experimental RAFL05-16-C24 AV784090;AV823165;AF462839 putative protein
2 1 11 9 RAFL05-16-A19 AY050437 Experimental RAFL05-16-A19 AV784080;AV823156;AY050437 putative PCI domain protein
2 1 11 10 RAFL05-16-D13 BP560962 Experimental RAFL05-16-D13 BP560962;AY050384 axi 1 protein-like protein
2 1 11 11 RAFL05-13-G12 AY081274 Experimental RAFL05-13-G12 AV783818;AV822940;AY081274 phosphoribosylanthranilate isomerase
2 1 11 12 RAFL05-13-I08 AV822950 Experimental RAFL05-13-I08 AV783830;AV822950 amino acid permease, putative, 5' partial
2 1 11 13 RAFL05-11-H22 AV822778 Experimental RAFL05-11-H22 AV783614;AV822778 defender against cell death protein, putative
2 1 11 14 RAFL05-11-E20 AV822758 Experimental RAFL05-11-E20 AV783589;AV822758 putative acyl-CoA synthetase
2 1 12 1 RAFL05-16-N06 AY050454 Experimental RAFL05-16-N06 AV784162;AV823229;AY050454
2 1 12 2 RAFL05-16-K03 AY050394 Experimental RAFL05-16-K03 AV784139;AV823207;AY050394 putative protein
2 1 12 3 RAFL05-17-P16 AY050392 Experimental RAFL05-17-P16 AV784272;AV823326;AY050392 unknown protein
2 1 12 4 RAFL05-18-B13 AV823335 Experimental RAFL05-18-B13 AV784284;AV823335;AF462837 putative protein
2 1 12 5 RAFL05-17-D02 AY091770 Experimental RAFL05-17-D02 AV784190;AV823257;AY091770 unknown protein
2 1 12 6 RAFL05-16-I21 AY050434 Experimental RAFL05-16-I21 AV784131;AV823200;AY050434 methylenetetrahydrofolate reductase (MTHFR2)
2 1 12 7 RAFL05-16-P20 AY050452 Experimental RAFL05-16-P20 AV784172;AV823240;AY050452 histone H1 like protein
2 1 12 8 RAFL05-17-L24 AV823311 Experimental RAFL05-17-L24 AV784251;AV823311;AF462842 hypothetical protein
2 1 12 9 RAFL05-16-J06 AY050442 Experimental RAFL05-16-J06 AV784134;AV823202;AY050442 CAO chloroplast signal recognition particle chromo protein
2 1 12 10 RAFL05-16-H03 AY074851 Experimental RAFL05-16-H03 AV784115;AV823188;AY074851 probable cytochrome P450
2 1 12 11 RAFL05-17-L16 AV823307 Experimental RAFL05-17-L16 AV784247;AV823307 unknown protein
2 1 12 12 RAFL05-18-B20 BP561000 Experimental RAFL05-18-B20 AV784287;BP561000;AY074844 serine/threonine kinase like protein
2 1 12 13 RAFL05-17-G12 AV823282 Experimental RAFL05-17-G12 AV784216;AV823282;AF462843 putative RING zinc finger protein
2 1 12 14 RAFL05-17-C10 AY074856 Experimental RAFL05-17-C10 AV823253;AY074856 unknown protein
2 1 13 1 RAFL05-21-P21 AY063817 Experimental RAFL05-21-P21 AV784640;AV823636;AY063817 putative protein
2 1 13 2 RAFL05-21-B19 AY046053 Experimental RAFL05-21-B19 AV784554;AV823559;AY046053 unknown protein
2 1 13 3 RAFL05-21-D08 AY080874 Experimental RAFL05-21-D08 AV784562;AV823566;AY080874 putative chloroplast nucleoid DNA-binding protein
2 1 13 4 RAFL05-21-A05 AY045832 Experimental RAFL05-21-A05 AV784541;AV823547;AY045832 unknown protein (F14J22.6)
2 1 13 5 RAFL05-20-N12 AY059727 Experimental RAFL05-20-N12 AV784523;AV823534;AY059727 ABC transporter -like protein
2 1 13 6 RAFL05-20-N02 AY045794 Experimental RAFL05-20-N02 AV784521;AV823532;AY045794 salt-tolerance protein
2 1 13 7 RAFL05-21-P18 AY050785 Experimental RAFL05-21-P18 AV784638;AV823634;AY050785 unknown protein
2 1 13 8 RAFL05-21-O12 AY096640 Experimental RAFL05-21-O12 AV784628;AV823625;AY096640
2 1 13 9 RAFL05-21-O04 AV823623 Experimental RAFL05-21-O04 AV784626;AV823623 putative aminotransferase
2 1 13 10 RAFL05-21-D01 AY045850 Experimental RAFL05-21-D01 AV784560;AV823564;AY045850 putative protein
2 1 13 11 RAFL05-20-P15 AY045825 Experimental RAFL05-20-P15 AV784538;AV823544;AY045825 cytosolic O-acetylserine(thiol)lyase (EC 4.2.99.8)
2 1 13 12 RAFL05-19-F07 AY045999 Experimental RAFL05-19-F07 AV784416;AV823448;AY045999 unknown protein
2 1 13 13 RAFL05-19-P24 AY045962 Experimental RAFL05-19-P24 AV784499;AV823515;AY045962 putative proline-rich cell wall protein (pir|IS52985); similar to ESTs gb|AI239404, gb|R89984, and emb|Z17709
2 1 13 14 RAFL05-19-M21 AY046050 Experimental RAFL05-19-M21 AV784475;AV823497;AY046050 putative dnaJ protein
2 1 14 1 RAFL06-09-G08 AY062789 Experimental RAFL06-09-G08 AV784908;AV823843;AY062789 outer membrane lipoprotein - like
2 1 14 2 RAFL06-07-N01 AY065122 Experimental RAFL06-07-N01 AV784733;AV823710;AY065122 glycolate oxidase like protein
2 1 14 3 RAFL06-07-L04 BT002422 Experimental RAFL06-07-L04 AV784722;AV823702;BT002422 hypothetical protein
2 1 14 4 RAFL06-08-P18 AY059924 Experimental RAFL06-08-P18 AV784865;AV823809;AY059924 arabinogalactan-protein AGP12
2 1 14 5 RAFL05-21-P13 AY074346 Experimental RAFL05-21-P13 AV784634;AV823630;AY074346 phosphoenolpyruvate carboxylase like protein
2 1 14 6 RAFL05-21-L05 AY080777 Experimental RAFL05-21-L05 AV784609;AV823604;AY080777 unknown protein (At1g60170)
2 1 14 7 RAFL05-20-N19 AY056223 Experimental RAFL05-20-N19 AV784527;AV823538;AY056223 putative protein
2 1 14 8 RAFL05-21-P23 AY045798 Experimental RAFL05-21-P23 AV784642;AV823638;AY045798 putative protein
2 1 14 9 RAFL05-21-N20 AY045968 Experimental RAFL05-21-N20 AV823620;AY045968 ethylene responsive element binding factor - like
2 1 14 10 RAFL05-21-G15 AY045944 Experimental RAFL05-21-G15 AV784581;AV823585;AY045944 cytochrome c
2 1 14 11 RAFL05-21-L13 AY096495 Experimental RAFL05-21-L13 AV823607;AY096495 predicted GPI-anchored protein
2 1 14 12 RAFL05-21-O08 AY045855 Experimental RAFL05-21-O08 AV784627;AV823624;AY045855 ribulose-5-phosphate-3-epimerase
2 1 14 13 RAFL05-21-D05 AY080770 Experimental RAFL05-21-D05 AV784561;AV823565;AY080770 putative protein
2 1 14 14 RAFL05-20-N17 AY050961 Experimental RAFL05-20-N17 AV784525;AV823536;AY050961 CCA1
2 2 1 1 RAFL02-04-G10 AV821124 Experimental RAFL02-04-G10 AV781382;AV821124;AF375402 unknown protein
2 2 1 2 RAFL02-10-P17 AV821228 Experimental RAFL02-10-P17 AV781568;AV821228;AF375396 unknown protein
2 2 1 3 RAFL02-10-D21 AY039568 Experimental RAFL02-10-D21 AV781533;AV821207;AY039568 unknown protein
2 2 1 4 RAFL02-03-F05 AV821116 Experimental RAFL02-03-F05 AV781372;AV821116;AF375417 unknown protein
2 2 1 5 RAFL02-10-F01 AV821210 Experimental RAFL02-10-F01 AV781537;AV821210;AF361857 unknown protein
2 2 1 6 RAFL02-06-C18 AV781414 Experimental RAFL02-06-C18 AV781414;AF361852 unknown protein
2 2 1 7 RAFL02-01-E05 AV821093 Experimental RAFL02-01-E05 AV781343;AV821093;AF375407 unknown protein
2 2 1 8 RAFL02-10-M19 AV821226 Experimental RAFL02-10-M19 AV781564;AV821226;AF361842 putative molybdopterin synthase large subunit
2 2 1 9 RAFL02-06-F22 AY039572 Experimental RAFL02-06-F22 AV781421;AV821147;AY039572 unknown protein
2 2 1 10 RAFL02-01-K08 AY075700 Experimental RAFL02-01-K08 AV781349;AV821099;AY075700 DegP2 protease (DEGP2)
2 2 1 11 RAFL02-10-G13 AY061753 Experimental RAFL02-10-G13 AV781544;AV821214;AY061753 unknown protein
2 2 1 12 RAFL02-06-A16 AV821141 Experimental RAFL02-06-A16 AV821141;AF375410 unknown protein
2 2 1 13 RAFL02-02-E01 AV821106 Experimental RAFL02-02-E01 AV821106;AF375403
2 2 1 14 RAFL02-01-C01 AY039556 Experimental RAFL02-01-C01 AV781340;AV821090;AY039556
2 2 2 1 RAFL04-10-C17 AV781874 Experimental RAFL04-10-C17 AV781874;AF370262 transport protein SEC13, putative
2 2 2 2 RAFL04-10-E06 AY035185 Experimental RAFL04-10-E06 AV781884;AV821436;AY035185 unknown protein
2 2 2 3 RAFL04-10-B17 AV821425 Experimental RAFL04-10-B17 AV781868;AV821425 putative protein
2 2 2 4 RAFL04-10-D06 BP560572 Experimental RAFL04-10-D06 AV781877;BP560572;AY035119 unknown protein
2 2 2 5 RAFL02-03-G08 AY039570 Experimental RAFL02-03-G08 AV821117;AY039570 ribosomal protein L11, cytosolic
2 2 2 6 RAFL02-10-H06 AY039567 Experimental RAFL02-10-H06 AV781547;AV821216;AY039567 glutathione-s-transferase, putative
2 2 2 7 RAFL02-02-A09 BP560424 Experimental RAFL02-02-A09 AV781352;BP560424;AY070462 unknown protein
2 2 2 8 RAFL02-02-B05 AY039564 Experimental RAFL02-02-B05 AV781353;AV821101;AY039564 unknown protein
2 2 2 9 RAFL02-01-G08 AV821095 Experimental RAFL02-01-G08 AV781345;AV821095;AF329500 ketol-acid reductoisomerase
2 2 2 10 RAFL02-05-J03 AV781405 Experimental RAFL02-05-J03 AV781405;AF361844 b-keto acyl reductase (glossy8)
2 2 2 11 RAFL02-05-I02 AY039576 Experimental RAFL02-05-I02 AV781402;AV821134;AY039576 putative RNA helicase (MMI9.2)
2 2 2 12 RAFL02-10-N23 AY039566 Experimental RAFL02-10-N23 AV781567;AV821227;AY039566 ubiquitin-conjugating enzyme E2-17 kD 10 (ubiquitin-protein ligase 10) (ubiquitin carrier protein 10) (sp|P35133)
2 2 2 13 RAFL02-10-L11 AV821223 Experimental RAFL02-10-L11 AV781561;AV821223;AF361858 Lhcb3 chlorophyll a/b binding protein (gb|AAD28773.1)
2 2 2 14 RAFL02-02-L02 AV821110 Experimental RAFL02-02-L02 AV781364;AV821110;AF375413 ubiquinol--cytochrome-c reductase - like protein
2 2 3 1 RAFL04-12-C06 AY091131 Experimental RAFL04-12-C06 AV781941;AV821478;AY091131 hypothetical protein
2 2 3 2 RAFL04-12-M04 AY091140 Experimental RAFL04-12-M04 AV781989;AV821506;AY091140 FRO2-like protein; NADPH oxidase-like
2 2 3 3 RAFL04-13-J08 AY034991 Experimental RAFL04-13-J08 AV782060;AV821562;AY034991 unknown protein
2 2 3 4 RAFL04-13-C03 AY034977 Experimental RAFL04-13-C03 AV782025;AV821532;AY034977 unknown protein
2 2 3 5 RAFL04-10-P05 AY035172 Experimental RAFL04-10-P05 AV781931;AV821470;AY035172 putative ribosomal protein S10
2 2 3 6 RAFL04-14-D18 AV821613 Experimental RAFL04-14-D18 AV821613
2 2 3 7 RAFL04-10-L09 AV821459 Experimental RAFL04-10-L09 AV781916;AV821459 nucleoid DNA-binding-like protein
2 2 3 8 RAFL04-12-N22 AV782000 Experimental RAFL04-12-N22 AV782000 unknown protein
2 2 3 9 RAFL04-12-M20 AV821509 Experimental RAFL04-12-M20 AV781995;AV821509;AF370266
2 2 3 10 RAFL04-12-N16 AY056189 Experimental RAFL04-12-N16 AV781999;AV821513;AY056189 uracil phosphoribosyltransferase-like protein
2 2 3 11 RAFL04-13-O18 AV821592 Experimental RAFL04-13-O18 AV782096;AV821592;AF370222 unknown protein
2 2 3 12 RAFL04-12-I04 AY035121 Experimental RAFL04-12-I04 AV781973;AV821496;AY035121 polygalacturonase inhibiting protein
2 2 3 13 RAFL04-10-C13 AY035098 Experimental RAFL04-10-C13 AV781872;AV821428;AY035098
2 2 3 14 RAFL04-10-C01 AV821427 Experimental RAFL04-10-C01 AV781870;AV821427;AF370274 glutathione transferase-like protein
2 2 4 1 RAFL04-16-M02 AY072303 Experimental RAFL04-16-M02 AV782366;AV821814;AY072303 putative cytochrome P450
2 2 4 2 RAFL04-16-C24 BP560634 Experimental RAFL04-16-C24 AV782310;BP560634;AY059799 WD-40 repeat protein MSI4 (MSI4)
2 2 4 3 RAFL04-16-L09 AV782361 Experimental RAFL04-16-L09 AV782361 SOUL-like protein
2 2 4 4 RAFL04-15-M02 AV821730 Experimental RAFL04-15-M02 AV782267;AV821730
2 2 4 5 RAFL04-16-J04 BT002013 Experimental RAFL04-16-J04 AV782342;AV821796;BT002013 spliceosome associated protein - like
2 2 4 6 RAFL04-15-O16 AV821746 Experimental RAFL04-15-O16 AV782284;AV821746 14-3-3 protein homolog RCI1 (pir||S47969)
2 2 4 7 RAFL04-15-N11 AV821740 Experimental RAFL04-15-N11 AV782276;AV821740;AF386953 20S proteasome subunit PAC1
2 2 4 8 RAFL04-16-B13 AY054679 Experimental RAFL04-16-B13 AV821763;AY054679 acyl-(acyl carrier protein) thioesterase, putative
2 2 4 9 RAFL04-12-D15 AY046005 Experimental RAFL04-12-D15 AV781947;AY046005 putative protein
2 2 4 10 RAFL04-12-O11 AY046004 Experimental RAFL04-12-O11 AV782002;AV821515;AY046004 carbamoyl phosphate synthetase small subunit (carA)
2 2 4 11 RAFL04-12-A09 AY034993 Experimental RAFL04-12-A09 AV781933;AV821471;AY034993 unknown protein
2 2 4 12 RAFL04-12-F06 BP560582 Experimental RAFL04-12-F06 AV781954;BP560582
2 2 4 13 RAFL04-12-O04 AY035174 Experimental RAFL04-12-O04 AV782001;AV821514;AY035174 unknown protein
2 2 4 14 RAFL04-13-D06 AY039921 Experimental RAFL04-13-D06 AV782033;AV821540;AY039921 dihydroxyacid dehydratase like protein
2 2 5 1 RAFL04-17-A15 AY128327 Experimental RAFL04-17-A15 AV782387;AV821833;AY128327 unknown protein
2 2 5 2 RAFL04-16-P21 AY065192 Experimental RAFL04-16-P21 AV782382;AV821828;AY065192 cytochrome P450 - like protein
2 2 5 3 RAFL04-16-J17 BT002035 Experimental RAFL04-16-J17 AV782349;AV821803;BT002035 putative small nuclear ribonucleoprotein E
2 2 5 4 RAFL04-16-F14 AY042875 Experimental RAFL04-16-F14 AV782320;AV821779;AY042875 unknown protein
2 2 5 5 RAFL04-16-I17 BP560640 Experimental RAFL04-16-I17 AV782338;BP560640;AF387012 nucleoside triphosphatase like protein
2 2 5 6 RAFL04-16-C12 BT002024 Experimental RAFL04-16-C12 AV782306;AV821767;BT002024 symbiosis-related like protein
2 2 5 7 RAFL04-16-B07 AV821762 Experimental RAFL04-16-B07 AV782303;AV821762 geranylgeranyl reductase
2 2 5 8 RAFL04-16-D03 BP560635 Experimental RAFL04-16-D03 AV782311;BP560635;AY065080 putative protein
2 2 5 9 RAFL04-15-P20 AV782294 Experimental RAFL04-15-P20 AV782294;AF387010 unknown protein
2 2 5 10 RAFL04-15-P18 AV821754 Experimental RAFL04-15-P18 AV782293;AV821754;AF386967 thioglucosidase 3D precursor
2 2 5 11 RAFL04-15-L13 AV821726 Experimental RAFL04-15-L13 AV782262;AV821726;AF387002 unknown protein
2 2 5 12 RAFL04-16-G15 AV821786 Experimental RAFL04-16-G15 AV782326;AV821786 putative protein
2 2 5 13 RAFL04-16-L11 BP560646 Experimental RAFL04-16-L11 AV782362;BP560646 glycyl-tRNA synthetase
2 2 5 14 RAFL04-16-P06 AY042827 Experimental RAFL04-16-P06 AV782381;AV821827;AY042827 unknown protein
2 2 6 1 RAFL04-20-H11 AY039555 Experimental RAFL04-20-H11 AV782680;AV822053;AY039555 asparaginase
2 2 6 2 RAFL04-20-N01 AY124004 Experimental RAFL04-20-N01 AV782721;AV822084;AY124004 putative ribosomal protein L6
2 2 6 3 RAFL04-20-J21 AY039549 Experimental RAFL04-20-J21 AV782702;AV822069;AY039549 plastid-specific ribosomal protein 6 precursor (Psrp-6) - like
2 2 6 4 RAFL04-20-K08 AY094416 Experimental RAFL04-20-K08 AV782706;AV822072;AY094416 unknown protein
2 2 6 5 RAFL04-20-G24 AY065050 Experimental RAFL04-20-G24 AV782679;AV822051;AY065050 unknown protein
2 2 6 6 RAFL04-20-H14 AY039546 Experimental RAFL04-20-H14 AV782682;AV822055;AY039546 GTPase activator protein of Rab-like small GTPases-like protein
2 2 6 7 RAFL04-20-I07 AY124006 Experimental RAFL04-20-I07 AV782689;AV822059;AY124006 hypothetical protein
2 2 6 8 RAFL04-20-P22 AY039551 Experimental RAFL04-20-P22 AV782744;AV822099;AY039551 unknown protein
2 2 6 9 RAFL04-20-J16 AY065054 Experimental RAFL04-20-J16 AV782699;AV822067;AY065054 glucose-6-phosphate 1-dehydrogenase, putative
2 2 6 10 RAFL04-20-P06 AV782737 Experimental RAFL04-20-P06 AV782737;AF389287 putative AVR9 elicitor response protein
2 2 6 11 RAFL04-20-F03 AY079020 Experimental RAFL04-20-F03 AV782668;AV822044;AY079020 ribosomal protein L5 - like
2 2 6 12 RAFL04-20-D23 AY065045 Experimental RAFL04-20-D23 AV782661;AV822038;AY065045 unknown protein
2 2 6 13 RAFL04-15-O05 BP560630 Experimental RAFL04-15-O05 AV782280;BP560630 Nonclathrin coat protein gamma - like protein
2 2 6 14 RAFL04-16-J05 AV821797 Experimental RAFL04-16-J05 AV782343;AV821797;AF370545 alpha NAC-like protein
2 2 7 1 RAFL05-10-D12 AV822673 Experimental RAFL05-10-D12 AV783491;AV822673;AF370324 farnesyl diphosphate synthase precursor (gb|AAB49290.1)
2 2 7 2 RAFL05-10-D02 AV822669 Experimental RAFL05-10-D02 AV783486;AV822669;AF370298 unknown protein
2 2 7 3 RAFL05-01-C20 BP560712 Experimental RAFL05-01-C20 AV782761;BP560712;AF389297 putative major latex protein
2 2 7 4 RAFL05-01-N11 AY049296 Experimental RAFL05-01-N11 AV782810;AV822145;AY049296 putative nonspecific lipid-transfer protein
2 2 7 5 RAFL05-01-K06 AV822135 Experimental RAFL05-01-K06 AV782796;AV822135;AF389295 omega-3 fatty acid desaturase, chloroplast precursor
2 2 7 6 RAFL05-01-P13 AV822150 Experimental RAFL05-01-P13 AV782819;AV822150;AF389290 putative photosystem I reaction center subunit II precursor
2 2 7 7 RAFL05-01-P03 AV782818 Experimental RAFL05-01-P03 AV782818;AF389285
2 2 7 8 RAFL05-01-H15 AY065047 Experimental RAFL05-01-H15 AV822125;AY065047 putative protein
2 2 7 9 RAFL04-20-P11 AY079027 Experimental RAFL04-20-P11 AV782740;AY079027 putative protein
2 2 7 10 RAFL04-20-M06 AY049301 Experimental RAFL04-20-M06 AV782717;AV822081;AY049301 unknown protein
2 2 7 11 RAFL04-20-G22 AV782677 Experimental RAFL04-20-G22 AV782677;AF389294 BolA like protein
2 2 7 12 RAFL04-20-I15 AY125501 Experimental RAFL04-20-I15 AV782691;AV822061;AY125501 putative proline-rich protein
2 2 7 13 RAFL04-20-O08 AV822089 Experimental RAFL04-20-O08 AV782732;AV822089;AF389279 unknown protein
2 2 7 14 RAFL04-20-P21 AY065046 Experimental RAFL04-20-P21 AV782743;AV822098;AY065046 lipase/hydrolase, putative
2 2 8 1 RAFL05-07-D18 BP560812 Experimental RAFL05-07-D18 AV783178;BP560812;AF370354 von Hippel-Lindau binding protein (VHL binding protein; VBP) like
2 2 8 2 RAFL05-08-E17 AY046031 Experimental RAFL05-08-E17 AV783308;AV822522;AY046031 Ruv DNA-helicase-like protein
2 2 8 3 RAFL05-07-A06 AY034939 Experimental RAFL05-07-A06 AV783149;AY034939 putative dihydrokaempferol 4-reductase
2 2 8 4 RAFL05-05-N13 BP560804 Experimental RAFL05-05-N13 AV783132;BP560804;AY045928
2 2 8 5 RAFL05-05-M08 AV822376 Experimental RAFL05-05-M08 AV783123;AV822376;AF370174 putative protein
2 2 8 6 RAFL05-05-M05 AV822375 Experimental RAFL05-05-M05 AV783122;AV822375;AF370152 putative AP2 domain containing protein (At1g78080)
2 2 8 7 RAFL05-10-F13 AV783504 Experimental RAFL05-10-F13 AV783504
2 2 8 8 RAFL05-10-E01 AY034961 Experimental RAFL05-10-E01 AV783495;AV822677;AY034961 putative type II CPD photolyase
2 2 8 9 RAFL05-10-E07 AV822679 Experimental RAFL05-10-E07 AV783497;AV822679
2 2 8 10 RAFL05-10-D21 AY034903 Experimental RAFL05-10-D21 AV783494;AV822676;AY034903 unknown protein
2 2 8 11 RAFL05-10-H08 AY040018 Experimental RAFL05-10-H08 AV783510;AV822692;AY040018 unknown protein
2 2 8 12 RAFL05-10-D20 AV822675 Experimental RAFL05-10-D20 AV783493;AV822675 cysteine synthase
2 2 8 13 RAFL05-10-H05 AV822691 Experimental RAFL05-10-H05 AV822691;AF337911 unknown protein
2 2 8 14 RAFL05-10-H23 AV822694 Experimental RAFL05-10-H23 AV822694;AF337912 unknown protein
2 2 9 1 RAFL05-10-N03 AV822722 Experimental RAFL05-10-N03 AV783544;AV822722 unknown protein
2 2 9 2 RAFL05-10-L23 BP560862 Experimental RAFL05-10-L23 AV783540;BP560862;AF327430 transport inhibitor response 1 (TIR1)
2 2 9 3 RAFL05-10-N12 AY042854 Experimental RAFL05-10-N12 AV783547;AY042854 TOPP8 serine/threonine protein phosphatase type one
2 2 9 4 RAFL05-10-L03 BT002005 Experimental RAFL05-10-L03 AV783532;BP560860;BT002005 glutaredoxin
2 2 9 5 RAFL05-10-L12 AY072313 Experimental RAFL05-10-L12 AV783536;AV822716;AY072313 putative protein
2 2 9 6 RAFL05-10-N19 AY054645 Experimental RAFL05-10-N19 AV783550;AV822727;AY054645 bZIP transcription factor-like protein
2 2 9 7 RAFL05-07-M09 AY045936 Experimental RAFL05-07-M09 AV783245;AV822469;AY045936 oligopeptidase A
2 2 9 8 RAFL05-08-O10 AY035025 Experimental RAFL05-08-O10 AV783363;AV822563;AY035025 unknown protein
2 2 9 9 RAFL05-08-K07 AY056194 Experimental RAFL05-08-K07 AV783341;AV822544;AY056194 putative L5 ribosomal protein
2 2 9 10 RAFL05-08-I12 AY034966 Experimental RAFL05-08-I12 AV783332;AY034966
2 2 9 11 RAFL05-08-H08 AY046027 Experimental RAFL05-08-H08 AV783324;AV822534;AY046027 fibrillarin - like protein
2 2 9 12 RAFL05-07-B11 AY063812 Experimental RAFL05-07-B11 AV783161;AV822406;AY063812
2 2 9 13 RAFL05-08-L19 AY040022 Experimental RAFL05-08-L19 AV783347;AV822550;AY040022 unknown protein
2 2 9 14 RAFL05-08-I08 AY045921 Experimental RAFL05-08-I08 AV783331;AV822539;AY045921
2 2 10 1 RAFL05-13-K13 AY059817 Experimental RAFL05-13-K13 AV783840;AV822960;AY059817 putative serine/threonine protein kinase
2 2 10 2 RAFL05-13-H09 AV822946 Experimental RAFL05-13-H09 AV783825;AV822946;AF386931
2 2 10 3 RAFL05-12-B14 BP560891 Experimental RAFL05-12-B14 AV783670;BP560891;AF386939 unknown protein
2 2 10 4 RAFL05-13-H21 AY054614 Experimental RAFL05-13-H21 AV783828;AV822949;AY054614 Unknown protein (At5g22950; MRN17.18)
2 2 10 5 RAFL05-12-D08 AV822833 Experimental RAFL05-12-D08 AV783687;AV822833
2 2 10 6 RAFL05-12-F05 AV822844 Experimental RAFL05-12-F05 AV783700;AV822844;AF386940 putative protein
2 2 10 7 RAFL05-13-G09 BP560916 Experimental RAFL05-13-G09 BP560916 ribosomal protein L9, putative
2 2 10 8 RAFL05-13-G06 AY072315 Experimental RAFL05-13-G06 AV783816;AV822939;AY072315 unknown protein
2 2 10 9 RAFL05-10-P04 AY042900 Experimental RAFL05-10-P04 AV783558;AY042900 unknown protein
2 2 10 10 RAFL05-10-K21 AV822711 Experimental RAFL05-10-K21 AV783530;AV822711;AF386944 protoporphyrinogen oxidase
2 2 10 11 RAFL05-10-J09 AV822701 Experimental RAFL05-10-J09 AV783521;AV822701
2 2 10 12 RAFL05-10-H24 AY042850 Experimental RAFL05-10-H24 AV783514;AV822695;AY042850 transcriptional coactivator - like protein
2 2 10 13 RAFL05-10-O23 AY120706 Experimental RAFL05-10-O23 AV783557;AV822733;AY120706 unknown protein
2 2 10 14 RAFL05-10-M08 BP560863 Experimental RAFL05-10-M08 AV783541;BP560863;AY042888 unknown protein
2 2 11 1 RAFL05-14-K24 AY048224 Experimental RAFL05-14-K24 AV783945;AV823047;AY048224 putative protein
2 2 11 2 RAFL05-16-C11 BP560960 Experimental RAFL05-16-C11 AV784087;BP560960;AY074580 unknown protein
2 2 11 3 RAFL05-16-F03 AY070480 Experimental RAFL05-16-F03 AV784105;AV823176;AY070480 putative protein
2 2 11 4 RAFL05-14-L07 AV823050 Experimental RAFL05-14-L07 AV783947;AV823050 ABC transporter homolog PnATH - like
2 2 11 5 RAFL05-14-O08 AY048235 Experimental RAFL05-14-O08 AV783968;AV823064;AY048235 thioredoxin
2 2 11 6 RAFL05-14-K07 AV823042 Experimental RAFL05-14-K07 AV783938;AV823042 unknown protein
2 2 11 7 RAFL05-15-D12 AV823092 Experimental RAFL05-15-D12 AV784004;AV823092
2 2 11 8 RAFL05-14-I02 BP560932 Experimental RAFL05-14-I02 AV783921;BP560932;AY048222 unknown protein
2 2 11 9 RAFL05-16-C19 AY070483 Experimental RAFL05-16-C19 AV784089;AV823164;AY070483 putative protein
2 2 11 10 RAFL05-16-A08 AY048215 Experimental RAFL05-16-A08 AV784077;AV823153;AY048215 cytosolic cyclophilin (ROC3)
2 2 11 11 RAFL05-12-E14 AV822838 Experimental RAFL05-12-E14 AV783693;AV822838;AF386989 similar to late embryogenesis abundant proteins
2 2 11 12 RAFL05-12-M12 AV822884 Experimental RAFL05-12-M12 AV783749;AV822884 unknown protein
2 2 11 13 RAFL05-12-H09 AY054650 Experimental RAFL05-12-H09 AV783718;AV822857;AY054650 G protein-coupled receptor-like protein
2 2 11 14 RAFL05-12-F08 AY054649 Experimental RAFL05-12-F08 AV783701;AV822845;AY054649 unknown protein
2 2 12 1 RAFL05-15-C04 AV823078 Experimental RAFL05-15-C04 AV783988;AV823078 cytochrome P450-like protein
2 2 12 2 RAFL05-14-P22 AY048230 Experimental RAFL05-14-P22 AV783977;AV823072;AY048230 unknown protein
2 2 12 3 RAFL05-16-D09 AY074584 Experimental RAFL05-16-D09 AV784091;AV823166;AY074584 unknown protein
2 2 12 4 RAFL05-16-G04 AV823182 Experimental RAFL05-16-G04 AV784110;AV823182 putative glucosyltransferase
2 2 12 5 RAFL05-14-K15 AY125499 Experimental RAFL05-14-K15 AV783941;AV823043;AY125499 putative C-4 sterol methyl oxidase
2 2 12 6 RAFL05-15-B20 AY048212 Experimental RAFL05-15-B20 AV783986;AV823077;AY048212 hypothetical protein
2 2 12 7 RAFL05-14-J15 AY048238 Experimental RAFL05-14-J15 AV783933;AV823036;AY048238 oligopeptidase-like protein
2 2 12 8 RAFL05-15-L19 AY090258 Experimental RAFL05-15-L19 AV784048;AV823127;AY090258 AtMRP1
2 2 12 9 RAFL05-15-P17 AY048225 Experimental RAFL05-15-P17 AV784074;AV823151;AY048225 unknown protein
2 2 12 10 RAFL05-14-N07 BP560941 Experimental RAFL05-14-N07 AV783963;BP560941;AY090253 translation releasing factor RF-1 -like protein
2 2 12 11 RAFL05-14-N04 AV783961 Experimental RAFL05-14-N04 AV783961
2 2 12 12 RAFL05-14-L02 AY048210 Experimental RAFL05-14-L02 AV783946;AV823048;AY048210 ubiquitin-protein ligase like protein
2 2 12 13 RAFL05-14-M10 BP560939 Experimental RAFL05-14-M10 AV783956;BP560939;AY048236 AT5g14180/MUA22_18
2 2 12 14 RAFL05-15-C16 AY048229 Experimental RAFL05-15-C16 AV783994;AV823084;AY048229 unknown protein
2 2 13 1 RAFL05-18-O04 AV823413 Experimental RAFL05-18-O04 AV784373;AV823413 putative tyrosine phosphatase
2 2 13 2 RAFL05-19-B13 AY096641 Experimental RAFL05-19-B13 AV784392;AV823430;AY096641 putative protein
2 2 13 3 RAFL05-18-H11 AY080873 Experimental RAFL05-18-H11 AV784320;AV823368;AY080873 ribosomal protein S21 - like
2 2 13 4 RAFL05-18-I06 AY045852 Experimental RAFL05-18-I06 AV784328;AV823374;AY045852 unknown protein (At1g28710)
2 2 13 5 RAFL05-18-E01 AV823350 Experimental RAFL05-18-E01 AV823350
2 2 13 6 RAFL05-18-N23 BP561010 Experimental RAFL05-18-N23 AV784371;BP561010;AY059724 glucosyltransferase like protein
2 2 13 7 RAFL05-18-N16 AY045964 Experimental RAFL05-18-N16 AV784369;AV823410;AY045964 bZip transcription factor AtbZip60
2 2 13 8 RAFL05-18-E11 AY059720 Experimental RAFL05-18-E11 AV784298;AV823351;AY059720 putative pre-mRNA splicing factor
2 2 13 9 RAFL05-18-L21 AV823401 Experimental RAFL05-18-L21 AV784359;AV823401 polyubiquitin (ubq3)
2 2 13 10 RAFL05-18-G15 AY045849 Experimental RAFL05-18-G15 AV784312;AV823360;AY045849 ring-H2 finger like protein
2 2 13 11 RAFL05-18-H10 AY045824 Experimental RAFL05-18-H10 AV784319;AV823367;AY045824 26S proteasome regulatory subunit
2 2 13 12 RAFL05-18-D04 AY045880 Experimental RAFL05-18-D04 AV784295;AV823346;AY045880 acetyl-CoA synthetase
2 2 13 13 RAFL05-19-B04 AY046054 Experimental RAFL05-19-B04 AV784389;AV823428;AY046054 putative protein
2 2 13 14 RAFL05-18-L19 AY046049 Experimental RAFL05-18-L19 AV784357;AV823399;AY046049 unknown protein
2 2 14 1 RAFL06-10-E05 AY059922 Experimental RAFL06-10-E05 AV784995;AY059922 Putative NADH-ubiquinone oxidoreductase
2 2 14 2 RAFL06-10-D03 AY065109 Experimental RAFL06-10-D03 AV784986;AY065109 60S ribosomal protein L26
2 2 14 3 RAFL06-11-M06 BT000455 Experimental RAFL06-11-M06 AV785108;AV823999;BT000455 putative transcription factor (MYB46)
2 2 14 4 RAFL06-11-E07 AY062767 Experimental RAFL06-11-E07 AV785066;AV823967;AY062767 carboxy-terminal proteinase D1-like protein
2 2 14 5 RAFL05-18-O24 AY080790 Experimental RAFL05-18-O24 AV823419;AY080790 unknown protein
2 2 14 6 RAFL05-18-E19 AV823354 Experimental RAFL05-18-E19 AV784302;AV823354 ERD6 protein
2 2 14 7 RAFL05-18-D16 AV823348 Experimental RAFL05-18-D16 AV823348 unknown protein
2 2 14 8 RAFL05-18-P09 AV823421 Experimental RAFL05-18-P09 AV784380;AV823421 peroxidase ATP4a
2 2 14 9 RAFL05-18-G03 BP561003 Experimental RAFL05-18-G03 AV784306;BP561003 unknown protein
2 2 14 10 RAFL05-18-O20 AY045942 Experimental RAFL05-18-O20 AV784376;AV823416;AY045942 unknown protein
2 2 14 11 RAFL05-18-G22 AY096650 Experimental RAFL05-18-G22 AV784314;AV823362;AY096650 putative protein
2 2 14 12 RAFL05-18-M18 AV784362 Experimental RAFL05-18-M18 AV784362 dehydrin RAB18-like protein (sp|P30185)
2 2 14 13 RAFL05-18-P15 BP561011 Experimental RAFL05-18-P15 BP561011 unknown
2 2 14 14 RAFL05-18-O11 AV823414 Experimental RAFL05-18-O11 AV784374;AV823414 putative spliceosome associated protein
2 3 1 1 RAFL03-08-K18 AV821333 Experimental RAFL03-08-K18 AV781731;AV821333;AF380635 putative calmodulin
2 3 1 2 RAFL03-04-L10 AV821261 Experimental RAFL03-04-L10 AV781615;AV821261;AF380631 chlorophyll a/b-binding protein - like
2 3 1 3 RAFL03-02-A08 AY075686 Experimental RAFL03-02-A08 AV781583;AV821240;AY075686 unknown protein
2 3 1 4 RAFL03-06-B07 AY039592 Experimental RAFL03-06-B07 AV781642;AV821284;AY039592 unknown protein
2 3 1 5 RAFL03-10-P14 AY039586 Experimental RAFL03-10-P14 AV781771;AV821350;AY039586 unknown protein
2 3 1 6 RAFL03-10-B01 AY045686 Experimental RAFL03-10-B01 AV781768;AV821348;AY045686 unknown protein
2 3 1 7 RAFL03-01-G05 AY045681 Experimental RAFL03-01-G05 AV781576;AV821235;AY045681 myrosinase precursor
2 3 1 8 RAFL03-04-A03 AV781607 Experimental RAFL03-04-A03 AV781607;AF380628 unknown protein
2 3 1 9 RAFL03-01-B05 AY039598 Experimental RAFL03-01-B05 AV821230;AY039598 unknown protein
2 3 1 10 RAFL03-03-E01 AY039596 Experimental RAFL03-03-E01 AV781603;AV821253;AY039596 putative serine carboxypeptidase II
2 3 1 11 RAFL03-01-C10 BP560486 Experimental RAFL03-01-C10 AV781572;BP560486;AY045689 pseudogene
2 3 1 12 RAFL03-01-A05 AV821229 Experimental RAFL03-01-A05 AV781569;AV821229;AF380641 sulfolipid biosynthesis protein SQD1
2 3 1 13 RAFL03-05-L02 AV781633 Experimental RAFL03-05-L02 AV781633;AF380634 unknown protein
2 3 1 14 RAFL03-02-G07 AV821248 Experimental RAFL03-02-G07 AV781595;AV821248;AF380633 unknown protein
2 3 2 1 RAFL04-12-P15 AY034987 Experimental RAFL04-12-P15 AV782007;AY034987 unknown protein
2 3 2 2 RAFL04-13-M20 AY035184 Experimental RAFL04-13-M20 AV782080;AV821578;AY035184 nucleoside diphosphate kinase 3 (ndpk3)
2 3 2 3 RAFL04-13-G17 AY035168 Experimental RAFL04-13-G17 AV782047;AV821552;AY035168 thaumatin-like protein
2 3 2 4 RAFL04-13-J15 AY035118 Experimental RAFL04-13-J15 AV782062;AV821563;AY035118
2 3 2 5 RAFL03-06-N08 AV821301 Experimental RAFL03-06-N08 AV781670;AV821301;AF380654 ubiquitin conjugating enzyme-like protein
2 3 2 6 RAFL03-07-N13 AV821320 Experimental RAFL03-07-N13 AV781710;AV821320;AF380653 unknown protein
2 3 2 7 RAFL03-07-B04 AV821304 Experimental RAFL03-07-B04 AV781676;AV821304;AF380650 unknown protein
2 3 2 8 RAFL03-08-I04 AV821331 Experimental RAFL03-08-I04 AV781728;AV821331;AF380642 3-hydroxyisobutyryl-coenzyme A hydrolase - like protein
2 3 2 9 RAFL03-09-D12 AY045679 Experimental RAFL03-09-D12 AV781744;AY045679 putative glutathione S-transferase
2 3 2 10 RAFL03-07-D23 AV821309 Experimental RAFL03-07-D23 AV781686;AV821309;AF380632 unknown protein
2 3 2 11 RAFL03-07-E17 AV821310 Experimental RAFL03-07-E17 AV781688;AV821310;AF380657
2 3 2 12 RAFL03-09-C14 AY075688 Experimental RAFL03-09-C14 AV781743;AV821340;AY075688 geranylgeranyl reductase
2 3 2 13 RAFL03-08-H22 AY045690 Experimental RAFL03-08-H22 AV781727;AV821330;AY045690 putative aquaporin (water channel protein)
2 3 2 14 RAFL03-09-F17 AV821341 Experimental RAFL03-09-F17 AV781747;AV821341;AF380643 unknown protein
2 3 3 1 RAFL04-13-P22 AY090959 Experimental RAFL04-13-P22 AV782102;AV821598;AY090959
2 3 3 2 RAFL04-13-C21 AV821537 Experimental RAFL04-13-C21 AV782030;AV821537;AF370276 unknown protein
2 3 3 3 RAFL04-13-M18 AY034990 Experimental RAFL04-13-M18 AV782079;AV821577;AY034990 unknown protein
2 3 3 4 RAFL04-13-A12 AV821525 Experimental RAFL04-13-A12 AV782016;AV821525;AF370242 unknown protein
2 3 3 5 RAFL04-13-O09 AY035171 Experimental RAFL04-13-O09 AV782092;AV821588;AY035171 putative mitochondrial processing peptidase alpha subunit
2 3 3 6 RAFL04-13-P03 AY039920 Experimental RAFL04-13-P03 AV782098;AV821593;AY039920 unknown protein
2 3 3 7 RAFL04-13-E14 AY039943 Experimental RAFL04-13-E14 AV782036;AV821543;AY039943 unknown protein
2 3 3 8 RAFL04-13-J09 BP560597 Experimental RAFL04-13-J09 AV782061;BP560597;AY035000 unknown protein
2 3 3 9 RAFL04-13-O03 AV821585 Experimental RAFL04-13-O03 AV782088;AV821585;AF370265 two-component phosphorelay mediator, putative
2 3 3 10 RAFL04-14-E16 AV821615 Experimental RAFL04-14-E16 AV782125;AV821615
2 3 3 11 RAFL04-14-C12 AY035170 Experimental RAFL04-14-C12 AV782115;AV821607;AY035170 14-3-3-LIKE PROTEIN GF14 UPSILON
2 3 3 12 RAFL04-14-B04 AY035120 Experimental RAFL04-14-B04 AV782108;AV821603;AY035120 unknown protein
2 3 3 13 RAFL04-12-F24 AY035097 Experimental RAFL04-12-F24 AV781960;AV821486;AY035097 putative proline-rich protein
2 3 3 14 RAFL04-14-C11 AV821606 Experimental RAFL04-14-C11 AV782114;AV821606 protein phosphatase - like protein
2 3 4 1 RAFL04-20-C13 BP560690 Experimental RAFL04-20-C13 AV782654;BP560690 putative protein
2 3 4 2 RAFL04-19-N24 AY054596 Experimental RAFL04-19-N24 AV782632;AV822013;AY054596 unknown protein
2 3 4 3 RAFL04-18-P24 AV821960 Experimental RAFL04-18-P24 AV782551;AV821960;AF370542 copia-like retroelement pol polyprotein
2 3 4 4 RAFL04-18-D21 AV821927 Experimental RAFL04-18-D21 AV782513;AV821927 MADS-box transcription factor (AGL16)
2 3 4 5 RAFL04-18-L17 AY054689 Experimental RAFL04-18-L17 AV782536;AV821947;AY054689 unknown protein
2 3 4 6 RAFL04-18-F13 AY081255 Experimental RAFL04-18-F13 AV782520;AV821933;AY081255 unknown protein
2 3 4 7 RAFL04-19-K24 AY042821 Experimental RAFL04-19-K24 AV782615;AV822003;AY042821 chlorophyll synthetase like protein
2 3 4 8 RAFL04-17-C22 BP560650 Experimental RAFL04-17-C22 AV782401;BP560650;AY128349 unknown protein
2 3 4 9 RAFL04-15-E01 AY080666 Experimental RAFL04-15-E01 AV782209;AV821683;AY080666
2 3 4 10 RAFL04-14-M06 AY035003 Experimental RAFL04-14-M06 AV782156;AV821641;AY035003 permease 1 - like protein
2 3 4 11 RAFL04-15-A18 AV821664 Experimental RAFL04-15-A18 AV782184;AV821664
2 3 4 12 RAFL04-15-J04 AY045793 Experimental RAFL04-15-J04 AV782241;AV821709;AY045793 putative protein
2 3 4 13 RAFL04-15-D01 AV821674 Experimental RAFL04-15-D01 AV782198;AV821674;AF370225 putative 60S acidic ribosomal protein P0
2 3 4 14 RAFL04-14-O13 AY035125 Experimental RAFL04-14-O13 AV782168;AV821650;AY035125 ABC transporter like ATPase
2 3 5 1 RAFL04-19-M17 AY128355 Experimental RAFL04-19-M17 AV782625;AV822010;AY128355 unknown protein
2 3 5 2 RAFL04-17-I16 BP560662 Experimental RAFL04-17-I16 AV782455;BP560662 unknown protein
2 3 5 3 RAFL04-19-I11 AY128333 Experimental RAFL04-19-I11 AV782599;AY128333 actin depolymerizing factor - like protein
2 3 5 4 RAFL04-19-J05 AY042874 Experimental RAFL04-19-J05 AV782602;AV821996;AY042874 Similar to glucose-6-phosphate/phosphate-translocator
2 3 5 5 RAFL04-19-H20 AY081263 Experimental RAFL04-19-H20 AV782593;AV821990;AY081263 60S ribosomal protein L10A
2 3 5 6 RAFL04-17-L18 AY128332 Experimental RAFL04-17-L18 AV782476;AY128332 endoplasmic reticulum-type calcium-transporting ATPase 4 (ECA4)
2 3 5 7 RAFL04-17-H16 AV821877 Experimental RAFL04-17-H16 AV782447;AV821877 serine acetyltransferase (Sat-1)
2 3 5 8 RAFL04-19-G11 BP560680 Experimental RAFL04-19-G11 AV782585;BP560680;AF386966 casein kinase II catalytic subunit (ATPK12D)
2 3 5 9 RAFL04-19-E09 AV821982 Experimental RAFL04-19-E09 AV782579;AV821982;AF387006 Unknown protein (MRO11.3)
2 3 5 10 RAFL04-19-H05 AY128353 Experimental RAFL04-19-H05 AV782590;AV821988;AY128353 hypothetical protein
2 3 5 11 RAFL04-19-G17 AV782587 Experimental RAFL04-19-G17 AV782587 putative protein
2 3 5 12 RAFL04-19-B15 AV821970 Experimental RAFL04-19-B15 AV782563;AV821970;AF386959 unknown protein
2 3 5 13 RAFL04-19-O12 AY065082 Experimental RAFL04-19-O12 AV782633;AV822014;AY065082 dnaJ-like protein
2 3 5 14 RAFL04-17-E06 AY128351 Experimental RAFL04-17-E06 AV782415;AV821852;AY128351 eukaryotic translation initiation factor 6 (EIF-6) - like protein
2 3 6 1 RAFL05-05-C12 AY039909 Experimental RAFL05-05-C12 AV783079;AV822343;AY039909 RNA-binding protein cp29 protein
2 3 6 2 RAFL05-05-B01 AY039892 Experimental RAFL05-05-B01 AV783072;AV822337;AY039892 putative protein
2 3 6 3 RAFL05-04-P18 AY037258 Experimental RAFL05-04-P18 AV783064;AV822331;AY037258 unknown protein
2 3 6 4 RAFL05-03-L14 AY037257 Experimental RAFL05-03-L14 AV782947;AV822244;AY037257 unknown protein
2 3 6 5 RAFL05-03-H12 AY037252 Experimental RAFL05-03-H12 AV782932;AV822231;AY037252 microbody NAD-dependent malate dehydrogenase
2 3 6 6 RAFL05-02-E22 AY037245 Experimental RAFL05-02-E22 AV782840;AV822163;AY037245 unknown protein
2 3 6 7 RAFL05-02-F07 BP560736 Experimental RAFL05-02-F07 AV782843;BP560736;AY039910 MAP kinase
2 3 6 8 RAFL05-02-L02 AY039894 Experimental RAFL05-02-L02 AV822183;AY039894 unknown protein
2 3 6 9 RAFL05-02-N24 AY039888 Experimental RAFL05-02-N24 AV782885;AV822195;AY039888 unknown protein
2 3 6 10 RAFL05-02-N21 AY094426 Experimental RAFL05-02-N21 AV782883;AV822193;AY094426 chloroplast inner envelope protein, putative, 5' partial
2 3 6 11 RAFL05-02-K09 AY037253 Experimental RAFL05-02-K09 AV782864;AV822182;AY037253 60S ribosomal protein L10A
2 3 6 12 RAFL05-02-H04 AY037246 Experimental RAFL05-02-H04 AV782850;AV822172;AY037246 unknown protein
2 3 6 13 RAFL04-19-D23 AV821978 Experimental RAFL04-19-D23 AV782573;AV821978;AF386982 ankyrin repeat-containing protein 2
2 3 6 14 RAFL04-19-J20 AY128334 Experimental RAFL04-19-J20 AV782604;AY128334 anthranilate N-hydroxycinnamoyl/benzoyltransferase - like protein
2 3 7 1 RAFL05-08-K18 AV822547 Experimental RAFL05-08-K18 AV783344;AV822547;AF370323 muconate cycloisomerase like protein
2 3 7 2 RAFL05-08-G09 AY046010 Experimental RAFL05-08-G09 AV783320;AV822529;AY046010 putative protein
2 3 7 3 RAFL05-05-E20 AY039900 Experimental RAFL05-05-E20 AV783086;AV822347;AY039900 putative ribosomal protein
2 3 7 4 RAFL05-03-P08 AY037263 Experimental RAFL05-03-P08 AV782969;AY037263 metallothionein-like protein (AtMT-K)
2 3 7 5 RAFL05-03-O05 AY123994 Experimental RAFL05-03-O05 AV782960;AV822251;AY123994 unknown protein
2 3 7 6 RAFL05-04-N24 AY037256 Experimental RAFL05-04-N24 AV783049;AV822323;AY037256 unknown protein
2 3 7 7 RAFL05-04-M23 AY037254 Experimental RAFL05-04-M23 AV783042;AV822319;AY037254
2 3 7 8 RAFL05-04-L16 AY094433 Experimental RAFL05-04-L16 AV783037;AV822314;AY094433 unknown
2 3 7 9 RAFL05-04-E15 AV822284 Experimental RAFL05-04-E15 AV783005;AV822284;AF462809 unknown protein
2 3 7 10 RAFL05-05-G17 AY037262 Experimental RAFL05-05-G17 AV783098;AV822357;AY037262 dihydrolipoamide S-acetyltransferase
2 3 7 11 RAFL05-05-F20 AY039884 Experimental RAFL05-05-F20 AV783092;AV822351;AY039884 unknown protein
2 3 7 12 RAFL05-05-E14 AY039875 Experimental RAFL05-05-E14 AV783084;AV822346;AY039875 unknown protein
2 3 7 13 RAFL05-04-O20 AY039865 Experimental RAFL05-04-O20 AV783057;AV822328;AY039865 unknown protein
2 3 7 14 RAFL05-04-J02 AY094430 Experimental RAFL05-04-J02 AV822300;AY094430
2 3 8 1 RAFL05-07-J09 AY063814 Experimental RAFL05-07-J09 AV783223;AV822450;AY063814 prolylcarboxypeptidase-like protein
2 3 8 2 RAFL05-07-H21 AV822445 Experimental RAFL05-07-H21 AV783214;AV822445 unknown protein
2 3 8 3 RAFL05-07-G20 AV822437 Experimental RAFL05-07-G20 AV783203;AV822437;AF370327 unknown protein
2 3 8 4 RAFL05-08-H19 BP560833 Experimental RAFL05-08-H19 BP560833;AF370299 unknown protein (At1g68820)
2 3 8 5 RAFL05-07-O04 AY040019 Experimental RAFL05-07-O04 AV783260;AV822482;AY040019 putative 3-o-glucosyltransferase
2 3 8 6 RAFL05-08-P23 AY045920 Experimental RAFL05-08-P23 AV783375;AV822571;AY045920 unknown protein
2 3 8 7 RAFL05-08-O17 AY035135 Experimental RAFL05-08-O17 AV783367;AV822567;AY035135 unknown protein
2 3 8 8 RAFL05-08-N22 AY034960 Experimental RAFL05-08-N22 AV783358;AV822558;AY034960 prolyl carboxypeptidase like protein
2 3 8 9 RAFL05-08-M16 AV822552 Experimental RAFL05-08-M16 AV783352;AV822552 unknown protein
2 3 8 10 RAFL05-08-K19 AY034902 Experimental RAFL05-08-K19 AV783345;AV822548;AY034902
2 3 8 11 RAFL05-07-O03 AY040017 Experimental RAFL05-07-O03 AV783259;AV822481;AY040017 putative J8 protein
2 3 8 12 RAFL05-07-N04 AV822471 Experimental RAFL05-07-N04 AV783249;AV822471;AF370149 unknown protein
2 3 8 13 RAFL05-08-O16 AY035133 Experimental RAFL05-08-O16 AV822566;AY035133 putative glycine-rich, zinc-finger DNA-binding protein
2 3 8 14 RAFL05-07-J05 AY034958 Experimental RAFL05-07-J05 AV783221;AY034958 sucrose synthase like protein
2 3 9 1 RAFL05-12-C15 AV822824 Experimental RAFL05-12-C15 AV783678;AV822824 similar to ADP-ribosylation factor gb|AAD17207; similar to ESTs gb|N65779, gb|AI996946.1, gb|AI725909.1, gb|T45928, gb|T42202
2 3 9 2 RAFL05-12-G13 AV822852 Experimental RAFL05-12-G13 AV783711;AV822852;AF386950 putative protein
2 3 9 3 RAFL05-12-P11 AV822900 Experimental RAFL05-12-P11 AV783769;AV822900
2 3 9 4 RAFL05-13-K22 AV822963 Experimental RAFL05-13-K22 AV783843;AV822963 ribonucleoprotein like protein
2 3 9 5 RAFL05-13-J17 AV822957 Experimental RAFL05-13-J17 AV783837;AV822957 hypothetical protein
2 3 9 6 RAFL05-13-J10 AY120707 Experimental RAFL05-13-J10 AV783836;AV822956;AY120707 unknown protein
2 3 9 7 RAFL05-08-A21 AY040023 Experimental RAFL05-08-A21 AV783281;AV822500;AY040023 phytochrome A supressor spa1, putative
2 3 9 8 RAFL05-07-P13 AV822490 Experimental RAFL05-07-P13 AV783270;AV822490;AF370154 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, putative
2 3 9 9 RAFL05-09-B08 AY045914 Experimental RAFL05-09-B08 AV783384;AV822579;AY045914 unknown protein
2 3 9 10 RAFL05-07-M02 AY034965 Experimental RAFL05-07-M02 AV783241;AV822466;AY034965 ribosomal protein S18 - like
2 3 9 11 RAFL05-08-N24 AY046017 Experimental RAFL05-08-N24 AV783359;AV822559;AY046017 cytochrome P450 like protein
2 3 9 12 RAFL05-07-F15 AV822429 Experimental RAFL05-07-F15 AV783195;AV822429;AF370300 unknown protein
2 3 9 13 RAFL05-07-O05 AY040021 Experimental RAFL05-07-O05 AV783261;AV822483;AY040021 unknown protein
2 3 9 14 RAFL05-07-N07 AV822473 Experimental RAFL05-07-N07 AV783251;AV822473;AF370153 predicted GPI-anchored protein
2 3 10 1 RAFL05-13-B18 BT001991 Experimental RAFL05-13-B18 AV783787;AV822915;BT001991 unknown protein
2 3 10 2 RAFL05-12-N04 AV822889 Experimental RAFL05-12-N04 AV783754;AV822889;AF370535 Unknown protein (F2H15.9)
2 3 10 3 RAFL05-11-E07 AY054621 Experimental RAFL05-11-E07 AV783584;AV822753;AY054621 2-cys peroxiredoxin-like protein
2 3 10 4 RAFL05-11-F04 AY054653 Experimental RAFL05-11-F04 AV783591;AV822760;AY054653 Unknown protein
2 3 10 5 RAFL05-11-I02 AY120718 Experimental RAFL05-11-I02 AV783616;AV822780;AY120718 quinone oxidoreductase -like protein
2 3 10 6 RAFL05-12-K10 AY054652 Experimental RAFL05-12-K10 AV822869;AY054652 unknown protein
2 3 10 7 RAFL05-12-M08 AV822883 Experimental RAFL05-12-M08 AV783748;AV822883 unknown protein
2 3 10 8 RAFL05-12-H07 AY042860 Experimental RAFL05-12-H07 AV783716;AV822855;AY042860
2 3 10 9 RAFL05-12-E19 BT001999 Experimental RAFL05-12-E19 AV783695;BP560894;BT001999 calnexin homolog
2 3 10 10 RAFL05-12-D15 BP560893 Experimental RAFL05-12-D15 AV783690;BP560893;AY054619 putative host response protein
2 3 10 11 RAFL05-11-E04 AV822752 Experimental RAFL05-11-E04 AV783583;AV822752;AF386998 unknown protein
2 3 10 12 RAFL05-13-C23 BT002001 Experimental RAFL05-13-C23 AV783791;BP560911;BT002001 unknown protein
2 3 10 13 RAFL05-13-K17 AV822962 Experimental RAFL05-13-K17 AV783842;AV822962;AF386946 serine/threonine kinase - like protein
2 3 10 14 RAFL05-12-K04 AY054651 Experimental RAFL05-12-K04 AV783732;AV822868;AY054651 indoleacetic acid (IAA)-inducible gene (IAA7)
2 3 11 1 RAFL05-17-D14 AV823260 Experimental RAFL05-17-D14 AV784193;AV823260 putative protein
2 3 11 2 RAFL05-18-B18 AY074853 Experimental RAFL05-18-B18 AV784285;AV823336;AY074853 putative squamosa-promoter binding protein 2
2 3 11 3 RAFL05-17-K03 AY102102 Experimental RAFL05-17-K03 AV784240;AV823301;AY102102 hypothetical protein
2 3 11 4 RAFL05-16-K23 AV823215 Experimental RAFL05-16-K23 AV784147;AV823215;AF462835 ribosomal protein L19, putative
2 3 11 5 RAFL05-16-E07 AY091772 Experimental RAFL05-16-E07 AV784097;AV823171;AY091772 transport inhibitor response-like protein
2 3 11 6 RAFL05-14-L16 AV823053 Experimental RAFL05-14-L16 AV783951;AV823053 cell elongation protein, Dwarf1
2 3 11 7 RAFL05-14-K14 BP560937 Experimental RAFL05-14-K14 AV783940;BP560937;AF462841 unknown protein
2 3 11 8 RAFL05-15-E19 AY050388 Experimental RAFL05-15-E19 AV823099;AY050388 putative protein phosphatase-2C
2 3 11 9 RAFL05-14-I08 AY050438 Experimental RAFL05-14-I08 AV783923;AV823027;AY050438 arabinogalactan-protein AGP1 (gb|AAC77823.1)
2 3 11 10 RAFL05-15-P13 AV823150 Experimental RAFL05-15-P13 AV784073;AV823150 Ring3-like bromodomain protein
2 3 11 11 RAFL05-11-H09 AV822775 Experimental RAFL05-11-H09 AV783611;AV822775 putative indole-3-acetate beta-glucosyltransferase
2 3 11 12 RAFL05-12-O13 AV822894 Experimental RAFL05-12-O13 AV783761;AV822894;AF386933 Thioredoxin like protein
2 3 11 13 RAFL05-12-D12 AY054655 Experimental RAFL05-12-D12 AV783689;AV822835;AY054655 unknown protein
2 3 11 14 RAFL05-13-G24 BT001990 Experimental RAFL05-13-G24 AV783823;AV822944;BT001990 50S ribosomal protein L24, chloroplast precursor
2 3 12 1 RAFL05-16-L13 AY091773 Experimental RAFL05-16-L13 AV823219;AY091773 cucumisin-like serine protease (gb|AAC18851.1)
2 3 12 2 RAFL05-16-I03 AY074858 Experimental RAFL05-16-I03 AV784126;AV823195;AY074858 unknown protein
2 3 12 3 RAFL05-17-B13 AY074855 Experimental RAFL05-17-B13 AV784184;AV823250;AY074855 putative protein
2 3 12 4 RAFL05-17-O08 BP560993 Experimental RAFL05-17-O08 AV784262;BP560993;AF462836 unknown protein
2 3 12 5 RAFL05-17-E04 AY074848 Experimental RAFL05-17-E04 AV784200;AV823267;AY074848 unknown protein
2 3 12 6 RAFL05-16-M24 AV823228 Experimental RAFL05-16-M24 AV784161;AV823228 hypothetical protein
2 3 12 7 RAFL05-17-A04 AY074861 Experimental RAFL05-17-A04 AV784177;AV823244;AY074861 putative protein
2 3 12 8 RAFL05-18-B06 AY050395 Experimental RAFL05-18-B06 AV784283;AV823334;AY050395
2 3 12 9 RAFL05-16-P12 AY050391 Experimental RAFL05-16-P12 AV784170;AV823237;AY050391 putative photosystem II core complex protein
2 3 12 10 RAFL05-16-O05 AY050390 Experimental RAFL05-16-O05 AV784166;AV823233;AY050390 putative protein
2 3 12 11 RAFL05-16-K02 AY074849 Experimental RAFL05-16-K02 AV784138;AV823206;AY074849 putative protein
2 3 12 12 RAFL05-18-C23 AV823343 Experimental RAFL05-18-C23 AV784292;AV823343;AF462832 unknown protein
2 3 12 13 RAFL05-16-L05 AV823216 Experimental RAFL05-16-L05 AV784148;AV823216 unknown protein
2 3 12 14 RAFL05-17-F16 AV823275 Experimental RAFL05-17-F16 AV784209;AV823275 transketolase - like protein
2 3 13 1 RAFL05-21-D23 AV823571 Experimental RAFL05-21-D23 AV784566;AV823571 putative 20S proteasome beta subunit PBC2
2 3 13 2 RAFL05-21-P16 AY046052 Experimental RAFL05-21-P16 AV784637;AV823633;AY046052 mitochondrial carrier like protein
2 3 13 3 RAFL05-21-E06 AV823573 Experimental RAFL05-21-E06 AV784568;AV823573 putative protein
2 3 13 4 RAFL05-21-A03 BT000704 Experimental RAFL05-21-A03 AV823546;BT000704 putative glycine-rich protein
2 3 13 5 RAFL05-20-M16 AY045826 Experimental RAFL05-20-M16 AV823530;AY045826 homeodomain transcription factor (ATHB-7)
2 3 13 6 RAFL05-21-M21 AY091141 Experimental RAFL05-21-M21 AV823616;AY091141 amylogenin; reversibly glycosylatable polypeptide
2 3 13 7 RAFL05-21-K14 BP561050 Experimental RAFL05-21-K14 AV784601;BP561050;AY045963 40S ribosomal protein S19
2 3 13 8 RAFL05-21-K10 AY046051 Experimental RAFL05-21-K10 AV784600;AV823598;AY046051
2 3 13 9 RAFL05-19-J18 AV823478 Experimental RAFL05-19-J18 AV784451;AV823478 putative protein
2 3 13 10 RAFL05-19-I11 AY045848 Experimental RAFL05-19-I11 AV784446;AV823473;AY045848 unknown protein
2 3 13 11 RAFL05-19-N05 AY045823 Experimental RAFL05-19-N05 AV784480;AV823500;AY045823
2 3 13 12 RAFL05-19-K24 AY045998 Experimental RAFL05-19-K24 AV784460;AV823483;AY045998 unknown protein
2 3 13 13 RAFL05-19-L21 AY050852 Experimental RAFL05-19-L21 AV784468;AY050852 putative RNA-binding protein
2 3 13 14 RAFL05-19-G11 AY050996 Experimental RAFL05-19-G11 AV784426;AV823458;AY050996 GF14 Kappa isoform
2 3 14 1 RAFL06-08-G19 AY059930 Experimental RAFL06-08-G19 AV784800;AV823759;AY059930 ATP-dependent RNA helicase-like
2 3 14 2 RAFL06-08-D19 AV823747 Experimental RAFL06-08-D19 AV784782;AV823747 putative NADH dehydrogenase (ubiquinone) 76K chain precursor protein
2 3 14 3 RAFL06-07-P16 AY062794 Experimental RAFL06-07-P16 AV784753;AV823721;AY062794 SWI/SNF family like transcription activator
2 3 14 4 RAFL06-07-O07 BT002419 Experimental RAFL06-07-O07 AV784743;BP561072;BT002419 unknown protein
2 3 14 5 RAFL05-21-G11 AV823583 Experimental RAFL05-21-G11 AV823583
2 3 14 6 RAFL05-21-N06 AY045857 Experimental RAFL05-21-N06 AV784621;AV823617;AY045857 unknown protein
2 3 14 7 RAFL05-20-O23 AY080771 Experimental RAFL05-20-O23 AV784532;AV823541;AY080771 delta-1-pyrroline 5-carboxylase synthetase (P5C1)
2 3 14 8 RAFL05-20-P13 AY045797 Experimental RAFL05-20-P13 AV784537;AV823543;AY045797 histone H1
2 3 14 9 RAFL05-21-A22 AY045967 Experimental RAFL05-21-A22 AV784548;AV823554;AY045967 histone H2A, putative
2 3 14 10 RAFL05-21-G17 BP561043 Experimental RAFL05-21-G17 AV784582;BP561043;AY050997 unknown protein
2 3 14 11 RAFL05-21-B15 AY080875 Experimental RAFL05-21-B15 AV784552;AV823557;AY080875 protein phosphatase homolog (PPH1)
2 3 14 12 RAFL05-21-E11 AV823575 Experimental RAFL05-21-E11 AV784570;AV823575 cellulose synthase
2 3 14 13 RAFL05-21-G03 AY056196 Experimental RAFL05-21-G03 AV784577;AY056196 pyruvate kinase like protein
2 3 14 14 RAFL05-20-L17 AY045796 Experimental RAFL05-20-L17 AV784512;AY045796 hypothetical protein
2 4 1 1 RAFL02-10-F08 AV821211 Experimental RAFL02-10-F08 AV781538;AV821211;AF375401 cytochrome P450 like protein
2 4 1 2 RAFL02-05-B07 AV821129 Experimental RAFL02-05-B07 AV781393;AV821129;AF361845 putative protein
2 4 1 3 RAFL02-03-H09 AY039571 Experimental RAFL02-03-H09 AV781374;AV821119;AY039571 unknown protein
2 4 1 4 RAFL02-10-B11 AV821203 Experimental RAFL02-10-B11 AV781529;AV821203;AF361861 peptide deformylase-like protein
2 4 1 5 RAFL02-02-H09 AY065059 Experimental RAFL02-02-H09 AV821108;AY065059
2 4 1 6 RAFL02-05-C01 AV821131 Experimental RAFL02-05-C01 AV781395;AV821131;AF375412 rac-like GTP binding protein Arac11
2 4 1 7 RAFL02-10-D23 AY075699 Experimental RAFL02-10-D23 AV781534;AV821208;AY075699 shaggy-like protein kinase etha (EC 2.7.1.-)
2 4 1 8 RAFL02-10-I16 AV821220 Experimental RAFL02-10-I16 AV781554;AV821220;AF361841 60S RIBOSOMAL PROTEIN L38-like protein
2 4 1 9 RAFL02-10-C07 AV821205 Experimental RAFL02-10-C07 AV781531;AV821205;AF375420 auxin-induced protein
2 4 1 10 RAFL02-06-B01 AY070472 Experimental RAFL02-06-B01 AV781411;AV821142;AY070472 putative T-complex protein 1, ETA subunit
2 4 1 11 RAFL02-01-F04 AY070463 Experimental RAFL02-01-F04 AV781344;AV821094;AY070463
2 4 1 12 RAFL02-03-H08 AV821118 Experimental RAFL02-03-H08 AV781373;AV821118;AF375414 heme oxygenase 1 (HO1)
2 4 1 13 RAFL02-05-K10 AV781408 Experimental RAFL02-05-K10 AV781408;AF375400 metallothionein-like protein
2 4 1 14 RAFL02-01-H06 AV821096 Experimental RAFL02-01-H06 AV821096;AF375399
2 4 2 1 RAFL04-10-F19 AV821441 Experimental RAFL04-10-F19 AV781893;AV821441 galactosidase, putative
2 4 2 2 RAFL04-10-D11 BP560573 Experimental RAFL04-10-D11 AV781878;BP560573;AY035183 unknown protein
2 4 2 3 RAFL04-10-C18 AY046020 Experimental RAFL04-10-C18 AV781875;AV821430;AY046020 putative ATP synthase
2 4 2 4 RAFL04-10-B14 AY035117 Experimental RAFL04-10-B14 AV781867;AV821424;AY035117 glycine hydroxymethyltransferase - like protein
2 4 2 5 RAFL02-02-B07 AV821103 Experimental RAFL02-02-B07 AV781355;AV821103;AF361863
2 4 2 6 RAFL02-05-B10 AV821130 Experimental RAFL02-05-B10 AV781394;AV821130;AF361860 copper homeostasis factor
2 4 2 7 RAFL02-05-I05 AV821135 Experimental RAFL02-05-I05 AV781403;AV821135;AF361859 cinnamyl-alcohol dehydrogenase ELI3-2
2 4 2 8 RAFL02-10-I18 AY039561 Experimental RAFL02-10-I18 AV781555;AV821221;AY039561 photosystem II type I chlorophyll a/b binding protein
2 4 2 9 RAFL02-03-B03 AV821112 Experimental RAFL02-03-B03 AV781368;AV821112;AF361848 unknown protein
2 4 2 10 RAFL02-06-B20 AV821145 Experimental RAFL02-06-B20 AV781413;AV821145;AF361840 unknown protein
2 4 2 11 RAFL02-03-F02 AV821115 Experimental RAFL02-03-F02 AV821115;AF361862 unknown protein
2 4 2 12 RAFL02-05-J09 AV821137 Experimental RAFL02-05-J09 AV781406;AV821137;AF375416 putative ubiquitin extension protein (UBQ6)
2 4 2 13 RAFL02-10-E21 AY065060 Experimental RAFL02-10-E21 AV781536;AV821209;AY065060 putative cytochrome P450
2 4 2 14 RAFL02-03-L07 AY039563 Experimental RAFL02-03-L07 AV781377;AV821120;AY039563 beta-ketoacyl-CoA synthase (FIDDLEHEAD)
2 4 3 1 RAFL04-12-N14 AY039944 Experimental RAFL04-12-N14 AV781997;AV821511;AY039944 splicing factor 3a
2 4 3 2 RAFL04-12-H11 AY039937 Experimental RAFL04-12-H11 AV781968;AV821492;AY039937 lysyl-tRNA synthetase like protein
2 4 3 3 RAFL04-13-A16 AY034989 Experimental RAFL04-13-A16 AV782020;AV821529;AY034989 profilin-like protein
2 4 3 4 RAFL04-12-K04 AY034976 Experimental RAFL04-12-K04 AV781982;AV821501;AY034976 unknown protein
2 4 3 5 RAFL04-13-H08 AV821554 Experimental RAFL04-13-H08 AV782049;AV821554;AF370223 unknown protein
2 4 3 6 RAFL04-10-O12 AY035122 Experimental RAFL04-10-O12 AV781927;AV821468;AY035122 unknown protein
2 4 3 7 RAFL04-13-F08 AY035100 Experimental RAFL04-13-F08 AV782039;AV821544;AY035100 AP2 domain containing protein RAP2.3
2 4 3 8 RAFL04-12-M22 AY046003 Experimental RAFL04-12-M22 AV821510;AY046003 unknown protein
2 4 3 9 RAFL04-10-F23 AV821442 Experimental RAFL04-10-F23 AV821442;AF370264 putative protein
2 4 3 10 RAFL04-10-F13 AV821439 Experimental RAFL04-10-F13 AV781891;AV821439 unknown protein
2 4 3 11 RAFL04-10-E02 AV821435 Experimental RAFL04-10-E02 AV781883;AV821435
2 4 3 12 RAFL04-10-D13 AV821432 Experimental RAFL04-10-D13 AV781879;AV821432;AF370211 unknown protein
2 4 3 13 RAFL04-10-F12 BP560575 Experimental RAFL04-10-F12 AV781890;BP560575;AY035096 putative disulfide isomerase
2 4 3 14 RAFL04-10-B12 AY034999 Experimental RAFL04-10-B12 AV781866;AV821423;AY034999 putative DNA-3-methyladenine glycosylase I
2 4 4 1 RAFL04-15-M14 AY042823 Experimental RAFL04-15-M14 AV782270;AV821733;AY042823 putative photosystem I reaction center subunit IV
2 4 4 2 RAFL04-16-L13 AY054682 Experimental RAFL04-16-L13 AV782364;AV821812;AY054682 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR)
2 4 4 3 RAFL04-16-J06 AY042828 Experimental RAFL04-16-J06 AV782344;AV821798;AY042828 ubiquitin-like protein
2 4 4 4 RAFL04-16-F02 AY042905 Experimental RAFL04-16-F02 AV821778;AY042905 putative fibrillin
2 4 4 5 RAFL04-15-N17 AY065191 Experimental RAFL04-15-N17 AV782277;AV821741;AY065191 ethylene-insensitive3-like1 (EIL1)
2 4 4 6 RAFL04-16-J09 AY065078 Experimental RAFL04-16-J09 AV782346;AV821800;AY065078 unknown protein
2 4 4 7 RAFL04-16-E04 AY042820 Experimental RAFL04-16-E04 AV782316;AV821774;AY042820 multicatalytic endopeptidase complex alpha chain
2 4 4 8 RAFL04-15-O19 AV821747 Experimental RAFL04-15-O19 AV782285;AV821747 putative sulphate transporter protein
2 4 4 9 RAFL04-13-M01 AY080744 Experimental RAFL04-13-M01 AV782076;AY080744 unknown protein
2 4 4 10 RAFL04-10-J03 AY035002 Experimental RAFL04-10-J03 AV781906;AV821450;AY035002 unknown protein
2 4 4 11 RAFL04-12-A21 AY034992 Experimental RAFL04-12-A21 AV781934;AV821472;AY034992 cell division protein FtsZ chloroplast homolog precursor (sp|Q42545)
2 4 4 12 RAFL04-12-B19 AY034978 Experimental RAFL04-12-B19 AV781938;AV821476;AY034978 putative enolase
2 4 4 13 RAFL04-12-B15 AV821474 Experimental RAFL04-12-B15 AV781936;AV821474;AF370224 myosin heavy chain-like protein
2 4 4 14 RAFL04-12-K11 AY035124 Experimental RAFL04-12-K11 AV781984;AY035124 GTP-binding protein - like
2 4 5 1 RAFL04-16-I05 BP560638 Experimental RAFL04-16-I05 AV782335;BP560638;AF386977 Unknown protein
2 4 5 2 RAFL04-15-O22 AV821748 Experimental RAFL04-15-O22 AV782286;AV821748;AF386976 glutamate dehydrogenase 2 (GDH2)
2 4 5 3 RAFL04-16-K24 AV821808 Experimental RAFL04-16-K24 AV782356;AV821808;AF370532 unknown protein
2 4 5 4 RAFL04-16-G19 AY065081 Experimental RAFL04-16-G19 AV782327;AV821787;AY065081 putative ubiquinone biosynthesis protein
2 4 5 5 RAFL04-16-A19 AV821761 Experimental RAFL04-16-A19 AV782302;AV821761;AF387005 unknown protein
2 4 5 6 RAFL04-16-F17 AV821780 Experimental RAFL04-16-F17 AV782321;AV821780 putative protein
2 4 5 7 RAFL04-16-D14 AY042838 Experimental RAFL04-16-D14 AV782313;AV821772;AY042838 E2 ubiquitin-conjugating-like enzyme Ahus5
2 4 5 8 RAFL04-16-B10 BP560633 Experimental RAFL04-16-B10 BP560633 1-aminocyclopropane-1-carboxylate oxidase - like protein
2 4 5 9 RAFL04-16-A05 AV821756 Experimental RAFL04-16-A05 AV782296;AV821756 aldehyde dehydrogenase like protein
2 4 5 10 RAFL04-16-J21 AY081259 Experimental RAFL04-16-J21 AY081259 putative protein
2 4 5 11 RAFL04-16-N13 AY065076 Experimental RAFL04-16-N13 AV782374;AV821819;AY065076 putative transitional endoplasmic reticulum ATPase
2 4 5 12 RAFL04-15-N04 BT002017 Experimental RAFL04-15-N04 AV782273;AV821737;BT002017 putative protein
2 4 5 13 RAFL04-16-L06 AY054593 Experimental RAFL04-16-L06 AV782360;AV821810;AY054593 cyclophilin
2 4 5 14 RAFL04-17-B11 AY042869 Experimental RAFL04-17-B11 AV821836;AY042869 unknown protein
2 4 6 1 RAFL04-20-P07 AY124005 Experimental RAFL04-20-P07 AV782738;AV822094;AY124005 hypothetical protein
2 4 6 2 RAFL04-20-J01 AY049297 Experimental RAFL04-20-J01 AV782694;AV822063;AY049297 Putative Cytochrome B5
2 4 6 3 RAFL04-20-P16 AY124003 Experimental RAFL04-20-P16 AV782741;AV822096;AY124003 protein kinase KIPK
2 4 6 4 RAFL04-20-N07 BP560702 Experimental RAFL04-20-N07 AV782722;BP560702;AF389286 translation initiation factor eIF4E
2 4 6 5 RAFL04-20-K07 AY049293 Experimental RAFL04-20-K07 AY049293 actin (ACT3)
2 4 6 6 RAFL04-20-G23 AY079019 Experimental RAFL04-20-G23 AV782678;AV822050;AY079019 unknown protein
2 4 6 7 RAFL04-20-F22 AY049305 Experimental RAFL04-20-F22 AV782674;AV822048;AY049305 putative protein
2 4 6 8 RAFL04-20-F09 AY065055 Experimental RAFL04-20-F09 AV782671;AV822045;AY065055 putative protein
2 4 6 9 RAFL04-20-E09 AY079023 Experimental RAFL04-20-E09 AV782664;AV822041;AY079023 hypothetical protein
2 4 6 10 RAFL04-20-E13 AY094411 Experimental RAFL04-20-E13 AV782666;AV822042;AY094411 unknown protein
2 4 6 11 RAFL04-20-F08 BP560692 Experimental RAFL04-20-F08 AV782670;BP560692;AF389282 putative protein
2 4 6 12 RAFL04-20-F17 AY094410 Experimental RAFL04-20-F17 AV782673;AV822047;AY094410 hypothetical protein
2 4 6 13 RAFL04-15-N07 AV821738 Experimental RAFL04-15-N07 AV782274;AV821738 putative protein
2 4 6 14 RAFL04-16-G07 AY042882 Experimental RAFL04-16-G07 AV782324;AV821783;AY042882 ribosomal protein, chloroplast
2 4 7 1 RAFL05-10-H13 BP560855 Experimental RAFL05-10-H13 AV783513;BP560855;AY034937 unknown protein
2 4 7 2 RAFL05-10-G03 AV822688 Experimental RAFL05-10-G03 AV783507;AV822688;AF326907 unknown protein
2 4 7 3 RAFL05-01-F11 AY079028 Experimental RAFL05-01-F11 AV782776;AV822117;AY079028 unknown protein
2 4 7 4 RAFL05-01-E19 AV822115 Experimental RAFL05-01-E19 AV782772;AV822115;AF389293 unknown protein
2 4 7 5 RAFL05-01-M13 AV822141 Experimental RAFL05-01-M13 AV782805;AV822141;AF389296
2 4 7 6 RAFL04-20-O22 AV822092 Experimental RAFL04-20-O22 AV782735;AV822092;AF389288 hypothetical protein
2 4 7 7 RAFL04-20-G12 AY094418 Experimental RAFL04-20-G12 AV782676;AV822049;AY094418 AMP-binding protein
2 4 7 8 RAFL04-20-K19 AY065048 Experimental RAFL04-20-K19 AV782710;AV822075;AY065048 unknown protein
2 4 7 9 RAFL04-20-H15 AV822056 Experimental RAFL04-20-H15 AV782683;AV822056 putative tryptophanyl-tRNA synthetase
2 4 7 10 RAFL04-20-H06 AY049300 Experimental RAFL04-20-H06 AV822052;AY049300 unknown protein
2 4 7 11 RAFL04-20-L24 AY039548 Experimental RAFL04-20-L24 AV822079;AY039548 unknown protein
2 4 7 12 RAFL04-20-J18 BP560697 Experimental RAFL04-20-J18 AV782700;BP560697 monogalactosyldiacylglycerol synthase - like protein
2 4 7 13 RAFL04-20-M08 AV822082 Experimental RAFL04-20-M08 AV782718;AV822082;AF389283 putative cell division control protein cdc2
2 4 7 14 RAFL04-20-N21 BP560705 Experimental RAFL04-20-N21 AV782729;BP560705;AY049290 unknown protein
2 4 8 1 RAFL05-05-M21 AY035136 Experimental RAFL05-05-M21 AV783129;AV822379;AY035136
2 4 8 2 RAFL05-05-L13 AY034963 Experimental RAFL05-05-L13 AV783119;AV822373;AY034963 eukaryotic release factor 1 homolog (eRF1)
2 4 8 3 RAFL05-05-J23 AY034938 Experimental RAFL05-05-J23 AV783111;AV822367;AY034938 putative thioredoxin
2 4 8 4 RAFL05-05-L07 BT000774 Experimental RAFL05-05-L07 AV783118;AV822372;BT000774
2 4 8 5 RAFL05-10-D13 AY063815 Experimental RAFL05-10-D13 AV783492;AV822674;AY063815 squamosa promoter binding protein-like 7
2 4 8 6 RAFL05-10-A09 AV822659 Experimental RAFL05-10-A09 AV783474;AV822659;AF370151 putative carboxylesterase
2 4 8 7 RAFL05-10-C03 AY035134 Experimental RAFL05-10-C03 AV783480;AV822663;AY035134 putative mitogen-activated protein kinase MMK2
2 4 8 8 RAFL05-10-C13 AY046030 Experimental RAFL05-10-C13 AV783482;AV822665;AY046030 putative cullin-like 1 protein
2 4 8 9 RAFL05-10-H04 AV822690 Experimental RAFL05-10-H04 AV783509;AV822690;AF370326 2-nitropropane dioxygenase-like protein
2 4 8 10 RAFL05-10-A11 AY039954 Experimental RAFL05-10-A11 AV822660;AY039954 putative cyclic nucleotide and calmodulin-regulated ion channel protein
2 4 8 11 RAFL05-10-C17 AY040016 Experimental RAFL05-10-C17 AV783483;AV822666;AY040016 bifunctional nuclease bfn1 like protein
2 4 8 12 RAFL05-10-D05 AV822670 Experimental RAFL05-10-D05 AV783488;AV822670;AF370148 unknown protein
2 4 8 13 RAFL05-10-C05 AY045931 Experimental RAFL05-10-C05 AV783481;AV822664;AY045931 putative protein
2 4 8 14 RAFL05-10-C19 AV822667 Experimental RAFL05-10-C19 AV783484;AV822667;AF370342 unknown protein
2 4 9 1 RAFL05-10-K19 AY042892 Experimental RAFL05-10-K19 AV783529;AV822710;AY042892 inner mitochondrial membrane protein
2 4 9 2 RAFL05-10-N11 AY128311 Experimental RAFL05-10-N11 AV783546;AV822724;AY128311 unknown protein
2 4 9 3 RAFL05-10-J22 AY042891 Experimental RAFL05-10-J22 AV822706;AY042891 gibberellin oxidase-like protein
2 4 9 4 RAFL05-10-O13 AV822731 Experimental RAFL05-10-O13 AV783555;AV822731 hypothetical protein
2 4 9 5 RAFL05-10-P09 AY054610 Experimental RAFL05-10-P09 AV783559;AV822734;AY054610 putative protein
2 4 9 6 RAFL05-10-K07 BP560857 Experimental RAFL05-10-K07 BP560857;AY054608 transcription initiation factor TFIID-1 (TATA sequence-binding protein 1)
2 4 9 7 RAFL05-07-A07 AV822397 Experimental RAFL05-07-A07 AV783150;AV822397 putative farnesylated protein
2 4 9 8 RAFL05-05-N16 AY035024 Experimental RAFL05-05-N16 AV783133;AV822383;AY035024 unknown protein
2 4 9 9 RAFL05-07-P19 AV822493 Experimental RAFL05-07-P19 AV783273;AV822493 unknown protein
2 4 9 10 RAFL05-09-B16 AY034964 Experimental RAFL05-09-B16 AV783386;AV822581;AY034964 MYB family like transcription factor
2 4 9 11 RAFL05-09-A05 AY039958 Experimental RAFL05-09-A05 AV783378;AV822574;AY039958 RB-binding protein -like
2 4 9 12 RAFL05-07-L10 AY034905 Experimental RAFL05-07-L10 AV783234;AV822460;AY034905 dynamin like protein 2a (ADL2a)
2 4 9 13 RAFL05-05-M23 AY045935 Experimental RAFL05-05-M23 AV822381;AY045935 dihydrolipoamide S-acetyltransferase
2 4 9 14 RAFL05-05-M22 AY039979 Experimental RAFL05-05-M22 AV783130;AV822380;AY039979 unknown protein
2 4 10 1 RAFL05-12-G18 AV822853 Experimental RAFL05-12-G18 AV783713;AV822853
2 4 10 2 RAFL05-12-B16 BP560892 Experimental RAFL05-12-B16 AV783671;BP560892;AY059803 HSP associated protein like
2 4 10 3 RAFL05-11-O20 AV822810 Experimental RAFL05-11-O20 AV783656;AV822810 neutral invertase, putative
2 4 10 4 RAFL05-12-C20 AY054611 Experimental RAFL05-12-C20 AV783680;AV822826;AY054611 Unknown protein
2 4 10 5 RAFL05-12-O15 AV822895 Experimental RAFL05-12-O15 AV783762;AV822895 biotin carboxyl carrier protein isoform 2 (BCCP2)
2 4 10 6 RAFL05-12-I12 AY054648 Experimental RAFL05-12-I12 AV783724;AV822862;AY054648 periaxin - like protein
2 4 10 7 RAFL05-10-P24 AV822736 Experimental RAFL05-10-P24 AV783563;AV822736 anion channel protein (gb|AAC05742.1)
2 4 10 8 RAFL05-10-L16 AY042858 Experimental RAFL05-10-L16 AV783537;AV822717;AY042858 phosphoglycerate dehydrogenase like protein
2 4 10 9 RAFL05-10-N02 AY128306 Experimental RAFL05-10-N02 AV783543;AV822721;AY128306 putative protein
2 4 10 10 RAFL05-10-N15 AY042898 Experimental RAFL05-10-N15 AV783548;AV822725;AY042898 putative thiamin pyrophosphokinase
2 4 10 11 RAFL05-10-O05 AY042897 Experimental RAFL05-10-O05 AV822730;AY042897 2-oxoglutarate dehydrogenase E2 subunit
2 4 10 12 RAFL05-10-M23 AY059814 Experimental RAFL05-10-M23 AV783542;AV822720;AY059814 pectinesterase, putative
2 4 10 13 RAFL05-10-I15 AY062633 Experimental RAFL05-10-I15 AV783516;AV822697;AY062633 unknown protein
2 4 10 14 RAFL05-10-J08 AY092970 Experimental RAFL05-10-J08 AV783520;AV822700;AY092970 predicted GPI-anchored protein
2 4 11 1 RAFL05-16-A20 AY048226 Experimental RAFL05-16-A20 AV823157;AY048226 unknown protein
2 4 11 2 RAFL05-16-F14 AY090254 Experimental RAFL05-16-F14 AV823180;AY090254 cytochrome P450 monooxygenase (CYP71B4)
2 4 11 3 RAFL05-15-L23 AY048217 Experimental RAFL05-15-L23 AV784051;AV823130;AY048217 unknown protein
2 4 11 4 RAFL05-14-J10 AY125498 Experimental RAFL05-14-J10 AV783932;AV823035;AY125498
2 4 11 5 RAFL05-15-E23 AY070489 Experimental RAFL05-15-E23 AV784014;AV823101;AY070489
2 4 11 6 RAFL05-15-F19 AY048231 Experimental RAFL05-15-F19 AV784020;AV823104;AY048231 transcription factor like protein
2 4 11 7 RAFL05-14-J08 AV823034 Experimental RAFL05-14-J08 AV823034 kinesin -like protein
2 4 11 8 RAFL05-15-C12 AY074578 Experimental RAFL05-15-C12 AV783991;AV823081;AY074578 unknown protein
2 4 11 9 RAFL05-14-H02 AY048218 Experimental RAFL05-14-H02 AV783912;AY048218 putative ribosomal protein S16
2 4 11 10 RAFL05-15-M02 AY074576 Experimental RAFL05-15-M02 AV784052;AV823131;AY074576 methyltransferase, putative
2 4 11 11 RAFL05-13-E04 AV822922 Experimental RAFL05-13-E04 AV783799;AV822922;AF386935 ubiquitin conjugating enzyme, putative
2 4 11 12 RAFL05-11-F19 AV822765 Experimental RAFL05-11-F19 AV783597;AV822765;AF386937 unknown protein
2 4 11 13 RAFL05-11-B17 BT001993 Experimental RAFL05-11-B17 AV783574;AV822745;BT001993 putative chalcone synthase
2 4 11 14 RAFL05-11-D15 BP560871 Experimental RAFL05-11-D15 AV783581;BP560871;AY072317 putative mitochondrial carrier protein
2 4 12 1 RAFL05-15-H16 AY048237 Experimental RAFL05-15-H16 AV784029;AV823113;AY048237 imidazoleglycerol-phosphate dehydratase
2 4 12 2 RAFL05-15-L10 AY048232 Experimental RAFL05-15-L10 AV784045;AV823124;AY048232 putative protein
2 4 12 3 RAFL05-15-N03 AY074583 Experimental RAFL05-15-N03 AV784063;AV823141;AY074583 ribosomal - like protein
2 4 12 4 RAFL05-14-O22 AV823068 Experimental RAFL05-14-O22 AV783973;AV823068 polyubiquitin (ubq10)
2 4 12 5 RAFL05-14-P20 AY074577 Experimental RAFL05-14-P20 AV783976;AV823071;AY074577 thaumatin, putative
2 4 12 6 RAFL05-14-M18 BP560940 Experimental RAFL05-14-M18 AV783959;BP560940;AY074575 fumarylacetoacetate hydrolase-like protein
2 4 12 7 RAFL05-15-M03 AY102100 Experimental RAFL05-15-M03 AV784053;AV823132;AY102100 unknown
2 4 12 8 RAFL05-16-B15 AY090257 Experimental RAFL05-16-B15 AV784083;AV823160;AY090257 unknown protein
2 4 12 9 RAFL05-16-E11 BP560964 Experimental RAFL05-16-E11 AV784100;BP560964 amino acid transporter protein-like
2 4 12 10 RAFL05-16-F08 AY048220 Experimental RAFL05-16-F08 AV784106;AV823177;AY048220 photosystem I subunit III precursor, putative
2 4 12 11 RAFL05-16-C04 AY070481 Experimental RAFL05-16-C04 AV784084;AV823161;AY070481
2 4 12 12 RAFL05-15-D21 AY048214 Experimental RAFL05-15-D21 AV784007;AV823095;AY048214 putative citrate synthase
2 4 12 13 RAFL05-15-F12 BP560950 Experimental RAFL05-15-F12 AV784018;BP560950;AY048234 unknown protein
2 4 12 14 RAFL05-15-G06 AY074586 Experimental RAFL05-15-G06 AV784021;AV823105;AY074586 unknown protein
2 4 13 1 RAFL05-18-H01 AY045965 Experimental RAFL05-18-H01 AV784315;AV823363;AY045965 unknown protein
2 4 13 2 RAFL05-18-J24 AV823386 Experimental RAFL05-18-J24 AV784341;AV823386
2 4 13 3 RAFL05-18-H04 AY096649 Experimental RAFL05-18-H04 AV784317;AV823365;AY096649 putative protein
2 4 13 4 RAFL05-19-A10 AY045851 Experimental RAFL05-19-A10 AV784383;AY045851 AX110P like protein
2 4 13 5 RAFL05-18-O21 AY091143 Experimental RAFL05-18-O21 AV784377;AV823417;AY091143 putative lipase
2 4 13 6 RAFL05-18-I18 AY046000 Experimental RAFL05-18-I18 AV784332;AV823378;AY046000 unknown protein
2 4 13 7 RAFL05-18-N12 AY051003 Experimental RAFL05-18-N12 AV784367;AV823408;AY051003 unknown protein
2 4 13 8 RAFL05-18-G04 AY056218 Experimental RAFL05-18-G04 AV784307;AV823357;AY056218
2 4 13 9 RAFL05-18-G10 AV823359 Experimental RAFL05-18-G10 AV784310;AV823359 unknown protein
2 4 13 10 RAFL05-18-O03 AY045847 Experimental RAFL05-18-O03 AV784372;AV823412;AY045847 Dof zinc finger protein
2 4 13 11 RAFL05-18-O22 AY045822 Experimental RAFL05-18-O22 AV784378;AV823418;AY045822
2 4 13 12 RAFL05-18-H16 AY045997 Experimental RAFL05-18-H16 AV784324;AY045997 putative glucosyl transferase
2 4 13 13 RAFL05-18-I07 AY074321 Experimental RAFL05-18-I07 AV784329;AV823375;AY074321 alpha-galactosidase-like protein
2 4 13 14 RAFL05-18-F02 AY074320 Experimental RAFL05-18-F02 AV784303;AV823355;AY074320 putative aminotransferase
2 4 14 1 RAFL06-11-P07 AY092996 Experimental RAFL06-11-P07 AV785123;AV824010;AY092996 transmembrane protein, putative
2 4 14 2 RAFL06-10-A12 BT002417 Experimental RAFL06-10-A12 AV784967;AV823889;BT002417 unknown protein
2 4 14 3 RAFL06-11-F24 AY092991 Experimental RAFL06-11-F24 AV785076;AV823976;AY092991 vegetative storage protein Vsp2
2 4 14 4 RAFL06-10-O15 AV823947 Experimental RAFL06-10-O15 AV785043;AV823947 ribulose bisphosphate carboxylase small chain 2b precursor (RuBisCO small subunit 2b) (sp|P10797)
2 4 14 5 RAFL05-18-P06 AV823420 Experimental RAFL05-18-P06 AV784379;AV823420 DEAD-box protein abstrakt
2 4 14 6 RAFL05-18-D03 AY045856 Experimental RAFL05-18-D03 AV784294;AV823345;AY045856 putative ribosomal protein S9
2 4 14 7 RAFL05-19-B14 AY045831 Experimental RAFL05-19-B14 AV784393;AV823431;AY045831 unknown protein
2 4 14 8 RAFL05-18-M20 AY050769 Experimental RAFL05-18-M20 AV784363;AV823405;AY050769 putative ribosomal protein L28
2 4 14 9 RAFL05-18-H13 AY045966 Experimental RAFL05-18-H13 AV784322;AV823370;AY045966 50S ribosomal protein L29
2 4 14 10 RAFL05-18-K01 AY045943 Experimental RAFL05-18-K01 AV784342;AV823387;AY045943 unknown protein
2 4 14 11 RAFL05-18-L18 AY074345 Experimental RAFL05-18-L18 AV784356;AV823398;AY074345 unknown protein (At1g70330)
2 4 14 12 RAFL05-18-E13 AY045854 Experimental RAFL05-18-E13 AV784300;AV823352;AY045854 N-myristoyltransferase 1 (NMT1)
2 4 14 13 RAFL05-18-K08 AY050789 Experimental RAFL05-18-K08 AV784346;AV823391;AY050789 putative trypsin inhibitor
2 4 14 14 RAFL05-18-K04 AY045795 Experimental RAFL05-18-K04 AV784344;AV823389;AY045795 putative vesicle transport protein
3 1 1 1 RAFL02-07-P21 AV821169 Experimental RAFL02-07-P21 AV781458;AV821169;AF372879
3 1 1 2 RAFL02-08-P16 AY048203 Experimental RAFL02-08-P16 AV781500;AV821188;AY048203 unknown protein
3 1 1 3 RAFL02-08-B13 AV821171 Experimental RAFL02-08-B13 AV781462;AV821171;AF372914 putative protein
3 1 1 4 RAFL02-07-H24 AY037208 Experimental RAFL02-07-H24 AV781445;AY037208 unknown protein
3 1 1 5 RAFL02-08-C20 AV781465 Experimental RAFL02-08-C20 AV781465;AF372904 nitrilase 1 like protein
3 1 1 6 RAFL02-09-B24 AY037195 Experimental RAFL02-09-B24 AV781502;AV821190;AY037195 unknown protein
3 1 1 7 RAFL02-07-E18 AV781441 Experimental RAFL02-07-E18 AV781441;AF372882 unknown protein
3 1 1 8 RAFL02-09-J03 AY037190 Experimental RAFL02-09-J03 AV781516;AV821199;AY037190 unknown protein
3 1 1 9 RAFL02-08-H22 AV821181 Experimental RAFL02-08-H22 AV781482;AV821181;AF372918 putative protein
3 1 1 10 RAFL02-09-O22 AY078974 Experimental RAFL02-09-O22 AV781522;AY078974 unknown protein
3 1 1 11 RAFL02-07-E20 AV821159 Experimental RAFL02-07-E20 AV821159;AF372902 ADP-ribosylation factor-like protein
3 1 1 12 RAFL02-06-N10 AV821154 Experimental RAFL02-06-N10 AV781429;AV821154;AF372894 unknown protein
3 1 1 13 RAFL02-08-M13 AV821186 Experimental RAFL02-08-M13 AV781492;AV821186;AF372880 actin depolymerizing factor 6 (ADF6)
3 1 1 14 RAFL02-09-D18 AV821193 Experimental RAFL02-09-D18 AV821193;AF372875 unknown protein (At1g23490)
3 1 2 1 RAFL04-12-G15 AY046001 Experimental RAFL04-12-G15 AV781963;AV821489;AY046001 putative M-type thioredoxin
3 1 2 2 RAFL04-12-C12 AY091158 Experimental RAFL04-12-C12 AV781942;AV821479;AY091158
3 1 2 3 RAFL04-13-A15 AY096497 Experimental RAFL04-13-A15 AV782019;AV821528;AY096497 Dem -like protein
3 1 2 4 RAFL04-13-N12 AY034928 Experimental RAFL04-13-N12 AV782085;AY034928 porin-like protein
3 1 2 5 RAFL03-01-B10 AY037212 Experimental RAFL03-01-B10 AV821231;AY037212 unknown protein
3 1 2 6 RAFL03-05-E08 AY070476 Experimental RAFL03-05-E08 AV781625;AV821270;AY070476 putative protein
3 1 2 7 RAFL02-09-P08 AV821201 Experimental RAFL02-09-P08 AV781524;AV821201;AF372903 unknown protein
3 1 2 8 RAFL03-06-B14 AV821285 Experimental RAFL03-06-B14 AV781643;AV821285;AF372890 AIG2-like protein
3 1 2 9 RAFL03-05-D06 AV821267 Experimental RAFL03-05-D06 AV781621;AV821267;AF372889 histone deacetylase -like protein
3 1 2 10 RAFL03-02-K10 AY065057 Experimental RAFL03-02-K10 AV781598;AV821251;AY065057 putative auxin-induced protein
3 1 2 11 RAFL03-04-A04 AV821257 Experimental RAFL03-04-A04 AV781608;AV821257;AF372916 unknown protein
3 1 2 12 RAFL03-02-H03 AV821250 Experimental RAFL03-02-H03 AV821250;AF372907 unknown protein
3 1 2 13 RAFL03-05-A01 AY037204 Experimental RAFL03-05-A01 AV781616;AV821262;AY037204 unknown protein
3 1 2 14 RAFL02-09-L17 AY037196 Experimental RAFL02-09-L17 AV781518;AY037196 unknown protein
3 1 3 1 RAFL04-10-M14 AY039953 Experimental RAFL04-10-M14 AV781922;AV821464;AY039953 unknown protein
3 1 3 2 RAFL04-10-J11 AV821453 Experimental RAFL04-10-J11 AV781909;AV821453 putative protein
3 1 3 3 RAFL04-12-M23 BP560592 Experimental RAFL04-12-M23 AV781996;BP560592;AY034997 glycine-rich protein (clone AtGRP8)
3 1 3 4 RAFL04-14-E15 BP560605 Experimental RAFL04-14-E15 AV782124;BP560605;AY034984
3 1 3 5 RAFL04-14-G10 AY045792 Experimental RAFL04-14-G10 AV782130;AV821620;AY045792 unknown protein
3 1 3 6 RAFL04-12-K15 AY034933 Experimental RAFL04-12-K15 AV781985;AV821503;AY034933 adenylate translocator
3 1 3 7 RAFL04-10-P03 AY035109 Experimental RAFL04-10-P03 AV781929;AY035109
3 1 3 8 RAFL04-12-M19 BP560591 Experimental RAFL04-12-M19 AV781994;BP560591;AY090957 putative glutathione S-transferase TSI-1
3 1 3 9 RAFL04-12-M17 AV821508 Experimental RAFL04-12-M17 AV781993;AV821508;AF370272 unknown protein
3 1 3 10 RAFL04-13-P21 AV821597 Experimental RAFL04-13-P21 AV782101;AV821597 unknown protein
3 1 3 11 RAFL04-13-J20 AY046021 Experimental RAFL04-13-J20 AV782064;AV821565;AY046021 putative protein kinase
3 1 3 12 RAFL04-13-P16 AY034930 Experimental RAFL04-13-P16 AV821596;AY034930 carbonate dehydratase - like protein
3 1 3 13 RAFL04-14-G14 AY045927 Experimental RAFL04-14-G14 AV782131;AV821621;AY045927 beta-glucosidase like protein
3 1 3 14 RAFL04-12-K17 AY035092 Experimental RAFL04-12-K17 AV781986;AV821504;AY035092 ERD4 protein (ERD4)
3 1 4 1 RAFL04-17-A02 BT002018 Experimental RAFL04-17-A02 AV782384;AV821830;BT002018 protein kinase, putative
3 1 4 2 RAFL04-16-C20 AV821770 Experimental RAFL04-16-C20 AV782309;AV821770;AF387001 putative fructokinase
3 1 4 3 RAFL04-16-A18 BP560632 Experimental RAFL04-16-A18 AV782301;BP560632;AY072309 putative protein
3 1 4 4 RAFL04-16-N14 AV821820 Experimental RAFL04-16-N14 AV782375;AV821820 small Ras-like GTP-binding nuclear protein
3 1 4 5 RAFL04-16-L05 AY054598 Experimental RAFL04-16-L05 AV782359;AV821809;AY054598 glucosyltransferase like protein
3 1 4 6 RAFL04-16-H01 AY042822 Experimental RAFL04-16-H01 AV782330;AV821790;AY042822 major latex protein, putative
3 1 4 7 RAFL04-15-O15 AV821745 Experimental RAFL04-15-O15 AV782283;AV821745 elongation factor 1-beta, putative
3 1 4 8 RAFL04-16-A16 AV821759 Experimental RAFL04-16-A16 AV782299;AV821759;AF386999 SOS2-like protein kinase PKS6/CBL-interacting protein kinase 9 (CIPK9)
3 1 4 9 RAFL04-13-P13 AY046009 Experimental RAFL04-13-P13 AV782099;AV821594;AY046009 beta-fructosidase like protein
3 1 4 10 RAFL04-13-G09 AY090926 Experimental RAFL04-13-G09 AV782043;AV821548;AY090926
3 1 4 11 RAFL04-10-N15 AV821467 Experimental RAFL04-10-N15 AV781926;AV821467;AF370273 unknown protein
3 1 4 12 RAFL04-10-M11 BP560577 Experimental RAFL04-10-M11 AV781920;BP560577;AY090989
3 1 4 13 RAFL04-12-O23 AY035182 Experimental RAFL04-12-O23 AV782004;AV821516;AY035182 unknown protein
3 1 4 14 RAFL04-14-G15 AY046019 Experimental RAFL04-14-G15 AV782132;AY046019 putative DNA binding protein (tso1)
3 1 5 1 RAFL04-19-H12 AV821989 Experimental RAFL04-19-H12 AV782592;AV821989
3 1 5 2 RAFL04-19-A11 AY042878 Experimental RAFL04-19-A11 AV782552;AV821962;AY042878 transcription factor like protein
3 1 5 3 RAFL04-17-F10 BT002037 Experimental RAFL04-17-F10 AV782427;BP560656;BT002037 putative RNA-binding protein
3 1 5 4 RAFL04-17-H08 BT002034 Experimental RAFL04-17-H08 AV782443;BT002034 unknown protein
3 1 5 5 RAFL04-17-N13 AV821903 Experimental RAFL04-17-N13 AV782487;AV821903;AF387013 unknown protein
3 1 5 6 RAFL04-19-L07 AY042840 Experimental RAFL04-19-L07 AV782618;AV822005;AY042840 phosphoprotein phosphatase 1 catalytic chain
3 1 5 7 RAFL04-17-J05 AY092954 Experimental RAFL04-17-J05 AV782459;AV821884;AY092954 Unknown protein
3 1 5 8 RAFL04-17-H03 AV821871 Experimental RAFL04-17-H03 AV782439;AV821871;AF387011 unknown protein
3 1 5 9 RAFL04-17-F01 AV821857 Experimental RAFL04-17-F01 AV782421;AV821857 low-temperature-induced protein 78 (sp|Q06738)
3 1 5 10 RAFL04-20-C11 AY054600 Experimental RAFL04-20-C11 AV782653;AV822032;AY054600 GPRI1 protein (gpri1)
3 1 5 11 RAFL04-17-D12 AV782406 Experimental RAFL04-17-D12 AV782406
3 1 5 12 RAFL04-19-F02 AY128337 Experimental RAFL04-19-F02 AV782583;AY128337 tubulin beta-9 chain
3 1 5 13 RAFL04-18-H23 BT002020 Experimental RAFL04-18-H23 AV782528;AV821938;BT002020 glyoxalase I, putative
3 1 5 14 RAFL04-17-A20 AY042871 Experimental RAFL04-17-A20 AV782388;AV821834;AY042871 zinc finger like protein
3 1 6 1 RAFL05-03-B15 AV822212 Experimental RAFL05-03-B15 AV782906;AV822212;AF375460
3 1 6 2 RAFL05-02-P09 AV822202 Experimental RAFL05-02-P09 AV782893;AV822202;AF375452 unknown protein
3 1 6 3 RAFL05-01-G23 AY094419 Experimental RAFL05-01-G23 AV782782;AV822122;AY094419 putative protein
3 1 6 4 RAFL05-01-I13 AY037226 Experimental RAFL05-01-I13 AV782787;AV822129;AY037226 unknown protein
3 1 6 5 RAFL05-01-I05 AV822128 Experimental RAFL05-01-I05 AV822128;AF375432 unknown protein
3 1 6 6 RAFL05-01-F21 AY037224 Experimental RAFL05-01-F21 AV782778;AV822119;AY037224 putative 60S ribosomal protein L18
3 1 6 7 RAFL05-01-K24 AV822138 Experimental RAFL05-01-K24 AV782800;AV822138;AF375454 unknown protein
3 1 6 8 RAFL05-01-F18 AV822118 Experimental RAFL05-01-F18 AV822118;AF375451 putative adenosine kinase
3 1 6 9 RAFL05-01-G12 AV822121 Experimental RAFL05-01-G12 AV782781;AV822121;AF375444 putative protein
3 1 6 10 RAFL05-01-B07 AV822104 Experimental RAFL05-01-B07 AV782751;AV822104;AF375436 anthranilate phosphoribosyltransferase-like protein
3 1 6 11 RAFL05-01-I24 AV822131 Experimental RAFL05-01-I24 AV782790;AV822131;AF375426 cytosolic triosephosphatisomerase
3 1 6 12 RAFL05-01-A07 AY037223 Experimental RAFL05-01-A07 AV782747;AV822101;AY037223 unknown protein
3 1 6 13 RAFL04-19-P16 AY092959 Experimental RAFL04-19-P16 AV822018;AY092959 protein kinase 6 - like
3 1 6 14 RAFL04-19-K14 AV782611 Experimental RAFL04-19-K14 AV782611;AF387019 putative MAP kinase (At1g73670)
3 1 7 1 RAFL05-08-P13 AV822568 Experimental RAFL05-08-P13 AV783371;AV822568;AF370338 unknown protein
3 1 7 2 RAFL05-07-H09 AY046013 Experimental RAFL05-07-H09 AV783209;AV822440;AY046013 putative protein
3 1 7 3 RAFL05-02-J02 AY094425 Experimental RAFL05-02-J02 AV782859;AV822179;AY094425 NIFS like protein CpNifsp precursor (NIFS)
3 1 7 4 RAFL05-03-B18 AV822213 Experimental RAFL05-03-B18 AV782908;AV822213;AF375459 unknown protein
3 1 7 5 RAFL05-02-L21 BP560743 Experimental RAFL05-02-L21 AV782871;BP560743;AF375438 mitochondrial ribosomal protein, putative
3 1 7 6 RAFL05-02-P13 AV822204 Experimental RAFL05-02-P13 AV782895;AV822204;AF375437 cdc2-like protein kinase
3 1 7 7 RAFL05-02-M06 AV822187 Experimental RAFL05-02-M06 AV782873;AV822187;AF375427 Lil3 protein
3 1 7 8 RAFL05-02-H02 AY039842 Experimental RAFL05-02-H02 AV782849;AV822171;AY039842 unknown protein
3 1 7 9 RAFL05-03-A22 AY037222 Experimental RAFL05-03-A22 AV782903;AV822211;AY037222 unknown protein
3 1 7 10 RAFL05-02-P22 AV822207 Experimental RAFL05-02-P22 AV782898;AV822207;AF375453 DNA-binding homeotic protein Athb-2
3 1 7 11 RAFL05-03-F16 AY037239 Experimental RAFL05-03-F16 AV782920;AV822220;AY037239 putative protein
3 1 7 12 RAFL05-02-C24 AY037232 Experimental RAFL05-02-C24 AV782831;AV822157;AY037232 CCCH-type zinc finger like protein
3 1 7 13 RAFL05-02-B21 AY039844 Experimental RAFL05-02-B21 AV782828;AV822155;AY039844 cytochrome P450 monooxygenase (CYP91A2)
3 1 7 14 RAFL05-02-E16 AY037217 Experimental RAFL05-02-E16 AV782839;AV822162;AY037217 putative porin
3 1 8 1 RAFL05-05-N22 AY035029 Experimental RAFL05-05-N22 AV783137;AV822386;AY035029 dihydroorotate dehydrogenase like protein
3 1 8 2 RAFL05-08-A06 AY045930 Experimental RAFL05-08-A06 AV783276;AV822496;AY045930 putative protein
3 1 8 3 RAFL05-09-B22 AV822584 Experimental RAFL05-09-B22 AV783390;AV822584;AF370339 putative DNA binding protein
3 1 8 4 RAFL05-08-P17 AV822570 Experimental RAFL05-08-P17 AV783373;AV822570;AF360351 putative cold-acclimation protein
3 1 8 5 RAFL05-08-E02 AY046036 Experimental RAFL05-08-E02 AV822518;AY046036 unknown protein
3 1 8 6 RAFL05-08-C21 AV783294 Experimental RAFL05-08-C21 AV783294;AF370170 putative 50S ribosomal protein L3, 5' partial
3 1 8 7 RAFL05-08-B17 AY035021 Experimental RAFL05-08-B17 AV783285;AV822502;AY035021 putative cytochrome P450 protein
3 1 8 8 RAFL05-09-B20 AY039969 Experimental RAFL05-09-B20 AV783389;AV822583;AY039969 putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase
3 1 8 9 RAFL05-09-B02 AY113848 Experimental RAFL05-09-B02 AV822576;AY113848 tyrosine aminotransferase
3 1 8 10 RAFL05-08-P15 AY034914 Experimental RAFL05-08-P15 AV783372;AV822569;AY034914 unknown protein
3 1 8 11 RAFL05-08-B14 BP560826 Experimental RAFL05-08-B14 AV783284;BP560826;AY045941 putative beta-alanine-pyruvate aminotransferase
3 1 8 12 RAFL05-08-A02 AY045933 Experimental RAFL05-08-A02 AV783274;AV822494;AY045933 putative nitrilase-associated protein
3 1 8 13 RAFL05-07-O19 AY035020 Experimental RAFL05-07-O19 AV783266;AV822487;AY035020 putative non-green plastid inner envelope membrane protein
3 1 8 14 RAFL05-07-N15 AY090961 Experimental RAFL05-07-N15 AV783255;AY090961
3 1 9 7 RAFL05-07-C03 BP560810 Experimental RAFL05-07-C03 AV783164;BP560810;AF370198 SERINE CARBOXYPEPTIDASE II-like protein
3 1 9 8 RAFL05-05-O01 BP560805 Experimental RAFL05-05-O01 AV783138;BP560805;AF370172 putative aquaporin (tonoplast intrinsic protein gamma)
3 1 9 9 RAFL05-09-D14 AY045919 Experimental RAFL05-09-D14 AV783398;AV822593;AY045919 phenylalanine ammonia lyase (PAL1)
3 1 9 10 RAFL05-09-C13 AV783391 Experimental RAFL05-09-C13 AV783391 unknown protein (At4g25360)
3 1 9 11 RAFL05-09-B04 AV822577 Experimental RAFL05-09-B04 AV783380;AV822577;AF370341 TINY-like AP2 domain transcription factor
3 1 9 12 RAFL05-08-P19 BP560842 Experimental RAFL05-08-P19 AV783374;BP560842;AF370322 oxidoreductase, putative
3 1 9 13 RAFL05-07-A18 AV822400 Experimental RAFL05-07-A18 AV783154;AV822400;AF370194 putative WRKY-type DNA-binding protein
3 1 9 14 RAFL05-05-P06 AV822392 Experimental RAFL05-05-P06 AV783144;AV822392;AF370171 arginine/serine-rich splicing factor RSP41 homolog
3 1 13 1 RAFL05-19-E21 AY080763 Experimental RAFL05-19-E21 AV784413;AV823446;AY080763 WD40-repeat like protein
3 1 13 2 RAFL05-19-M17 AY050768 Experimental RAFL05-19-M17 AV823494;AY050768 unknown protein
3 1 13 3 RAFL05-19-F14 AY074352 Experimental RAFL05-19-F14 AV784418;AV823451;AY074352 unknown protein
3 1 13 4 RAFL05-19-G10 AY080870 Experimental RAFL05-19-G10 AV784425;AV823457;AY080870 60S ribosomal protein, putative
3 1 13 5 RAFL05-19-L04 AY045844 Experimental RAFL05-19-L04 AV784461;AV823484;AY045844 Similar to TF-1 apoptosis related protein 19
3 1 13 6 RAFL05-20-D01 AY045815 Experimental RAFL05-20-D01 AV784502;AV823517;AY045815 unknown protein
3 1 13 7 RAFL05-19-G22 BT000788 Experimental RAFL05-19-G22 AV784431;AV823462;BT000788 putative nodulin
3 1 13 8 RAFL05-19-G19 AY050767 Experimental RAFL05-19-G19 AV784430;AV823461;AY050767 unknown protein
3 1 13 9 RAFL05-19-C06 AV823434 Experimental RAFL05-19-C06 AV784397;AV823434 quinone reductase-like protein
3 1 13 10 RAFL05-19-N01 AY063819 Experimental RAFL05-19-N01 AV784478;AV823498;AY063819 homeodomain transcription factor (ATHB-6)
3 1 13 11 RAFL05-19-L23 AY096647 Experimental RAFL05-19-L23 AV784469;AV823490;AY096647 unknown protein
3 1 13 12 RAFL05-19-K20 AY045812 Experimental RAFL05-19-K20 AV784458;AV823482;AY045812 unknown protein, 3' partial
3 1 13 13 RAFL05-19-N16 AY096646 Experimental RAFL05-19-N16 AV784483;AV823503;AY096646 40S ribsomomal protein
3 1 13 14 RAFL05-19-P05 AY051002 Experimental RAFL05-19-P05 AV784492;AY051002 signal recognition particle - like protein
3 1 14 1 RAFL06-11-N06 AV824003 Experimental RAFL06-11-N06 AV785115;AV824003 putative protein
3 1 14 2 RAFL06-11-L14 AY062820 Experimental RAFL06-11-L14 AV785104;AV823997;AY062820 ribosomal protein L36-like
3 1 14 3 RAFL06-11-B13 AV823957 Experimental RAFL06-11-B13 AV785056;AV823957 similar to unknown protein (sp|P72777)
3 1 14 4 RAFL06-10-O06 AV823945 Experimental RAFL06-10-O06 AV785040;AV823945 unknown protein
3 1 14 5 RAFL05-19-G09 AV823456 Experimental RAFL05-19-G09 AV784424;AV823456 putative nucleosome assembly protein
3 1 14 6 RAFL05-19-N03 AV823499 Experimental RAFL05-19-N03 AV784479;AV823499 integral membrane protein, putative
3 1 14 7 RAFL05-20-L01 AY063818 Experimental RAFL05-20-L01 AV784507;AV823521;AY063818
3 1 14 8 RAFL05-19-K21 BP561024 Experimental RAFL05-19-K21 AV784459;BP561024;AY045821 unknown protein
3 1 14 9 RAFL05-19-E09 AY045995 Experimental RAFL05-19-E09 AV784407;AV823441;AY045995 unknown protein
3 1 14 10 RAFL05-19-M03 AY045960 Experimental RAFL05-19-M03 AV784471;AV823492;AY045960 cellulose synthase catalytic subunit (Ath-B)
3 1 14 11 RAFL05-19-M19 AY074367 Experimental RAFL05-19-M19 AV784473;AV823495;AY074367 unknown protein
3 1 14 12 RAFL05-19-M15 AV823493 Experimental RAFL05-19-M15 AV784472;AV823493 Histone deacetylase
3 1 14 13 RAFL05-19-K10 AY045845 Experimental RAFL05-19-K10 AV784455;AV823479;AY045845 unknown protein
3 1 14 14 RAFL05-19-H05 AY045818 Experimental RAFL05-19-H05 AV784434;AV823465;AY045818 60S ribosomal protein L34, putative
3 2 1 1 AtNCED2 AY056789 At4g19170 Experimental AtNCED2 AY056789 At4g19170 neoxanthin cleavage enzyme-like protein
3 2 1 2 AtGolS3 AB062850 Experimental AtGolS3 AB062850 putative galactinol synthase
3 2 1 3 ERD14 D17715 Experimental ERD14 D17715 unknown protein
3 2 1 4 ERD11 D17672 Experimental ERD11 D17672 glutathione S-transferase
3 2 1 5 ERD9 AB039930 Experimental ERD9 AB039930 glutathione S-transferase (GST30b)
3 2 1 6 ERD7 AB039929 Experimental ERD7 AB039929
3 2 1 7 ERD4 AB039928 Experimental ERD4 AB039928 ERD4 protein (ERD4)
3 2 1 8 ERD2 M23105 Experimental ERD2 M23105
3 2 2 1 RAFL04-09-A13 AY039535 Experimental RAFL04-09-A13 AY039535 eukaryotic initiation factor 4, eIF4-like protein
3 2 2 2 RAFL04-09-D07 AV821369 Experimental RAFL04-09-D07 AV781793;AV821369;AF378873 putative protein
3 2 2 3 RAFL03-08-A09 AV781714 Experimental RAFL03-08-A09 AV781714;AF378864 unknown protein
3 2 2 4 RAFL03-07-M19 AV821319 Experimental RAFL03-07-M19 AV781708;AV821319;AF378858 unknown protein
3 2 2 11 RAFL06-82-G15 AY063779 Experimental RAFL06-82-G15 AV789144;AY063779 antifungal protein-like
3 2 2 12 RAFL09-66-C10 AY099668 Experimental RAFL09-66-C10 AV810983;AV830268;AY099668 beta-1,3-glucanase 2 (BG2)
3 2 2 13 AtNCED6 AC013430 At1g78390 Experimental AtNCED6 AC013430 At1g78390 similar to 9-cis-epoxycarotenoid dioxygenase gb|AAF26356.1
3 2 2 14 AtNCED4 AL163818 At3g63520 Experimental AtNCED4 AL163818 At3g63520 neoxanthin cleavage enzyme nc1
3 2 3 1 RAFL04-09-C05 AY039545 Experimental RAFL04-09-C05 AV781783;AV821360;AY039545 unknown protein
3 2 3 2 RAFL04-09-D24 BP560548 Experimental RAFL04-09-D24 AV781798;BP560548;AY039539 putative glyceraldehyde-3-phosphate dehydrogenase (At1g42970)
3 2 3 3 RAFL04-09-L18 BP560560 Experimental RAFL04-09-L18 AV781835;BP560560;AF378882
3 2 3 4 RAFL04-09-M11 AY039531 Experimental RAFL04-09-M11 AV781843;AV821404;AY039531 unknown protein
3 2 3 5 RAFL04-09-C08 AV821361 Experimental RAFL04-09-C08 AV781785;AV821361;AF378867 unknown protein
3 2 3 6 RAFL04-09-M02 AV781840 Experimental RAFL04-09-M02 AV781840;AF378855 putative pollen allergen
3 2 3 7 RAFL04-09-D02 AV821368 Experimental RAFL04-09-D02 AV781792;AV821368;AF378899 rna binding protein - like
3 2 3 8 RAFL04-09-H22 AY075697 Experimental RAFL04-09-H22 AV781815;AV821385;AY075697 cytochrome P450 monooxygenase (CYP83A1)
3 2 3 9 RAFL04-09-N13 AY102098 Experimental RAFL04-09-N13 AV781848;AV821409;AY102098 D-ribulose-5-phosphate like protein
3 2 3 10 RAFL04-09-D09 AY039526 Experimental RAFL04-09-D09 AV781794;AV821370;AY039526 unknown protein
3 2 3 11 RAFL04-09-J06 BP560558 Experimental RAFL04-09-J06 AV781822;BP560558;AY039519 60S ribosomal protein L27A
3 2 3 12 RAFL04-09-M23 AY075694 Experimental RAFL04-09-M23 AY075694
3 2 3 13 RAFL04-09-M24 AV821407 Experimental RAFL04-09-M24 AV781846;AV821407;AF378897 unknown protein
3 2 3 14 RAFL04-09-N17 BP560565 Experimental RAFL04-09-N17 AV781852;BP560565;AY075696 tonneau 1b (TON1b)
3 2 4 1 RAFL04-14-L16 AY046022 Experimental RAFL04-14-L16 AV782154;AV821640;AY046022 unknown protein
3 2 4 2 RAFL04-14-I08 AY034931 Experimental RAFL04-14-I08 AV782139;AV821627;AY034931 unknown protein
3 2 4 3 RAFL04-15-D12 AY035108 Experimental RAFL04-15-D12 AV782204;AV821679;AY035108 putative jasmonate inducible protein (MDC8.9/AT3g16460)
3 2 4 4 RAFL04-15-D03 AY035006 Experimental RAFL04-15-D03 AV782200;AV821676;AY035006 putative leucine aminopeptidase
3 2 4 5 RAFL04-14-I11 AY046002 Experimental RAFL04-14-I11 AV782140;AV821628;AY046002 putative polygalacturonase
3 2 4 6 RAFL04-14-K03 AV821636 Experimental RAFL04-14-K03 AV821636 putative protein
3 2 4 7 RAFL04-15-D15 AV821681 Experimental RAFL04-15-D15 AV782206;AV821681;AF370240 unknown protein
3 2 4 8 RAFL04-15-D09 AV821678 Experimental RAFL04-15-D09 AV782202;AV821678;AF370220 beta-carotene hydroxylase
3 2 4 9 RAFL04-09-K08 AF378901 Experimental RAFL04-09-K08 AF378901 unknown protein
3 2 4 10 RAFL04-09-N03 AV821408 Experimental RAFL04-09-N03 AV781847;AV821408;AF378892 pectinesterase like protein
3 2 4 11 RAFL04-09-J20 AV821391 Experimental RAFL04-09-J20 AV781824;AV821391;AF378884 NaCl-inducible Ca2+-binding protein-like; calmodulin-like
3 2 4 12 RAFL04-09-M12 AV821405 Experimental RAFL04-09-M12 AV781844;AV821405;AF378869 ribosomal protein L14 -like protein
3 2 4 13 RAFL04-09-B07 AV781779 Experimental RAFL04-09-B07 AV781779;AF378860 unknown protein
3 2 4 14 RAFL04-09-I24 AY039512 Experimental RAFL04-09-I24 AV781819;AV821388;AY039512 hypothetical protein
3 2 5 1 RAFL04-09-P08 AY074318 Experimental RAFL04-09-P08 AV821417;AY074318 putative RNA helicase (At1g32490)
3 2 5 2 RAFL04-09-P17 BP560570 Experimental RAFL04-09-P17 BP560570;AY091126
3 2 5 3 RAFL04-15-I08 AY046023 Experimental RAFL04-15-I08 AV782239;AV821707;AY046023 putative serine protease (MSN9.10)
3 2 5 4 RAFL04-15-D02 AY045786 Experimental RAFL04-15-D02 AV782199;AV821675;AY045786 vegetative storage protein-like
3 2 5 5 RAFL04-14-O17 AV821651 Experimental RAFL04-14-O17 AV782170;AV821651;AF370297 putative protein
3 2 5 6 RAFL04-15-F23 AV821697 Experimental RAFL04-15-F23 AV782227;AV821697;AF370288 unknown protein
3 2 5 7 RAFL04-15-J21 BP560625 Experimental RAFL04-15-J21 AV782247;BP560625;AY090956 putative protein
3 2 5 8 RAFL04-15-K17 AY034985 Experimental RAFL04-15-K17 AV782256;AV821721;AY034985 putative protein
3 2 5 9 RAFL04-15-K09 AY035181 Experimental RAFL04-15-K09 AV782252;AV821718;AY035181 hypothetical protein
3 2 5 10 RAFL04-15-B06 AY034934 Experimental RAFL04-15-B06 AV782187;AV821666;AY034934 monodehydroascorbate reductase
3 2 5 11 RAFL04-15-C23 AY080784 Experimental RAFL04-15-C23 AV782196;AV821672;AY080784 unknown protein (At1g75200)
3 2 5 12 RAFL04-15-D19 AV821682 Experimental RAFL04-15-D19 AV782207;AV821682 unknown
3 2 5 13 RAFL04-15-K15 AY035167 Experimental RAFL04-15-K15 AV782255;AV821720;AY035167 unknown protein
3 2 5 14 RAFL04-15-H12 AV821704 Experimental RAFL04-15-H12 AV782234;AV821704 hypothetical protein
3 2 6 1 RAFL04-20-B02 AY042835 Experimental RAFL04-20-B02 AV782644;AV822024;AY042835 putative annexin
3 2 6 2 RAFL04-17-C23 AV821844 Experimental RAFL04-17-C23 AV782402;AV821844 hypothetical protein
3 2 6 3 RAFL04-17-J21 AV821887 Experimental RAFL04-17-J21 AV782464;AV821887 glycine-rich RNA binding protein
3 2 6 4 RAFL04-19-E16 AV821984 Experimental RAFL04-19-E16 AV782581;AV821984 putative protein
3 2 6 5 RAFL04-17-G15 AY128345 Experimental RAFL04-17-G15 AV782436;AV821868;AY128345 chlorophyll a/b-binding protein
3 2 6 6 RAFL04-17-D13 AV821846 Experimental RAFL04-17-D13 AV782407;AV821846 60S ribosomal protein L39
3 2 6 7 RAFL04-17-I21 AY054604 Experimental RAFL04-17-I21 AV782457;AV821882;AY054604 unknown protein
3 2 6 8 RAFL04-17-D17 AY059833 Experimental RAFL04-17-D17 AV782409;AV821848;AY059833
3 2 6 9 RAFL04-19-N11 AV822012 Experimental RAFL04-19-N11 AV782629;AV822012 unknown protein
3 2 6 10 RAFL04-17-G07 AY072311 Experimental RAFL04-17-G07 AV782434;AV821866;AY072311 putative protein
3 2 6 11 RAFL04-18-F22 BP560673 Experimental RAFL04-18-F22 AV782523;BP560673;AY059811 unknown protein
3 2 6 12 RAFL04-18-B19 AV821923 Experimental RAFL04-18-B19 AV782507;AV821923 aldehyde dehydrogenase
3 2 6 13 RAFL04-09-P12 AY034900 Experimental RAFL04-09-P12 AV821418;AY034900 unknown protein
3 2 6 14 RAFL04-09-O22 AY090958 Experimental RAFL04-09-O22 AV781860;AV821415;AY090958
3 2 7 1 RAFL05-04-C19 AY039605 Experimental RAFL05-04-C19 AV822273;AY039605 unknown protein
3 2 7 2 RAFL05-04-A06 AV822261 Experimental RAFL05-04-A06 AV782974;AV822261;AF385688 MAP kinase kinase 2
3 2 7 3 RAFL04-20-B17 AV822028 Experimental RAFL04-20-B17 AV782649;AV822028;AF386987 Unknown protein (K1F13.27)
3 2 7 4 RAFL04-20-A08 BT000440 Experimental RAFL04-20-A08 AV782639;AV822021;BT000440 mRNA capping enzyme - like protein
3 2 7 5 RAFL04-18-L02 AV821943 Experimental RAFL04-18-L02 AV821943 Similar to zinc finger protein
3 2 7 6 RAFL04-19-J21 AY042837 Experimental RAFL04-19-J21 AV782605;AV821997;AY042837 cytochrome P450 90A1 (sp|Q42569)
3 2 7 7 RAFL04-19-G19 AV821987 Experimental RAFL04-19-G19 AV782588;AV821987;AF386985 unknown protein
3 2 7 8 RAFL04-19-L13 AY128348 Experimental RAFL04-19-L13 AV782621;AV822007;AY128348 unknown protein
3 2 7 9 RAFL04-18-N07 BT002029 Experimental RAFL04-18-N07 AV782540;AV821950;BT002029
3 2 7 10 RAFL04-17-E23 AY042841 Experimental RAFL04-17-E23 AV782420;AV821856;AY042841 putative cinnamyl alcohol dehydrogenase 2
3 2 7 11 RAFL04-17-K21 AY092961 Experimental RAFL04-17-K21 AV782471;AV821893;AY092961 steroid sulfotransferase like protein
3 2 7 12 RAFL04-19-G16 AV821986 Experimental RAFL04-19-G16 AV782586;AV821986;AF386973 Unknown protein (At2g46390; F11C10.8)
3 2 7 13 RAFL04-17-H15 BP560660 Experimental RAFL04-17-H15 AV782446;BP560660;AF387014 Unknown protein
3 2 7 14 RAFL04-19-N09 AV822011 Experimental RAFL04-19-N09 AV782628;AV822011 putative pectate lyase
3 2 8 1 RAFL05-04-G22 AY039610 Experimental RAFL05-04-G22 AV783015;AV822292;AY039610 putative beta-fructosidase (At1g62660)
3 2 8 2 RAFL05-05-I22 AV822364 Experimental RAFL05-05-I22 AV783107;AV822364;AF385702
3 2 8 3 RAFL05-04-C24 AV822274 Experimental RAFL05-04-C24 AV782990;AV822274;AF385700 30S ribosomal protein S10, putative
3 2 8 4 RAFL05-04-B19 AV822269 Experimental RAFL05-04-B19 AV782985;AV822269;AF385693 AtKAP alpha
3 2 8 5 RAFL05-05-I21 AY093781 Experimental RAFL05-05-I21 AV783106;AV822363;AY093781
3 2 8 6 RAFL05-05-H09 AY039612 Experimental RAFL05-05-H09 AV783101;AV822360;AY039612
3 2 8 7 RAFL05-04-B18 AY039611 Experimental RAFL05-04-B18 AV782984;AV822268;AY039611
3 2 8 8 RAFL05-03-O15 AV822255 Experimental RAFL05-03-O15 AV782964;AV822255;AF385703 ATGP1
3 2 8 9 RAFL05-03-M03 AV822247 Experimental RAFL05-03-M03 AV822247;AF385701 unknown protein, 5'partial
3 2 8 10 RAFL05-03-I14 AV822233 Experimental RAFL05-03-I14 AV782936;AV822233;AF385687 unknown protein
3 2 8 11 RAFL05-04-O06 AY070726 Experimental RAFL05-04-O06 AV783051;AV822324;AY070726 glycine hydroxymethyltransferase like protein
3 2 8 12 RAFL05-03-I09 BP560757 Experimental RAFL05-03-I09 AV782935;BP560757;AY093779 dehydrin RAB18-like protein (sp|P30185)
3 2 8 13 RAFL05-04-J09 AV822303 Experimental RAFL05-04-J09 AV783026;AV822303;AF385722 ribosomal protein L11-like
3 2 8 14 RAFL05-05-I17 AV822362 Experimental RAFL05-05-I17 AV783105;AV822362;AF385704 G protein alpha subunit 1 (GPA1)
3 2 9 1 RAFL05-07-I06 AV783216 Experimental RAFL05-07-I06 AV783216;AF370191 unknown protein
3 2 9 2 RAFL05-07-F17 AY040012 Experimental RAFL05-07-F17 AV783197;AV822431;AY040012 tubulin alpha-5 chain
3 2 9 3 RAFL05-08-G24 AV822533 Experimental RAFL05-08-G24 AV783323;AV822533 dihydroxyacetone kinase, putative
3 2 9 4 RAFL05-08-F18 AV822526 Experimental RAFL05-08-F18 AV783315;AV822526 unknown protein
3 2 9 5 RAFL05-07-B07 AY046028 Experimental RAFL05-07-B07 AV783160;AV822405;AY046028 putative trehalose-6-phosphate synthase
3 2 9 6 RAFL05-07-A05 AY039956 Experimental RAFL05-07-A05 AV783148;AV822396;AY039956 unknown protein
3 2 9 7 RAFL05-05-J07 AV822365 Experimental RAFL05-05-J07 AV783108;AV822365;AF385744 unknown protein
3 2 9 8 RAFL05-04-D05 AV822276 Experimental RAFL05-04-D05 AV782992;AV822276;AF385733 putative protein
3 2 9 9 RAFL05-04-C03 AY039607 Experimental RAFL05-04-C03 AV782987;AV822271;AY039607 RNA-binding protein cp33 precursor
3 2 9 10 RAFL05-05-A24 AV822336 Experimental RAFL05-05-A24 AV783071;AV822336;AF385713 AP47/50p (gb|AAB88283.1)
3 2 9 11 RAFL05-03-L12 AY039606 Experimental RAFL05-03-L12 AV782946;AV822243;AY039606 cysteine proteinase RD21A
3 2 9 12 RAFL05-04-M06 AV822317 Experimental RAFL05-04-M06 AV822317;AF385689 unknown protein
3 2 9 13 RAFL05-04-N11 AY070727 Experimental RAFL05-04-N11 AV783046;AV822321;AY070727 very-long-chain fatty acid condensing enzyme (CUT1)
3 2 9 14 RAFL05-04-L02 AY070724 Experimental RAFL05-04-L02 AV783034;AV822311;AY070724 unknown protein
3 2 10 1 RAFL05-09-L12 AY034957 Experimental RAFL05-09-L12 AV783445;AY034957 unknown protein
3 2 10 2 RAFL05-09-I21 AY039957 Experimental RAFL05-09-I21 AV783427;AV822621;AY039957 putative protein
3 2 10 3 RAFL05-09-P04 AV822650 Experimental RAFL05-09-P04 AV783464;AV822650;AF370195 1-aminocyclopropane-1-carboxylate oxidase
3 2 10 4 RAFL05-09-M04 AV783448 Experimental RAFL05-09-M04 AV783448 unknown protein
3 2 10 5 RAFL05-09-J23 AV822627 Experimental RAFL05-09-J23 AV783434;AV822627;AF370147 unknown protein
3 2 10 6 RAFL05-09-G20 AY035132 Experimental RAFL05-09-G20 AV822613;AY035132 GTP-binding protein ara-3
3 2 10 7 RAFL05-09-N09 AV822642 Experimental RAFL05-09-N09 AV783454;AV822642;AF370340 putative mitochondrial dicarboxylate carrier protein
3 2 10 8 RAFL05-09-J19 AY034915 Experimental RAFL05-09-J19 AV783433;AV822626;AY034915 unknown protein
3 2 10 9 RAFL05-09-H21 AY039987 Experimental RAFL05-09-H21 AV783421;AV822617;AY039987 putative transcription factor IIA large subunit protein
3 2 10 10 RAFL05-09-P15 AV822655 Experimental RAFL05-09-P15 AV783469;AV822655 putative protein
3 2 10 11 RAFL05-09-K18 AY045918 Experimental RAFL05-09-K18 AV783440;AV822631;AY045918 delta 9 desaturase (ADS2)
3 2 10 12 RAFL05-09-H20 AY045911 Experimental RAFL05-09-H20 AV783420;AV822616;AY045911 copia-like retroelement pol polyprotein
3 2 10 13 RAFL05-09-N22 AY034956 Experimental RAFL05-09-N22 AV783461;AV822648;AY034956 unknown protein
3 2 10 14 RAFL05-09-J08 AV783429 Experimental RAFL05-09-J08 AV783429 senescence-associated protein 5-like protein
3 2 11 1 RAFL05-14-B09 AV822990 Experimental RAFL05-14-B09 AV822990;AF370541 NWMU1 - 2S albumin 1 precursor
3 2 11 2 RAFL05-13-P03 AV822978 Experimental RAFL05-13-P03 AV783861;AV822978 auxin-regulated protein (IAA8)
3 2 11 3 RAFL05-14-B17 AY042853 Experimental RAFL05-14-B17 AV783876;AV822992;AY042853 unknown protein
3 2 11 4 RAFL05-14-A01 AY042852 Experimental RAFL05-14-A01 AV783865;AV822981;AY042852 chaperone GrpE-like protein
3 2 11 5 RAFL05-13-E13 AV822926 Experimental RAFL05-13-E13 AV783803;AV822926 putative protein
3 2 11 6 RAFL05-13-B09 AY042855 Experimental RAFL05-13-B09 AV783785;AV822914;AY042855 adenosine kinase (MOK16.21)
3 2 11 7 RAFL05-13-F06 AY054672 Experimental RAFL05-13-F06 AV783809;AV822932;AY054672 unknown protein
3 2 11 8 RAFL05-11-F20 AY072324 Experimental RAFL05-11-F20 AV783598;AV822766;AY072324 putative protein
3 2 11 9 RAFL05-11-B19 AV822746 Experimental RAFL05-11-B19 AV783575;AV822746 transcription factor scarecrow-like 14, putative
3 2 11 10 RAFL05-11-O16 AY054670 Experimental RAFL05-11-O16 AV783655;AV822809;AY054670 Lhca2 protein
3 2 11 11 RAFL05-09-P12 AV822654 Experimental RAFL05-09-P12 AV783468;AV822654;AF370199 putative protein
3 2 11 12 RAFL05-09-K14 AY045934 Experimental RAFL05-09-K14 AV783438;AV822630;AY045934 putative Bos beta-mannosidase
3 2 11 13 RAFL05-09-P10 AY039978 Experimental RAFL05-09-P10 AV783467;AV822653;AY039978 unknown protein
3 2 11 14 RAFL05-09-J02 AY045912 Experimental RAFL05-09-J02 AV822622;AY045912 putative protein
3 2 12 1 RAFL05-14-F20 AY072329 Experimental RAFL05-14-F20 AV783901;AV823013;AY072329 putative 4-hydroxyphenylpyruvate dioxygenase (HPD)
3 2 12 2 RAFL05-14-G07 AY054643 Experimental RAFL05-14-G07 AV783905;AV823016;AY054643 OBp32 protein
3 2 12 3 RAFL05-13-O22 AV822977 Experimental RAFL05-13-O22 AV783860;AV822977 WRKY transcription factor 1 splice variant 1 (WRKY1)
3 2 12 4 RAFL05-14-E20 AY059824 Experimental RAFL05-14-E20 AV823006;AY059824 hypothetical protein
3 2 12 5 RAFL05-14-E16 AY054642 Experimental RAFL05-14-E16 AV783893;AV823005;AY054642 similar to glutamate synthase
3 2 12 6 RAFL05-14-C07 BT001988 Experimental RAFL05-14-C07 AV783878;AV822994;BT001988 unknown
3 2 12 7 RAFL05-14-D05 AY092966 Experimental RAFL05-14-D05 AV783885;AV822999;AY092966 putative protein
3 2 12 8 RAFL05-13-O09 AY128325 Experimental RAFL05-13-O09 AV783857;AY128325 putative casein kinase
3 2 12 9 RAFL05-14-G19 AY120716 Experimental RAFL05-14-G19 AV783910;AV823019;AY120716 24-sterol C-methyltransferase
3 2 12 10 RAFL05-14-F03 AY042902 Experimental RAFL05-14-F03 AV783897;AV823009;AY042902 putative alanine aminotransferase
3 2 12 11 RAFL05-14-B21 AY072326 Experimental RAFL05-14-B21 AV783877;AV822993;AY072326 putative peroxidase
3 2 12 12 RAFL05-14-A08 AY081257 Experimental RAFL05-14-A08 AV783867;AV822983;AY081257 glutaredoxin-like protein
3 2 12 13 RAFL05-14-G17 AY059823 Experimental RAFL05-14-G17 AV783908;AV823017;AY059823
3 2 12 14 RAFL05-14-G18 AY081281 Experimental RAFL05-14-G18 AV783909;AV823018;AY081281 unknown protein
3 2 13 1 RAFL05-17-D19 AV823265 Experimental RAFL05-17-D19 AV784198;AV823265 unknown protein (At1g19400)
3 2 13 2 RAFL05-17-C16 AY050317 Experimental RAFL05-17-C16 AV823255;AY050317 salt stress inducible small GTP binding protein Ran1 homolog
3 2 13 3 RAFL05-17-F17 AY095997 Experimental RAFL05-17-F17 AV784210;AV823276;AY095997 hypothetical protein
3 2 13 4 RAFL05-17-O13 AY095992 Experimental RAFL05-17-O13 AV784264;AV823321;AY095992 putative 4-coumarate:CoA ligase 2
3 2 13 5 RAFL05-17-G07 AY050348 Experimental RAFL05-17-G07 AV784215;AV823281;AY050348 transcriptional adaptor like protein
3 2 13 6 RAFL05-17-N02 AY050344 Experimental RAFL05-17-N02 AV784258;AV823317;AY050344 unknown protein
3 2 13 7 RAFL05-17-D01 AY050333 Experimental RAFL05-17-D01 AV784189;AV823256;AY050333 unknown protein
3 2 13 8 RAFL05-18-C05 AY050325 Experimental RAFL05-18-C05 AV823337;AY050325 unknown protein
3 2 13 9 RAFL05-16-J07 AY050368 Experimental RAFL05-16-J07 AV784135;AV823203;AY050368 ubiquitin conjugating enzyme E2 (UBC13)
3 2 13 10 RAFL05-18-C22 AY050356 Experimental RAFL05-18-C22 AV784291;AV823342;AY050356 unknown protein
3 2 13 11 RAFL05-18-C17 AY050353 Experimental RAFL05-18-C17 AV823339;AY050353 RD2 protein (RD2)
3 2 13 12 RAFL05-17-A07 AY050334 Experimental RAFL05-17-A07 AV784178;AV823245;AY050334 actin depolymerizing factor 3 - like protein
3 2 13 13 RAFL05-17-A01 BP560978 Experimental RAFL05-17-A01 AV784175;BP560978;AY050330 unknown protein
3 2 13 14 RAFL05-16-N13 AY050321 Experimental RAFL05-16-N13 AV784163;AV823230;AY050321 unknown protein
3 2 14 1 RAFL05-21-I22 AY045843 Experimental RAFL05-21-I22 AV784593;AV823593;AY045843 unknown protein
3 2 14 2 RAFL05-21-M19 AV823614 Experimental RAFL05-21-M19 AV784619;AV823614 ubiquitin-specific protease (UBP5)
3 2 14 3 RAFL05-21-B10 AY045989 Experimental RAFL05-21-B10 AV784551;AV823556;AY045989 unknown protein
3 2 14 4 RAFL05-21-G04 AY080731 Experimental RAFL05-21-G04 AY080731 unknown protein
3 2 14 5 RAFL05-17-J17 AY095995 Experimental RAFL05-17-J17 AV784236;AV823296;AY095995
3 2 14 6 RAFL05-18-A21 AY050361 Experimental RAFL05-18-A21 AV784281;AV823332;AY050361 arabinogalactan protein AGP7
3 2 14 7 RAFL05-17-B12 AV823249 Experimental RAFL05-17-B12 AV784183;AV823249 putative protein
3 2 14 8 RAFL05-17-A08 BP560979 Experimental RAFL05-17-A08 AV784179;BP560979;AY050343 glutathione transferase, putative
3 2 14 9 RAFL05-18-A10 AY050329 Experimental RAFL05-18-A10 AV784278;AV823331;AY050329 unknown protein
3 2 14 10 RAFL05-16-K19 AY050323 Experimental RAFL05-16-K19 AV784145;AV823213;AY050323 unknown protein
3 2 14 11 RAFL05-18-A07 AY050365 Experimental RAFL05-18-A07 AV784276;AV823329;AY050365 unknown protein
3 2 14 12 RAFL05-16-M15 BP560976 Experimental RAFL05-16-M15 AV784160;BP560976;AY074572 unknown protein
3 2 14 13 RAFL05-17-N23 AY050347 Experimental RAFL05-17-N23 AV784261;AV823319;AY050347 unknown protein
3 2 14 14 RAFL05-17-K21 AY050342 Experimental RAFL05-17-K21 AV784241;AV823302;AY050342 unknown protein
3 3 1 1 RAFL02-09-F04 AY048205 Experimental RAFL02-09-F04 AV781508;AV821196;AY048205 threonyl-tRNA synthetase
3 3 1 2 RAFL02-08-A23 AY037186 Experimental RAFL02-08-A23 AV781460;AV821170;AY037186 putative YABBY3 axial regulator
3 3 1 3 RAFL02-06-M22 AV821153 Experimental RAFL02-06-M22 AV781428;AV821153;AF372917 Lhcb3 chlorophyll a/b binding protein (gb|AAD28773.1)
3 3 1 4 RAFL02-09-B19 AY070477 Experimental RAFL02-09-B19 AV781501;AV821189;AY070477 putative CCAAT-box binding trancription factor
3 3 1 5 RAFL02-07-L08 AY037199 Experimental RAFL02-07-L08 AV781450;AV821164;AY037199 anthocyanin 5-aromatic acyltransferase - like protein
3 3 1 6 RAFL02-08-J17 AV781489 Experimental RAFL02-08-J17 AV781489;AF372895 unknown protein
3 3 1 7 RAFL02-09-D23 AY037192 Experimental RAFL02-09-D23 AV781505;AV821194;AY037192 ribosomal protein S25
3 3 1 8 RAFL02-07-K20 AV821162 Experimental RAFL02-07-K20 AV781448;AV821162;AF372872 vacuolar H+-transporting ATPase 16K chain
3 3 1 9 RAFL02-08-F21 AV821178 Experimental RAFL02-08-F21 AV781476;AV821178;AF372919 unknown protein
3 3 1 10 RAFL02-08-H09 AY037209 Experimental RAFL02-08-H09 AV781481;AV821180;AY037209 unknown protein
3 3 1 11 RAFL02-08-J07 AY037201 Experimental RAFL02-08-J07 AV781486;AV821183;AY037201 unknown protein
3 3 1 12 RAFL02-08-O23 AY037197 Experimental RAFL02-08-O23 AV781498;AV821187;AY037197 unknown protein
3 3 1 13 RAFL02-08-C17 AV821173 Experimental RAFL02-08-C17 AV781464;AV821173;AF372886 photosystem II type I chlorophyll a/b binding protein
3 3 1 14 RAFL02-07-L07 AV821163 Experimental RAFL02-07-L07 AV781449;AV821163;AF372878 unknown protein
3 3 2 1 RAFL04-10-G07 AY035165 Experimental RAFL04-10-G07 AV781897;AV821444;AY035165 unknown protein
3 3 2 2 RAFL04-10-L03 AY039935 Experimental RAFL04-10-L03 AV781914;AV821457;AY039935 putative acyl-CoA synthetase
3 3 2 3 RAFL04-12-C21 AY045790 Experimental RAFL04-12-C21 AV781946;AV821481;AY045790 putative protein
3 3 2 4 RAFL04-12-C19 BP560579 Experimental RAFL04-12-C19 AV781944;BP560579;AY034927 30S ribosomal protein S16
3 3 2 5 RAFL03-06-H04 AY037211 Experimental RAFL03-06-H04 AV781652;AV821291;AY037211 phosphate/triose-phosphate translocator precursor (gb|AAC83815.1)
3 3 2 6 RAFL03-05-B08 AV821266 Experimental RAFL03-05-B08 AV781620;AV821266;AF372905 glutathione S-transferase
3 3 2 7 RAFL03-01-H02 AV821237 Experimental RAFL03-01-H02 AV781578;AV821237;AF372900 hyoscyamine 6-dioxygenase hydroxylase, putative
3 3 2 8 RAFL03-03-A07 AV821252 Experimental RAFL03-03-A07 AV781601;AV821252;AF372898 33 kDa polypeptide of oxygen-evolving complex (OEC) in photosystem II (emb|CAA75629.1)
3 3 2 9 RAFL03-02-H01 AV821249 Experimental RAFL03-02-H01 AV821249;AF372883 unknown protein
3 3 2 10 RAFL03-05-N03 AY037191 Experimental RAFL03-05-N03 AV781636;AV821280;AY037191 unknown protein
3 3 2 11 RAFL02-08-J05 AY037214 Experimental RAFL02-08-J05 AV781485;AV821182;AY037214 s-adenosylmethionine synthetase like protein
3 3 2 12 RAFL02-07-J21 AY037207 Experimental RAFL02-07-J21 AV781446;AV821161;AY037207 unknown protein
3 3 2 13 RAFL02-08-E18 AY037200 Experimental RAFL02-08-E18 AV781473;AV821176;AY037200 monooxygenase 2 (MO2)
3 3 2 14 RAFL02-06-P07 BP560448 Experimental RAFL02-06-P07 AV781434;BP560448;AY078972 putative transport protein
3 3 3 1 RAFL04-12-G12 AY034897 Experimental RAFL04-12-G12 AV781962;AV821488;AY034897 putative fructose bisphosphate aldolase
3 3 3 2 RAFL04-12-E05 AY035094 Experimental RAFL04-12-E05 AV781950;AY035094 putative tetracycline resistance efflux protein
3 3 3 3 RAFL04-13-M06 AY034995 Experimental RAFL04-13-M06 AV782077;AV821575;AY034995 calcium-dependent protein kinase like protein
3 3 3 4 RAFL04-13-O04 BP560601 Experimental RAFL04-13-O04 AV782089;BP560601;AY034983 Asp1 (asp1)
3 3 3 5 RAFL04-13-J03 AY063808 Experimental RAFL04-13-J03 AV782058;AV821560;AY063808 phospholipase - like protein
3 3 3 6 RAFL04-10-J07 AY045785 Experimental RAFL04-10-J07 AV781908;AV821452;AY045785 putative ribose 5-phosphate isomerase
3 3 3 7 RAFL04-12-C05 AV821477 Experimental RAFL04-12-C05 AV781940;AV821477;AF370278 putative protein
3 3 3 8 RAFL04-13-A11 AY035093 Experimental RAFL04-13-A11 AV782015;AV821524;AY035093 tropinone reductase like protein
3 3 3 9 RAFL04-10-O21 AY035166 Experimental RAFL04-10-O21 AV781928;AY035166 FtsH like cell division protein
3 3 3 10 RAFL04-10-H14 BT000681 Experimental RAFL04-10-H14 AV781903;AV821447;BT000681 60S RIBOSOMAL PROTEIN - like
3 3 3 11 RAFL04-10-N10 AV821465 Experimental RAFL04-10-N10 AV781924;AV821465 50S ribosomal protein L3
3 3 3 12 RAFL04-10-H07 AY034929 Experimental RAFL04-10-H07 AV781902;AY034929 scarecrow-like 5 (SCL5)
3 3 3 13 RAFL04-13-L08 AY039950 Experimental RAFL04-13-L08 AV782072;AV821571;AY039950 phospholipase like protein
3 3 3 14 RAFL04-13-G03 AY050979 Experimental RAFL04-13-G03 AV782042;AV821547;AY050979 protease inhibitor II
3 3 4 1 RAFL04-15-L21 AV821728 Experimental RAFL04-15-L21 AV782265;AV821728;AF370549 ribosomal protein
3 3 4 2 RAFL04-16-I22 AV821795 Experimental RAFL04-16-I22 AV782341;AV821795;AF370555 30S ribosomal protein S20
3 3 4 3 RAFL04-16-K10 BT002388 Experimental RAFL04-16-K10 AV782352;AV821806;BT002388 unknown protein
3 3 4 4 RAFL04-16-J07 BT002010 Experimental RAFL04-16-J07 AV782345;AV821799;BT002010 putative protein
3 3 4 5 RAFL04-16-M03 AY092967 Experimental RAFL04-16-M03 AV782367;AV821815;AY092967 unknown protein
3 3 4 6 RAFL04-16-D22 BT002009 Experimental RAFL04-16-D22 AV782314;BP560636;BT002009 unknown protein
3 3 4 7 RAFL04-15-L12 BT002008 Experimental RAFL04-15-L12 AV782261;AV821725;BT002008 anthranilate N-benzoyltransferase
3 3 4 8 RAFL04-16-G14 AY128357 Experimental RAFL04-16-G14 AV821785;AY128357 chlorophyll a oxygenase
3 3 4 9 RAFL04-14-A11 AY034898 Experimental RAFL04-14-A11 AV782104;AV821600;AY034898 unknown protein
3 3 4 10 RAFL04-14-C03 BP560603 Experimental RAFL04-14-C03 AV782111;BP560603;AY035095 unknown protein
3 3 4 11 RAFL04-13-C22 AV821538 Experimental RAFL04-13-C22 AV782031;AV821538 unknown protein
3 3 4 12 RAFL04-13-E17 BP560595 Experimental RAFL04-13-E17 AV782038;BP560595;AY034986 blue copper binding protein (bcb)
3 3 4 13 RAFL04-12-F05 AY039931 Experimental RAFL04-12-F05 AV781953;AY039931 unknown protein
3 3 4 14 RAFL04-13-N06 AV821582 Experimental RAFL04-13-N06 AV782084;AV821582;AF370221 hydroxypyruvate reductase (HPR)
3 3 5 1 RAFL04-18-L08 AY128342 Experimental RAFL04-18-L08 AV782533;AV821945;AY128342 zinc finger protein 3 (gb|AAD27875.1)
3 3 5 2 RAFL04-19-J24 BT002030 Experimental RAFL04-19-J24 AV782607;BT002030 putative RNA helicase
3 3 5 3 RAFL04-19-A22 AY092958 Experimental RAFL04-19-A22 AV782556;AY092958 GTP-binding protein LepA homolog
3 3 5 4 RAFL04-17-O17 AV821911 Experimental RAFL04-17-O17 AV782495;AV821911 CER2
3 3 5 5 RAFL04-20-B08 AY054691 Experimental RAFL04-20-B08 AV782646;AV822026;AY054691 1-aminocyclopropane-1-carboxylate synthase, putative
3 3 5 6 RAFL04-20-C04 AV822030 Experimental RAFL04-20-C04 AV782651;AV822030;AF386963
3 3 5 7 RAFL04-17-M23 BP560667 Experimental RAFL04-17-M23 AV782482;BP560667;AY042880 unknown protein
3 3 5 8 RAFL04-17-N21 AY128339 Experimental RAFL04-17-N21 AV782490;AV821906;AY128339 putative protein
3 3 5 9 RAFL04-17-N17 AV821905 Experimental RAFL04-17-N17 AV782489;AV821905;AF386962 Unknown protein
3 3 5 10 RAFL04-17-K13 AV821891 Experimental RAFL04-17-K13 AV782469;AV821891;AF387004 putative glutathione S-transferase
3 3 5 11 RAFL04-16-K16 AY128336 Experimental RAFL04-16-K16 AV782353;AY128336 unknown protein
3 3 5 12 RAFL04-15-N09 AV821739 Experimental RAFL04-15-N09 AV782275;AV821739;AF386957 Unknown protein (F15I1.26)
3 3 5 13 RAFL04-16-I09 AY128335 Experimental RAFL04-16-I09 AV782336;AY128335 hypothetical protein
3 3 5 14 RAFL04-16-A04 AY042824 Experimental RAFL04-16-A04 AV782295;AV821755;AY042824 S-adenosylmethionine decarboxylase (SAMdC)
3 3 6 1 RAFL05-01-A11 AV822102 Experimental RAFL05-01-A11 AV782748;AV822102;AF375457 unknown protein
3 3 6 2 RAFL05-01-G05 AV822120 Experimental RAFL05-01-G05 AV822120;AF375448 photosystem II reaction center 6.1KD protein
3 3 6 3 RAFL05-01-B21 AY037241 Experimental RAFL05-01-B21 AV782754;AY037241 50S ribosomal protein L12-C
3 3 6 4 RAFL05-01-A17 AY039849 Experimental RAFL05-01-A17 AV782750;AV822103;AY039849 unknown protein; non-consensus donor site at intron 5, (GA) instead of(GT)
3 3 6 5 RAFL05-01-C23 AV822109 Experimental RAFL05-01-C23 AV782762;AV822109;AF375431 uridylate kinase like protein
3 3 6 6 RAFL05-01-K10 AY037221 Experimental RAFL05-01-K10 AV782797;AV822136;AY037221 unknown protein
3 3 6 7 RAFL05-01-N02 AV822144 Experimental RAFL05-01-N02 AV782809;AV822144;AF375455 20S proteasome subunit C8 (PAG1/PRC8_ARATH)
3 3 6 8 RAFL05-01-C14 AV822107 Experimental RAFL05-01-C14 AV782758;AV822107;AF375447 20S proteasome subunit PAF1 (gb|AAC32062.1)
3 3 6 9 RAFL05-01-C10 AY037237 Experimental RAFL05-01-C10 AV782756;AV822106;AY037237 protein kinase like protein
3 3 6 10 RAFL05-01-F04 BP560717 Experimental RAFL05-01-F04 AV782774;BP560717;AY039848 unknown protein
3 3 6 11 RAFL05-01-H22 AV822126 Experimental RAFL05-01-H22 AV822126;AF375429 unknown protein
3 3 6 12 RAFL05-01-C12 AY037225 Experimental RAFL05-01-C12 AV782757;AY037225 unknown protein
3 3 6 13 RAFL04-17-L05 AY128343 Experimental RAFL04-17-L05 AV782472;AY128343 aspartate aminotransferase Asp2
3 3 6 14 RAFL04-17-I03 AV821879 Experimental RAFL04-17-I03 AV782451;AV821879 unknown protein
3 3 7 1 RAFL05-05-N17 AY034954 Experimental RAFL05-05-N17 AV783134;AV822384;AY034954 N-hydroxycinnamoyl/benzoyltransferase-like protein
3 3 7 2 RAFL05-09-D08 AY034913 Experimental RAFL05-09-D08 AV822591;AY034913 unknown protein
3 3 7 3 RAFL05-03-A05 AY039853 Experimental RAFL05-03-A05 AV782901;AV822210;AY039853 cold-regulated protein cor15a precursor
3 3 7 4 RAFL05-02-A17 AV822152 Experimental RAFL05-02-A17 AV782823;AV822152;AF375450 glycine hydroxymethyltransferase (EC 2.1.2.1) - like protein
3 3 7 5 RAFL05-02-G09 AY037240 Experimental RAFL05-02-G09 AV782847;AV822168;AY037240 unknown protein
3 3 7 6 RAFL05-03-B22 AY037228 Experimental RAFL05-03-B22 AV822215;AY037228 unknown protein
3 3 7 7 RAFL05-02-L16 AY094423 Experimental RAFL05-02-L16 AV782869;AV822185;AY094423 putative shaggy-like protein kinase dzeta
3 3 7 8 RAFL05-02-G06 AY037218 Experimental RAFL05-02-G06 AV782845;AV822166;AY037218 cellulase homolog OR16pep precursor (pir||S71215)
3 3 7 9 RAFL05-03-B20 AY039855 Experimental RAFL05-03-B20 AV782909;AV822214;AY039855 beta-glucosidase, putative
3 3 7 10 RAFL05-02-A19 BP560730 Experimental RAFL05-02-A19 AV782824;BP560730;AY065043 protein kinase MSK-3 - like
3 3 7 11 RAFL05-02-P23 AV822208 Experimental RAFL05-02-P23 AV782899;AV822208;AF375443
3 3 7 12 RAFL05-02-I10 AY037230 Experimental RAFL05-02-I10 AV782855;AV822176;AY037230 unknown protein
3 3 7 13 RAFL05-02-O23 AY094421 Experimental RAFL05-02-O23 AV782890;AV822199;AY094421 putative protein
3 3 7 14 RAFL05-02-G08 AV822167 Experimental RAFL05-02-G08 AV782846;AV822167;AF375423 putative protein
3 3 8 1 RAFL05-08-K14 AV822545 Experimental RAFL05-08-K14 AV783342;AV822545;AF370357 unknown protein
3 3 8 2 RAFL05-07-F05 AY035131 Experimental RAFL05-07-F05 AV783192;AV822428;AY035131 putative ribosomal protein S4
3 3 8 3 RAFL05-07-D22 AY090960 Experimental RAFL05-07-D22 AV783182;AV822419;AY090960
3 3 8 4 RAFL05-07-C17 AV822413 Experimental RAFL05-07-C17 AV783172;AV822413;AF370320 putative ribosomal protein
3 3 8 5 RAFL05-07-K16 AY039986 Experimental RAFL05-07-K16 AV822455;AY039986 putative beta-expansin/allergen protein
3 3 8 6 RAFL05-08-M01 BP560837 Experimental RAFL05-08-M01 AV783348;BP560837;AF370168 cysteine proteinase inhibitor-like protein
3 3 8 7 RAFL05-07-G14 AV822433 Experimental RAFL05-07-G14 AV783199;AV822433;AF370356 thioredoxin f2 (gb|AAD35004.1)
3 3 8 8 RAFL05-08-H10 AV822536 Experimental RAFL05-08-H10 AV783326;AV822536;AF370352 ribosomal protein
3 3 8 9 RAFL05-07-C15 AY034955 Experimental RAFL05-07-C15 AV783171;AY034955 beta-glucosidase-like protein
3 3 8 10 RAFL05-07-A10 AY046014 Experimental RAFL05-07-A10 AV783152;AV822399;AY046014 unknown protein (At1g71820)
3 3 8 11 RAFL05-07-F01 AY039985 Experimental RAFL05-07-F01 AV783190;AV822427;AY039985 unknown protein
3 3 8 12 RAFL05-07-D20 AY113847 Experimental RAFL05-07-D20 AV783180;AV822418;AY113847 H+-transporting ATP synthase beta chain (mitochondrial) -like protein
3 3 8 13 RAFL05-07-B15 BP560809 Experimental RAFL05-07-B15 AV783162;BP560809;AY035019 unknown protein
3 3 8 14 RAFL05-07-A08 AV822398 Experimental RAFL05-07-A08 AV783151;AV822398;AF370351 aquaporin/MIP - like protein
3 3 9 7 RAFL05-07-K24 AV822456 Experimental RAFL05-07-K24 AV783229;AV822456;AF370196 unknown protein
3 3 9 8 RAFL05-07-J03 BP560818 Experimental RAFL05-07-J03 AV783220;BP560818;AY040014 unknown protein
3 3 9 9 RAFL05-07-H16 AY035022 Experimental RAFL05-07-H16 AV783211;AV822442;AY035022 ribosomal protein S3a homolog
3 3 9 10 RAFL05-07-G16 AV822435 Experimental RAFL05-07-G16 AV783201;AV822435;AF370353 unknown protein
3 3 9 11 RAFL05-08-G06 AV822528 Experimental RAFL05-08-G06 AV783319;AV822528 2-hydroxyphytanoyl-CoA lyase-like protein
3 3 9 12 RAFL05-08-F01 AY034936 Experimental RAFL05-08-F01 AV783311;AV822523;AY034936 protein kinase (AME2/AFC1)
3 3 9 13 RAFL05-08-O13 AY039988 Experimental RAFL05-08-O13 AV783366;AV822565;AY039988 unknown protein
3 3 9 14 RAFL05-07-J01 AV822448 Experimental RAFL05-07-J01 AV783219;AV822448 anthranilate N-hydroxycinnamoyl/benzoyltransferase, putative
3 3 13 1 RAFL05-20-E01 AY045992 Experimental RAFL05-20-E01 AV784503;AV823518;AY045992 beta-1,3-glucanase - like protein
3 3 13 2 RAFL05-19-H19 AY045957 Experimental RAFL05-19-H19 AV784439;AV823469;AY045957 putative protein
3 3 13 3 RAFL05-19-F12 AV823450 Experimental RAFL05-19-F12 AV823450
3 3 13 4 RAFL05-19-D06 BT000683 Experimental RAFL05-19-D06 AV784403;AV823437;BT000683
3 3 13 5 RAFL05-19-M23 BT000706 Experimental RAFL05-19-M23 AV784477;BT000706 unknown protein
3 3 13 6 RAFL05-19-E19 BP561016 Experimental RAFL05-19-E19 AV784411;BP561016;AY045813 putative WRKY-type DNA binding protein
3 3 13 7 RAFL05-19-C14 AY116673 Experimental RAFL05-19-C14 AV784401;AV823436;AY116673 putative polyA-binding protein II
3 3 13 8 RAFL05-19-P09 AY050766 Experimental RAFL05-19-P09 AV784493;AV823510;AY050766
3 3 13 9 RAFL05-19-H20 AY080884 Experimental RAFL05-19-H20 AV784440;AV823470;AY080884 UIP1
3 3 13 10 RAFL05-19-L16 AY080590 Experimental RAFL05-19-L16 AV784465;AV823487;AY080590
3 3 13 11 RAFL05-19-A19 AY045841 Experimental RAFL05-19-A19 AV784387;AV823427;AY045841
3 3 13 12 RAFL05-18-P17 AY113846 Experimental RAFL05-18-P17 AV823422;AY113846 putative MAP kinase
3 3 13 13 RAFL05-18-H12 AY091154 Experimental RAFL05-18-H12 AV784321;AV823369;AY091154 transcription factor like protein
3 3 13 14 RAFL05-18-M05 AY096643 Experimental RAFL05-18-M05 AV784360;AV823403;AY096643 putative dihydrolipoamide succinyltransferase
3 3 14 1 RAFL06-11-K21 AY062843 Experimental RAFL06-11-K21 AV785103;AV823996;AY062843 AP2 domain transcription factor
3 3 14 2 RAFL06-11-J09 AY065152 Experimental RAFL06-11-J09 AV785093;AV823989;AY065152 H-protein promoter binding factor-2a
3 3 14 3 RAFL06-11-F15 AV823972 Experimental RAFL06-11-F15 AV785072;AV823972 ferritin 1 precursor
3 3 14 4 RAFL06-11-B12 AV823956 Experimental RAFL06-11-B12 AV785055;AV823956 putative protein
3 3 14 5 RAFL05-19-G24 AY074369 Experimental RAFL05-19-G24 AV784432;AV823463;AY074369 CONSTANS-like 1
3 3 14 6 RAFL05-19-N19 AY080871 Experimental RAFL05-19-N19 AV784485;AV823505;AY080871 phosphoprotein phosphatase, type 1 catalytic subunit
3 3 14 7 RAFL05-19-P15 AY050792 Experimental RAFL05-19-P15 AV784495;AV823512;AY050792 unknown protein
3 3 14 8 RAFL05-19-C11 BP561013 Experimental RAFL05-19-C11 AV784399;BP561013;AY050787 putative dioxygenase
3 3 14 9 RAFL05-19-I05 AV823472 Experimental RAFL05-19-I05 AV784444;AV823472 NAC domain protein, putative
3 3 14 10 RAFL05-19-F24 AY045958 Experimental RAFL05-19-F24 AV784422;AV823454;AY045958 unknown protein
3 3 14 11 RAFL05-19-N12 AY080886 Experimental RAFL05-19-N12 AV784482;AV823502;AY080886 Unknown protein (At2g06520; T12H3.7)
3 3 14 12 RAFL05-19-F08 AY074343 Experimental RAFL05-19-F08 AV784417;AV823449;AY074343 N-carbamyl-L-amino acid amidohydrolase-like protein
3 3 14 13 RAFL05-19-D24 AY045853 Experimental RAFL05-19-D24 AV784406;AV823439;AY045853 kinase associated protein phosphatase
3 3 14 14 RAFL05-19-L12 AY045816 Experimental RAFL05-19-L12 AV784463;AV823486;AY045816 unknown protein
3 4 1 1 EXGT-A1 D16454 Experimental EXGT-A1 D16454 putative endoxyloglucan glycosyltransferase
3 4 1 2 ADH AY090330 Experimental ADH AY090330 alcohol dehydrogenase
3 4 1 3 RD28 D13254 Experimental RD28 D13254 aquaporin (plasma membrane intrinsic protein 2C)
3 4 1 4 RD22 D01113 Experimental RD22 D01113 dehydration-induced protein RD22
3 4 1 5 RD20 AB039924 Experimental RD20 AB039924 putative calcium-binding EF-hand protein
3 4 1 6 RD17 AB004872 Experimental RD17 AB004872 putative protein
3 4 1 7 Atp5CS D32138 Experimental Atp5CS D32138 delta-1-pyrroline 5-carboxylase synthetase (P5C1)
3 4 1 8 kin1 X51474 Experimental kin1 X51474 cold and ABA inducible protein kin1
3 4 2 1 RAFL03-07-K19 AY039532 Experimental RAFL03-07-K19 AV781699;AV821316;AY039532 GATA transcription factor 4
3 4 2 2 RAFL03-07-C10 AV821307 Experimental RAFL03-07-C10 AV781680;AV821307;AF378872 unknown protein
3 4 2 3 RAFL03-08-H18 AY039522 Experimental RAFL03-08-H18 AV781726;AV821329;AY039522 unknown protein
3 4 2 4 RAFL03-06-N04 AV821300 Experimental RAFL03-06-N04 AV781669;AV821300;AF378859 photosystem I subunit V precursor, putative
3 4 2 11 AtGolS1 AB062848 Experimental AtGolS1 AB062848 putative galactinol synthase
3 4 2 13 RD22-BP1 AB000875 Experimental RD22-BP1 AB000875 putative transcription factor BHLH6
3 4 2 14 DREB-2A AB007790 Experimental DREB-2A AB007790 DREB2A (dbj|BAA33794.1)
3 4 3 1 RAFL04-09-I09 AY039540 Experimental RAFL04-09-I09 AV821386;AY039540 putative 11-zinc finger protein
3 4 3 2 RAFL04-09-L04 AY039538 Experimental RAFL04-09-L04 AV781830;AV821396;AY039538
3 4 3 3 RAFL04-09-H21 AV821384 Experimental RAFL04-09-H21 AV781814;AV821384 unknown protein
3 4 3 4 RAFL04-09-H18 AY075691 Experimental RAFL04-09-H18 AV781813;AV821383;AY075691 putative retroelement pol polyprotein
3 4 3 5 RAFL04-09-N15 AV821410 Experimental RAFL04-09-N15 AV781850;AV821410;AF378868 DEAD BOX RNA helicase RH15
3 4 3 6 RAFL04-09-K06 AY039516 Experimental RAFL04-09-K06 AV781825;AV821392;AY039516 germin-like protein (GLP3b)
3 4 3 7 RAFL04-09-C09 AY039542 Experimental RAFL04-09-C09 AV781786;AV821362;AY039542 transporter-like protein
3 4 3 8 RAFL04-09-L23 AV821401 Experimental RAFL04-09-L23 AV781838;AV821401;AF378890 putative receptor kinase
3 4 3 9 RAFL04-09-J19 AV821390 Experimental RAFL04-09-J19 AV781823;AV821390;AF378880 putative protein (At1g56450)
3 4 3 10 RAFL04-09-D13 AV821371 Experimental RAFL04-09-D13 AV781795;AV821371;AF378874 putative protein
3 4 3 11 RAFL04-09-E04 BP560549 Experimental RAFL04-09-E04 BP560549;AF378861 unknown protein
3 4 3 12 RAFL04-09-I16 AY075693 Experimental RAFL04-09-I16 AV781818;AV821387;AY075693 40S ribosomal protein
3 4 3 13 RAFL03-06-L22 AV821298 Experimental RAFL03-06-L22 AV781665;AV821298;AF378902 putative 60S Ribosomal Protein L10
3 4 3 14 RAFL03-08-L14 AV821334 Experimental RAFL03-08-L14 AV781732;AV821334;AF378891 unknown protein
3 4 4 1 RAFL04-14-K16 BP560609 Experimental RAFL04-14-K16 AV782150;BP560609;AY045791 beta-galactosidase like protein
3 4 4 2 RAFL04-14-O03 AY039926 Experimental RAFL04-14-O03 AV782166;AV821648;AY039926 unknown protein
3 4 4 3 RAFL04-15-B03 BT000796 Experimental RAFL04-15-B03 AV782186;BT000796 H+-transporting ATP synthase beta chain (mitochondrial) -like protein
3 4 4 4 RAFL04-14-M15 AY074319 Experimental RAFL04-14-M15 AV782159;AV821642;AY074319 DNA binding protein ACBF - like
3 4 4 5 RAFL04-15-J22 AY080602 Experimental RAFL04-15-J22 AV782248;AV821714;AY080602 putative peroxidase
3 4 4 6 RAFL04-15-I20 AV821708 Experimental RAFL04-15-I20 AV782240;AV821708;AF370260 protein kinase interactor, putative
3 4 4 7 RAFL04-15-K18 AV821722 Experimental RAFL04-15-K18 AV782257;AV821722;AF370239 pseudogene
3 4 4 8 RAFL04-15-K13 AY045784 Experimental RAFL04-15-K13 AV782253;AV821719;AY045784 ferripyochelin-binding protein-like
3 4 4 9 RAFL04-09-G20 AV821381 Experimental RAFL04-09-G20 AV781811;AV821381;AF378898 putative triosephosphate isomerase
3 4 4 10 RAFL04-09-C16 AY039536 Experimental RAFL04-09-C16 AV781789;AV821365;AY039536 alpha-mannosidase, putative
3 4 4 11 RAFL04-09-A10 AV821352 Experimental RAFL04-09-A10 AV781773;AV821352;AF378877 putative guanylate kinase
3 4 4 12 RAFL04-09-A07 AY075690 Experimental RAFL04-09-A07 AV781772;AV821351;AY075690 receptor protein kinase - like
3 4 4 13 RAFL04-09-A20 AV821354 Experimental RAFL04-09-A20 AV781775;AV821354;AF378863 unknown protein
3 4 4 14 RAFL04-09-E14 AV821376 Experimental RAFL04-09-E14 AV781802;AV821376 unknown protein
3 4 5 1 RAFL04-15-K19 AY034998 Experimental RAFL04-15-K19 AV782258;AV821723;AY034998 putative salt-tolerance zinc finger protein
3 4 5 2 RAFL04-15-F14 AY046024 Experimental RAFL04-15-F14 AV782223;AV821694;AY046024 shaggy-like kinase alpha
3 4 5 3 RAFL04-15-F08 AV821692 Experimental RAFL04-15-F08 AV782220;AV821692 unknown protein
3 4 5 4 RAFL04-15-D04 AY034935 Experimental RAFL04-15-D04 AV782201;AV821677;AY034935 putative endochitinase
3 4 5 5 RAFL04-14-I24 AY039952 Experimental RAFL04-14-I24 AV821632;AY039952 putative protein
3 4 5 6 RAFL04-15-D23 AY039941 Experimental RAFL04-15-D23 AV782208;AY039941 unknown protein
3 4 5 7 RAFL04-14-J04 AY034996 Experimental RAFL04-14-J04 AV782146;AV821633;AY034996 pectinesterase like protein
3 4 5 8 RAFL04-15-D14 AV821680 Experimental RAFL04-15-D14 AV782205;AV821680 H+-transporting ATP synthase beta chain (mitochondrial) -like protein
3 4 5 9 RAFL04-15-A08 AY074317 Experimental RAFL04-15-A08 AV782180;AV821660;AY074317 putative serine carboxypeptidase II
3 4 5 10 RAFL04-14-M16 AY034932 Experimental RAFL04-14-M16 AV782160;AV821643;AY034932 protein kinase
3 4 5 11 RAFL04-14-H04 AY039951 Experimental RAFL04-14-H04 AV782133;AV821622;AY039951 phytochelatin synthase 1 (AtPCS1)
3 4 5 12 RAFL04-15-J15 BT000721 Experimental RAFL04-15-J15 AV782245;AV821712;BT000721 ribulose bisphosphate carboxylase small chain 3b precursor (RuBisCO small subunit 3b) (sp|P10798)
3 4 5 13 RAFL04-15-J05 BP560624 Experimental RAFL04-15-J05 AV782242;BP560624;AY091130 putative protein
3 4 5 14 RAFL04-15-K01 AV821715 Experimental RAFL04-15-K01 AV782249;AV821715;AF370261 putative cinnamyl alcohol dehydrogenase 2
3 4 6 1 RAFL04-19-K06 AY081266 Experimental RAFL04-19-K06 AV782610;AV821999;AY081266 cytochrome P450 CYP86A1
3 4 6 2 RAFL04-17-H07 AY054606 Experimental RAFL04-17-H07 AV782442;AV821874;AY054606 adenylosuccinate synthetase
3 4 6 3 RAFL04-18-H22 AY128344 Experimental RAFL04-18-H22 AV782527;AY128344 chloroplast nucleoid DNA binding protein, putative
3 4 6 4 RAFL04-18-H19 AY062629 Experimental RAFL04-18-H19 AV782526;AV821937;AY062629 unknown protein
3 4 6 5 RAFL04-18-B02 AV821919 Experimental RAFL04-18-B02 AV782503;AV821919 hypothetical protein
3 4 6 6 RAFL04-17-N22 AY054605 Experimental RAFL04-17-N22 AV782491;AV821907;AY054605 putative protein
3 4 6 7 RAFL04-18-N10 AY042830 Experimental RAFL04-18-N10 AV782542;AV821952;AY042830 Putative 40S ribosomal protein S15A
3 4 6 8 RAFL04-18-J01 AV821939 Experimental RAFL04-18-J01 AV821939 hypothetical protein
3 4 6 9 RAFL04-17-M22 AY072312 Experimental RAFL04-17-M22 AV782481;AV821899;AY072312 putative protein
3 4 6 10 RAFL04-17-F21 AV821864 Experimental RAFL04-17-F21 AV782430;AV821864 DNA-binding protein, putative
3 4 6 11 RAFL04-19-I15 AV821995 Experimental RAFL04-19-I15 AV782600;AV821995 photolyase/blue-light receptor (PHR2)
3 4 6 12 RAFL04-17-P12 AY042866 Experimental RAFL04-17-P12 AV782498;AV821914;AY042866 adenosylhomocysteinase
3 4 6 13 RAFL04-14-I19 BP560608 Experimental RAFL04-14-I19 AV782143;BP560608;AY034899 unknown protein
3 4 6 14 RAFL04-14-P08 AY039942 Experimental RAFL04-14-P08 AV782174;AV821655;AY039942 unknown protein
3 4 7 1 RAFL05-04-H19 AV822295 Experimental RAFL05-04-H19 AV783020;AV822295;AF385696
3 4 7 2 RAFL05-05-I13 AV783104 Experimental RAFL05-05-I13 AV783104;AF385690 3-hydroxy-3-methylglutaryl CoA reductase (AA 1-592)
3 4 7 3 RAFL04-17-H13 AY128362 Experimental RAFL04-17-H13 AV782444;AV821875;AY128362 TCP-1 chaperonin-like protein
3 4 7 4 RAFL04-17-C12 AY092955 Experimental RAFL04-17-C12 AV782397;AV821840;AY092955 s-adenosylmethionine synthetase
3 4 7 5 RAFL04-17-P09 BT002033 Experimental RAFL04-17-P09 AV782497;AV821913;BT002033 unknown protein
3 4 7 6 RAFL04-19-E02 AV821981 Experimental RAFL04-19-E02 AV782576;AV821981 cellulose synthase catalytic subunit (RSW1)
3 4 7 7 RAFL04-18-D23 AV821929 Experimental RAFL04-18-D23 AV782515;AV821929;AF386979 Unknown protein (MMM17.15)
3 4 7 8 RAFL04-20-A17 AY042836 Experimental RAFL04-20-A17 AV782642;AV822023;AY042836 Unknown protein
3 4 7 9 RAFL04-19-M06 AV822009 Experimental RAFL04-19-M06 AV782623;AV822009;AF387008 putative indole-3-acetate beta-glucosyltransferase
3 4 7 10 RAFL04-19-C04 BT002022 Experimental RAFL04-19-C04 AV782566;AV821972;BT002022 putative protein
3 4 7 11 RAFL04-19-N01 AY128347 Experimental RAFL04-19-N01 AV782627;AY128347 metal ion transporter
3 4 7 12 RAFL04-18-N22 AY065196 Experimental RAFL04-18-N22 AV782545;AV821955;AY065196 At2g44120/F6E13.25
3 4 7 13 RAFL04-18-H16 AY081268 Experimental RAFL04-18-H16 AV782525;AV821936;AY081268 unknown protein
3 4 7 14 RAFL04-18-B12 BP560669 Experimental RAFL04-18-B12 BP560669;AF386965 putative exonuclease
3 4 8 1 RAFL05-03-M05 BP560760 Experimental RAFL05-03-M05 AV782951;BP560760;AY093778 putative protein
3 4 8 2 RAFL05-04-M01 AV822315 Experimental RAFL05-04-M01 AV783038;AV822315;AF385718 ubiquitin-conjugating enzyme, putative
3 4 8 3 RAFL05-04-L01 AY039603 Experimental RAFL05-04-L01 AV783033;AV822310;AY039603 putative protein
3 4 8 4 RAFL05-03-G07 AV822224 Experimental RAFL05-03-G07 AV782924;AV822224;AF385692 unknown protein
3 4 8 5 RAFL05-04-J11 AV822304 Experimental RAFL05-04-J11 AV783027;AV822304;AF385738 unknown protein (At1g80030)
3 4 8 6 RAFL05-04-I05 BP560778 Experimental RAFL05-04-I05 AV783021;BP560778;AF385727 putative short-chain type dehydrogenase/reductase
3 4 8 7 RAFL05-04-F04 AV822286 Experimental RAFL05-04-F04 AV783007;AV822286;AF385723 unknown protein
3 4 8 8 RAFL05-04-A07 AY070719 Experimental RAFL05-04-A07 AV782975;AV822262;AY070719 unknown protein
3 4 8 9 RAFL05-03-O13 AV822254 Experimental RAFL05-03-O13 AV782963;AV822254;AF385706 putative protein
3 4 8 10 RAFL05-04-P04 AV822330 Experimental RAFL05-04-P04 AV783061;AV822330;AF385691 glutathione S-transferase like protein
3 4 8 11 RAFL05-03-O10 AY070725 Experimental RAFL05-03-O10 AV782962;AV822253;AY070725 sexual differentiation process protein ISP4-like
3 4 8 12 RAFL05-03-N05 AY039613 Experimental RAFL05-03-N05 AV782955;AV822249;AY039613 unknown protein
3 4 8 13 RAFL05-04-O04 BP560783 Experimental RAFL05-04-O04 AV783050;BP560783;AF385725 pseudo-response regulator 2 (APRR2)
3 4 8 14 RAFL05-04-J08 AV822302 Experimental RAFL05-04-J08 AV783025;AV822302;AF385708 putative protein
3 4 9 1 RAFL05-09-F24 AY045940 Experimental RAFL05-09-F24 AV783411;AV822606;AY045940 small zinc finger-like protein TIM9
3 4 9 2 RAFL05-07-P16 AY035034 Experimental RAFL05-07-P16 AV783271;AV822491;AY035034 GTP-binding - like protein
3 4 9 3 RAFL05-09-B12 AY039977 Experimental RAFL05-09-B12 AV783385;AV822580;AY039977 unknown protein
3 4 9 4 RAFL05-09-A02 AY045910 Experimental RAFL05-09-A02 AY045910 phosphatidylserine decarboxylase like protein
3 4 9 5 RAFL05-08-O03 AV822560 Experimental RAFL05-08-O03 AV783360;AV822560;AF370337 small Ras-like GTP-binding protein
3 4 9 6 RAFL05-08-N01 AV822555 Experimental RAFL05-08-N01 AV783355;AV822555;AF370318 unknown protein
3 4 9 7 RAFL05-03-G09 AV822225 Experimental RAFL05-03-G09 AV782925;AV822225;AF385742 putative membrane-associated salt-inducible protein
3 4 9 8 RAFL05-04-G23 AV822293 Experimental RAFL05-04-G23 AV783016;AV822293;AF385730 putative 20S proteasome beta subunit PBC2
3 4 9 9 RAFL05-04-D03 AY126987 Experimental RAFL05-04-D03 AV782991;AV822275;AY126987 cell division protein FtsH
3 4 9 10 RAFL05-04-A18 AV822264 Experimental RAFL05-04-A18 AV782977;AV822264;AF385711 histone H2A-like protein
3 4 9 11 RAFL05-03-O18 AV822256 Experimental RAFL05-03-O18 AV782965;AV822256;AF385695 syntaxin related protein AtVam3p (gb|AAC49823.1)
3 4 9 12 RAFL05-03-M08 BP560761 Experimental RAFL05-03-M08 AV782952;BP560761;AF385686 predicted GPI-anchored protein
3 4 9 13 RAFL05-04-A17 AV822263 Experimental RAFL05-04-A17 AV782976;AV822263;AF385743 transcription factor IRE
3 4 9 14 RAFL05-05-C03 AY039615 Experimental RAFL05-05-C03 AV783077;AV822341;AY039615 unknown protein
3 4 10 1 RAFL05-09-M07 AV822638 Experimental RAFL05-09-M07 AV783449;AV822638 cellulose synthase
3 4 10 2 RAFL05-09-K04 AV822628 Experimental RAFL05-09-K04 AV783435;AV822628;AF370321 unknown protein
3 4 10 3 RAFL05-09-N08 AV822641 Experimental RAFL05-09-N08 AV783453;AV822641;AF370193 cathepsin B-like cysteine protease
3 4 10 4 RAFL05-09-J16 AY040013 Experimental RAFL05-09-J16 AV783432;AV822625;AY040013 spermidine synthase
3 4 10 5 RAFL05-09-P18 AV822656 Experimental RAFL05-09-P18 AV783471;AV822656;AF370146 tubby like protein (Tub family protein)
3 4 10 6 RAFL05-09-J15 AY039970 Experimental RAFL05-09-J15 AV783431;AV822624;AY039970 alanine aminotransferase (ALAAT1)
3 4 10 7 RAFL05-09-G11 AY091132 Experimental RAFL05-09-G11 AV783416;AV822610;AY091132 hypothetical protein
3 4 10 8 RAFL05-09-N03 AY046015 Experimental RAFL05-09-N03 AV783452;AV822640;AY046015 alpha-hydroxynitrile lyase-like protein
3 4 10 9 RAFL05-09-G10 AV822609 Experimental RAFL05-09-G10 AV783415;AV822609;AF370192 unknown protein
3 4 10 10 RAFL05-09-E09 AV822598 Experimental RAFL05-09-E09 AV783402;AV822598;AF370169 protein translocation complex Sec61 gamma chain (pir||T05513)
3 4 10 11 RAFL05-09-D06 AY050857 Experimental RAFL05-09-D06 AV783395;AV822589;AY050857 adenosine nucleotide translocator
3 4 10 12 RAFL05-07-N11 AY035130 Experimental RAFL05-07-N11 AV822476;AY035130 putative alanine aminotransferase
3 4 10 13 RAFL05-07-M04 BP560821 Experimental RAFL05-07-M04 AV783243;BP560821;AY046029 unknown protein
3 4 10 14 RAFL05-07-J20 AV822452 Experimental RAFL05-07-J20 AV783225;AV822452;AF370319 alcohol dehydrogenase like protein
3 4 11 1 RAFL05-13-P13 AY042857 Experimental RAFL05-13-P13 AV783863;AV822979;AY042857 unknown protein
3 4 11 2 RAFL05-13-K24 BT002000 Experimental RAFL05-13-K24 AV783844;AV822964;BT002000 unknown protein
3 4 11 3 RAFL05-13-F21 BT002002 Experimental RAFL05-13-F21 AV783812;AV822936;BT002002 putative protein
3 4 11 4 RAFL05-12-P07 AY072325 Experimental RAFL05-12-P07 AV783767;AV822899;AY072325 UDP glucose:flavonoid 3-o-glucosyltransferase -like protein
3 4 11 5 RAFL05-11-O14 AV822808 Experimental RAFL05-11-O14 AV783654;AV822808;AF386949 Unknown protein (F21O3.19)
3 4 11 6 RAFL05-11-L11 AV822793 Experimental RAFL05-11-L11 AV783636;AV822793;AF370533 ubiquinol--cytochrome-c reductase - like protein
3 4 11 7 RAFL05-11-I09 BP560878 Experimental RAFL05-11-I09 AV783618;BP560878;AY081282 low-temperature-induced 65 kD protein (sp|Q04980)
3 4 11 8 RAFL05-11-C05 AY054640 Experimental RAFL05-11-C05 AV783576;AV822747;AY054640 IAA-amino acid hydrolase (ILR1)
3 4 11 9 RAFL05-12-N10 AY054635 Experimental RAFL05-12-N10 AV783755;AY054635 Unknown protein (At2g37870; T8P21.22)
3 4 11 10 RAFL05-12-B09 AY042844 Experimental RAFL05-12-B09 AV783668;AV822817;AY042844 Unknown protein
3 4 11 11 RAFL05-09-P07 AV822652 Experimental RAFL05-09-P07 AV783466;AV822652;AF370197 putative protein
3 4 11 12 RAFL05-09-L11 AY040015 Experimental RAFL05-09-L11 AV783444;AV822636;AY040015
3 4 11 13 RAFL05-09-I19 AY035023 Experimental RAFL05-09-I19 AV783426;AV822620;AY035023 cytochrome P450 monooxygenase (CYP83B1)
3 4 11 14 RAFL05-09-P06 AY080750 Experimental RAFL05-09-P06 AV783465;AV822651;AY080750 putative protein
3 4 12 1 RAFL05-13-N21 AY054677 Experimental RAFL05-13-N21 AV783854;AV822974;AY054677 Gluthatione reductase, chloroplast precursor
3 4 12 2 RAFL05-14-D24 AV823002 Experimental RAFL05-14-D24 AV783889;AV823002;AF386932 MYB - like protein
3 4 12 3 RAFL05-14-E08 BP560925 Experimental RAFL05-14-E08 AV783890;BP560925;AY081258 unknown protein
3 4 12 4 RAFL05-14-A02 AV822982 Experimental RAFL05-14-A02 AV783866;AV822982 unknown protein
3 4 12 5 RAFL05-13-M10 AV822970 Experimental RAFL05-13-M10 AV822970;AF370537 Unknown protein (MFD22.10)
3 4 12 6 RAFL05-14-A16 AY128326 Experimental RAFL05-14-A16 AV783870;AY128326 unknown protein
3 4 12 7 RAFL05-13-M08 AY054641 Experimental RAFL05-13-M08 AV783849;AV822969;AY054641 putative translation initiation factor
3 4 12 8 RAFL05-14-C11 BT001995 Experimental RAFL05-14-C11 AV783880;AV822996;BT001995 predicted protein
3 4 12 9 RAFL05-14-G01 BP560927 Experimental RAFL05-14-G01 AV783903;BP560927;AF386993 putative ribosomal protein L19
3 4 12 10 RAFL05-13-P07 BP560921 Experimental RAFL05-13-P07 AV783862;BP560921;AY054637 10-formyltetrahydrofolate synthetase
3 4 12 11 RAFL05-14-E09 AV823003 Experimental RAFL05-14-E09 AV783891;AV823003;AF386994 putative protein
3 4 12 12 RAFL05-13-M17 BP560919 Experimental RAFL05-13-M17 AV783851;BP560919;AY065200 40S ribosomal protein S21 homolog
3 4 12 13 RAFL05-14-C18 AY054674 Experimental RAFL05-14-C18 AV783883;AV822998;AY054674 unknown protein
3 4 12 14 RAFL05-14-D04 BP560923 Experimental RAFL05-14-D04 AV783884;BP560923;AY042899 unknown protein
3 4 13 1 RAFL05-16-O07 AY050332 Experimental RAFL05-16-O07 AV784167;AV823234;AY050332 glutathione S-transferase
3 4 13 2 RAFL05-16-J04 BP560972 Experimental RAFL05-16-J04 AV784132;BP560972;AY050318 putative uricase subunit
3 4 13 3 RAFL05-16-K15 AY074573 Experimental RAFL05-16-K15 AV823211;AY074573 unknown protein
3 4 13 4 RAFL05-17-G21 AV823285 Experimental RAFL05-17-G21 AV784219;AV823285 NADP-dependent malate dehydrogenase
3 4 13 5 RAFL05-17-D17 AY074568 Experimental RAFL05-17-D17 AV784196;AV823263;AY074568 putative protein
3 4 13 6 RAFL05-17-D11 AY050338 Experimental RAFL05-17-D11 AV784191;AV823258;AY050338 protein kinase C-receptor/G-protein, putative
3 4 13 7 RAFL05-16-H22 AY095990 Experimental RAFL05-16-H22 AV784124;AV823193;AY095990 unknown protein
3 4 13 8 RAFL05-16-P14 AY050319 Experimental RAFL05-16-P14 AV823238;AY050319 unknown protein
3 4 13 9 RAFL05-16-H07 AY050367 Experimental RAFL05-16-H07 AV784117;AV823189;AY050367 RNA helicase, putative
3 4 13 10 RAFL05-16-M03 AY095991 Experimental RAFL05-16-M03 AV784155;AV823225;AY095991 putative glyceraldehyde-3-phosphate dehydrogenase (At1g42970)
3 4 13 11 RAFL05-17-A17 AY050351 Experimental RAFL05-17-A17 AV784180;AV823247;AY050351 Translocon-associated protein, alpha subunit precursor TRAP complex/Signal sequence receptor alpha subunit (SSR-alpha)
3 4 13 12 RAFL05-17-E13 AY050339 Experimental RAFL05-17-E13 AV784202;AV823268;AY050339 unknown protein
3 4 13 13 RAFL05-17-F02 AV823271 Experimental RAFL05-17-F02 AV784205;AV823271 predicted GPI-anchored protein
3 4 13 14 RAFL05-16-K21 AY074562 Experimental RAFL05-16-K21 AV784146;AV823214;AY074562 unknown protein
3 4 14 1 RAFL05-21-C12 AY045842 Experimental RAFL05-21-C12 AV784557;AV823561;AY045842 unknown protein
3 4 14 2 RAFL05-21-M05 AY045811 Experimental RAFL05-21-M05 AV784615;AV823612;AY045811 putative alpha NAC
3 4 14 3 RAFL05-21-D24 AY045988 Experimental RAFL05-21-D24 AV784567;AV823572;AY045988
3 4 14 4 RAFL05-21-D22 AY056124 Experimental RAFL05-21-D22 AV784565;AV823570;AY056124 50S ribosomal protein L12-A
3 4 14 5 RAFL05-16-I12 AY139759 Experimental RAFL05-16-I12 AV784130;AV823199;AY139759 sphingosine kinase (AtLCBK1)
3 4 14 6 RAFL05-16-M08 AY050354 Experimental RAFL05-16-M08 AV784157;AV823226;AY050354 unknown protein
3 4 14 7 RAFL05-17-E19 AY050346 Experimental RAFL05-17-E19 AV784204;AV823270;AY050346 putative protein
3 4 14 8 RAFL05-17-D16 AV823262 Experimental RAFL05-17-D16 AV784195;AV823262 unknown protein
3 4 14 9 RAFL05-17-M07 AY074563 Experimental RAFL05-17-M07 AV784253;AV823313;AY074563 transfactor like protein
3 4 14 10 RAFL05-17-F03 AY050324 Experimental RAFL05-17-F03 AV784206;AV823272;AY050324 40S ribosomal protein S12
3 4 14 11 RAFL05-17-P11 BP560994 Experimental RAFL05-17-P11 AV784269;BP560994;AY050364 putative ribosomal protein s19 or s24
3 4 14 12 RAFL05-17-E01 AY074571 Experimental RAFL05-17-E01 AV784199;AV823266;AY074571 proline oxidase, mitochondrial precursor (osmotic stress-induced proline dehydrogenase), 5' partial
3 4 14 13 RAFL05-16-P18 AY102104 Experimental RAFL05-16-P18 AV784171;AV823239;AY102104 hypothetical protein
3 4 14 14 RAFL05-16-I11 AY050340 Experimental RAFL05-16-I11 AV784129;AV823198;AY050340 cytochrome c1 precursor
4 1 1 1 RAFL03-07-G20 AY045680 Experimental RAFL03-07-G20 AV821314;AY045680 endosomal like protein
4 1 1 2 RAFL03-08-I16 AY045675 Experimental RAFL03-08-I16 AV821332;AY045675 unknown protein
4 1 1 3 RAFL03-03-J03 AV821255 Experimental RAFL03-03-J03 AV821255;AF380655 putative lectin
4 1 1 4 RAFL03-02-C01 AY045695 Experimental RAFL03-02-C01 AV781586;AV821241;AY045695 anthranilate phosphoribosyltransferase, putative (At1g51570)
4 1 1 5 RAFL03-01-K05 AY045692 Experimental RAFL03-01-K05 AV781582;AV821239;AY045692 unknown protein
4 1 1 6 RAFL03-04-H03 AY045685 Experimental RAFL03-04-H03 AV781612;AV821259;AY045685 putative protein
4 1 1 7 RAFL03-06-G11 AY045677 Experimental RAFL03-06-G11 AV781651;AV821290;AY045677 ClpP protease complex subunit ClpR1
4 1 1 8 RAFL03-05-I07 AY039580 Experimental RAFL03-05-I07 AV781630;AV821275;AY039580 Atpm24.1 glutathione S transferase
4 1 1 9 RAFL03-02-D06 AY075685 Experimental RAFL03-02-D06 AV781590;AV821244;AY075685 mercaptopyruvate sulfurtransferase (Atmst1)
4 1 1 10 RAFL03-01-G10 AY045693 Experimental RAFL03-01-G10 AV781577;AV821236;AY045693 putative protein
4 1 1 11 RAFL03-01-D05 AY049308 Experimental RAFL03-01-D05 AV781573;AV821232;AY049308 putative protein
4 1 1 12 RAFL03-05-P02 AV821283 Experimental RAFL03-05-P02 AV781639;AV821283;AF380646 unknown protein
4 1 1 13 RAFL03-06-H10 AV821294 Experimental RAFL03-06-H10 AV781655;AV821294;AF380637
4 1 1 14 RAFL03-01-D10 AY049307 Experimental RAFL03-01-D10 AV781575;AV821234;AY049307 putative protein
4 1 2 1 RAFL04-13-H17 AY091127 Experimental RAFL04-13-H17 AV782051;AV821556;AY091127 hypothetical protein
4 1 2 2 RAFL04-12-J05 AV821497 Experimental RAFL04-12-J05 AV781975;AV821497;AF370254 unknown protein
4 1 2 3 RAFL04-13-J11 BP560598 Experimental RAFL04-13-J11 BP560598;AY080781 putative thionin (At1g72260)
4 1 2 4 RAFL04-10-I16 AV821449 Experimental RAFL04-10-I16 AV781905;AV821449;AF370216 60S ribosomal protein L37, putative
4 1 2 5 RAFL03-07-B22 AV821306 Experimental RAFL03-07-B22 AV821306;AF380656 steroid 5alpha-reductase-like protein
4 1 2 6 RAFL03-08-G11 AY039597 Experimental RAFL03-08-G11 AV781721;AV821326;AY039597 zinc finger protein ZFP8
4 1 2 7 RAFL03-07-A14 AY039584 Experimental RAFL03-07-A14 AV781674;AV821302;AY039584 unknown protein
4 1 2 8 RAFL03-08-F18 AV821325 Experimental RAFL03-08-F18 AV781720;AV821325;AF380648 unknown protein
4 1 2 9 RAFL03-06-H09 AV821293 Experimental RAFL03-06-H09 AV781654;AV821293;AF380636 ribosomal protein S13
4 1 2 10 RAFL03-09-N15 AY039579 Experimental RAFL03-09-N15 AV781764;AV821347;AY039579 plasma membrane intrinsic protein 2a
4 1 2 11 RAFL03-09-J09 AY045700 Experimental RAFL03-09-J09 AV781753;AV821342;AY045700 conglutin gamma - like protein
4 1 2 12 RAFL03-06-H07 AY039593 Experimental RAFL03-06-H07 AV781653;AV821292;AY039593 ribosomal protein L9, putative
4 1 2 13 RAFL03-07-B15 AY045688 Experimental RAFL03-07-B15 AV781678;AV821305;AY045688 unknown protein
4 1 2 14 RAFL03-08-M12 AV821336 Experimental RAFL03-08-M12 AV781737;AV821336;AF380647 delta subunit of mitochondrial F1-ATPase
4 1 3 1 RAFL04-15-C24 AV821673 Experimental RAFL04-15-C24 AV782197;AV821673 unknown protein
4 1 3 2 RAFL04-15-K08 AV821717 Experimental RAFL04-15-K08 AV782251;AV821717
4 1 3 3 RAFL04-15-I04 AY035161 Experimental RAFL04-15-I04 AV782237;AV821706;AY035161 unknown protein
4 1 3 4 RAFL04-15-A01 AV821658 Experimental RAFL04-15-A01 AV821658;AF370258 developmentally regulated GTP-binding protein
4 1 3 5 RAFL04-14-I05 AY039930 Experimental RAFL04-14-I05 AV782137;AV821625;AY039930
4 1 3 6 RAFL04-14-F12 AV821618 Experimental RAFL04-14-F12 AV782128;AV821618;AF370218
4 1 3 7 RAFL04-13-L02 AY056193 Experimental RAFL04-13-L02 AV782069;AV821569;AY056193 unknown protein
4 1 3 8 RAFL04-10-J05 AV821451 Experimental RAFL04-10-J05 AV781907;AV821451;AF370284 peroxidase ATP8a
4 1 3 9 RAFL04-12-J18 AY091128 Experimental RAFL04-12-J18 AV781979;AV821500;AY091128 putative protein
4 1 3 10 RAFL04-12-G16 AV821490 Experimental RAFL04-12-G16 AV781964;AV821490 putative endochitinase
4 1 3 11 RAFL04-12-H13 AY045789 Experimental RAFL04-12-H13 AV781969;AV821493;AY045789 similar to tyrosyl-tRNA synthetase isolog
4 1 3 12 RAFL04-12-I10 AY034922 Experimental RAFL04-12-I10 AV781974;AY034922 hypothetical protein
4 1 3 13 RAFL04-13-J22 BP560599 Experimental RAFL04-13-J22 AV782065;BP560599;AF370291 unknown protein
4 1 3 14 RAFL04-13-O20 BP560602 Experimental RAFL04-13-O20 AV782097;BP560602;AF370282 rev interacting protein mis3 - like
4 1 4 1 RAFL04-19-O24 AV822016 Experimental RAFL04-19-O24 AV782635;AV822016 ribosomal protein L35 - like
4 1 4 2 RAFL04-19-K22 AV822002 Experimental RAFL04-19-K22 AV782614;AV822002 putative protein
4 1 4 3 RAFL04-19-H22 AV821991 Experimental RAFL04-19-H22 AV782595;AV821991;AF370530 unknown protein
4 1 4 4 RAFL04-19-A20 BT002016 Experimental RAFL04-19-A20 AV782555;AV821964;BT002016 nitrate/chlorate transporter CHL1
4 1 4 5 RAFL04-19-B17 BT000437 Experimental RAFL04-19-B17 AV782564;AV821971;BT000437 predicted GPI-anchored protein
4 1 4 6 RAFL04-17-E16 AY128328 Experimental RAFL04-17-E16 AV782417;AY128328 APETALA2 protein
4 1 4 7 RAFL04-19-B11 AV821967 Experimental RAFL04-19-B11 AV782560;AV821967;AF386955 unknown protein
4 1 4 8 RAFL04-17-I10 AV782452 Experimental RAFL04-17-I10 AV782452;AF386954
4 1 4 9 RAFL04-15-A03 AV821659 Experimental RAFL04-15-A03 AV782178;AV821659;AF370296 similar to SOR1 from the fungus Cercospora nicotianae
4 1 4 10 RAFL04-14-I21 AV782144 Experimental RAFL04-14-I21 AV782144;AF370287 trehalose-6-phosphate synthase
4 1 4 11 RAFL04-15-F24 AV821698 Experimental RAFL04-15-F24 AV782228;AV821698;AF370271 unknown protein
4 1 4 12 RAFL04-14-N06 AY034982 Experimental RAFL04-14-N06 AV782163;AV821646;AY034982 polyadenylation cleavage/specificity factor 100 kDa subunit
4 1 4 13 RAFL04-14-M02 BP560611 Experimental RAFL04-14-M02 AV782155;BP560611;AY091157
4 1 4 14 RAFL04-15-G13 AV821701 Experimental RAFL04-15-G13 AV782231;AV821701;AF370219 Rab-type small GTP-binding protein-like
4 1 5 1 RAFL04-17-G02 AY062628 Experimental RAFL04-17-G02 AV782432;AV821865;AY062628 putative protein
4 1 5 2 RAFL04-18-B15 AV821922 Experimental RAFL04-18-B15 AV782506;AV821922;AF386986 protein disulfide isomerase, putative (At1g35620)
4 1 5 3 RAFL04-18-L10 AV821946 Experimental RAFL04-18-L10 AV782534;AV821946;AF387020 unknown protein
4 1 5 4 RAFL04-18-J05 AV821940 Experimental RAFL04-18-J05 AV782529;AV821940 putative nucleotide-sugar dehydratase
4 1 5 5 RAFL04-17-F09 BT002391 Experimental RAFL04-17-F09 AV782426;AV821862;BT002391 predicted GPI-anchored protein
4 1 5 6 RAFL04-17-J04 AY042881 Experimental RAFL04-17-J04 AV782458;AV821883;AY042881 unknown protein
4 1 5 7 RAFL04-20-B22 BT002027 Experimental RAFL04-20-B22 AV782650;AV822029;BT002027 septum site-determining MinD (dbj|BAA90261.1)
4 1 5 8 RAFL04-18-N14 AV821953 Experimental RAFL04-18-N14 AV782543;AV821953;AF370547 putative protein
4 1 5 9 RAFL04-18-D10 BP560670 Experimental RAFL04-18-D10 AV782510;BP560670;AY054688 NADPH-ferrihemoprotein reductase ATR1
4 1 5 10 RAFL04-18-H05 AV821935 Experimental RAFL04-18-H05 AV782524;AV821935;AF370551 RNA polymerase I, II and III 24.3 kDa subunit
4 1 5 11 RAFL04-17-N08 AY128352 Experimental RAFL04-17-N08 AV782485;AV821900;AY128352 putative RING zinc finger protein
4 1 5 12 RAFL04-17-F06 BT000438 Experimental RAFL04-17-F06 AV782425;AV821861;BT000438 putative acetyl-CoA carboxylase biotin-containing subunit
4 1 5 13 RAFL04-17-H04 AY062626 Experimental RAFL04-17-H04 AV782440;AV821872;AY062626 Unknown protein (At3g20560; K10D20.9)
4 1 5 14 RAFL04-18-N09 AV821951 Experimental RAFL04-18-N09 AV782541;AV821951;AF387003 putative chaperonin
4 1 6 1 RAFL05-04-H07 BP560777 Experimental RAFL05-04-H07 AV783018;BP560777;AY039901 unknown protein
4 1 6 2 RAFL05-05-G16 AY039895 Experimental RAFL05-05-G16 AV783097;AV822356;AY039895 HSP90-like protein
4 1 6 3 RAFL05-04-N20 AV822322 Experimental RAFL05-04-N20 AV783047;AV822322;AF462807 putative tyrosine activation protein
4 1 6 4 RAFL05-04-L08 AY123992 Experimental RAFL05-04-L08 AV783036;AV822313;AY123992
4 1 6 5 RAFL05-04-F15 AY039866 Experimental RAFL05-04-F15 AV783010;AV822288;AY039866 unknown protein
4 1 6 6 RAFL05-04-D08 AY039857 Experimental RAFL05-04-D08 AV782993;AV822277;AY039857 proteasome regulatory subunit, putative
4 1 6 7 RAFL05-02-F20 AY039904 Experimental RAFL05-02-F20 AV782844;AV822165;AY039904 histone H3 (sp|P05203)
4 1 6 8 RAFL05-02-P11 AY039897 Experimental RAFL05-02-P11 AV782894;AV822203;AY039897 putative UDP-glucose glucosyltransferase
4 1 6 9 RAFL05-02-L04 AY039885 Experimental RAFL05-02-L04 AV782867;AV822184;AY039885 unknown protein
4 1 6 10 RAFL05-02-P24 AY039877 Experimental RAFL05-02-P24 AV782900;AV822209;AY039877 unknown protein
4 1 6 11 RAFL05-02-B22 AY094427 Experimental RAFL05-02-B22 AV782829;AV822156;AY094427 unknown protein
4 1 6 12 RAFL05-02-M17 AY039856 Experimental RAFL05-02-M17 AV782877;AV822190;AY039856 unknown protein
4 1 6 13 RAFL04-17-I11 AY092968 Experimental RAFL04-17-I11 AV782453;AV821880;AY092968 putative acetyltransferase
4 1 6 14 RAFL04-17-K04 AY128356 Experimental RAFL04-17-K04 AV782466;AV821889;AY128356 unknown protein
4 1 7 1 RAFL05-08-C05 AY034947 Experimental RAFL05-08-C05 AV783287;AV822504;AY034947 unknown protein
4 1 7 2 RAFL05-08-A10 AY034910 Experimental RAFL05-08-A10 AV783278;AV822497;AY034910 unknown protein
4 1 7 3 RAFL05-05-G24 AY039907 Experimental RAFL05-05-G24 AV783100;AV822359;AY039907 unknown protein
4 1 7 4 RAFL05-05-B18 AV822340 Experimental RAFL05-05-B18 AV783076;AV822340;AF462808 beta-D-glucan exohydrolase-like protein
4 1 7 5 RAFL05-05-A16 AY039887 Experimental RAFL05-05-A16 AV783065;AY039887 cathepsin B-like cysteine proteinase like protein
4 1 7 6 RAFL05-04-N01 AY039874 Experimental RAFL05-04-N01 AV783043;AV822320;AY039874 U1 snRNP 70K protein
4 1 7 7 RAFL05-04-K21 AY039868 Experimental RAFL05-04-K21 AV783031;AV822308;AY039868 RNA-binding protein-like
4 1 7 8 RAFL05-04-E20 AY094434 Experimental RAFL05-04-E20 AV822285;AY094434 putative transitional endoplasmic reticulum ATPase
4 1 7 9 RAFL05-04-K09 AY039898 Experimental RAFL05-04-K09 AV783030;AV822307;AY039898 copper homeostasis factor, putative
4 1 7 10 RAFL05-04-F24 AY037260 Experimental RAFL05-04-F24 AV783013;AV822290;AY037260 unknown protein
4 1 7 11 RAFL05-04-D14 AY039883 Experimental RAFL05-04-D14 AV782996;AY039883 telomere repeat binding factor 2 (TRB2)
4 1 7 12 RAFL05-04-B01 AY039869 Experimental RAFL05-04-B01 AV782981;AV822267;AY039869 unknown protein
4 1 7 13 RAFL05-03-J07 AY037249 Experimental RAFL05-03-J07 AV782938;AV822236;AY037249 putative 60S ribosomal protein L17
4 1 7 14 RAFL05-03-G20 AY039861 Experimental RAFL05-03-G20 AV782926;AV822226;AY039861 unknown protein
4 1 8 1 RAFL05-08-E12 AV822521 Experimental RAFL05-08-E12 AV783307;AV822521;AF370355 protease inhibitor II
4 1 8 2 RAFL05-08-D08 AV822513 Experimental RAFL05-08-D08 AV783298;AV822513;AF370350 unknown protein
4 1 8 3 RAFL05-05-O12 AV822388 Experimental RAFL05-05-O12 AV783140;AV822388;AF370336 unknown protein
4 1 8 4 RAFL05-08-A15 AV822499 Experimental RAFL05-08-A15 AV783280;AV822499;AF370316 unknown protein (At1g44920)
4 1 8 5 RAFL05-08-G15 AV822530 Experimental RAFL05-08-G15 AV822530;AF370185 putative clathrin assembly protein
4 1 8 6 RAFL05-08-F12 AY040011 Experimental RAFL05-08-F12 AV783313;AV822525;AY040011 RASBERRY3 (RSY3) like protein
4 1 8 7 RAFL05-08-E11 AV822520 Experimental RAFL05-08-E11 AV783306;AV822520 RIBOSOMAL PROTEIN S30 homolog
4 1 8 8 RAFL05-08-D07 AV822512 Experimental RAFL05-08-D07 AV783297;AV822512 branched chain alpha-keto acid dehydrogenase E2 subunit
4 1 8 9 RAFL05-08-C07 AY034949 Experimental RAFL05-08-C07 AV783288;AV822505;AY034949 unknown protein
4 1 8 10 RAFL05-09-F11 AV822603 Experimental RAFL05-09-F11 AV783408;AV822603;AF370313 unknown protein
4 1 8 11 RAFL05-07-G19 AY045939 Experimental RAFL05-07-G19 AV783202;AV822436;AY045939 protease like protein
4 1 8 12 RAFL05-07-E03 AV822421 Experimental RAFL05-07-E03 AV783184;AV822421;AF370162 kinase like protein
4 1 8 13 RAFL05-08-F07 AY035147 Experimental RAFL05-08-F07 AV783312;AV822524;AY035147 unknown protein
4 1 8 14 RAFL05-07-A20 AY034972 Experimental RAFL05-07-A20 AV783156;AV822402;AY034972 putative topoisomerase
4 1 9 1 RAFL05-13-A11 AY072318 Experimental RAFL05-13-A11 AV783776;AV822908;AY072318 unknown protein
4 1 9 2 RAFL05-13-J07 AY054618 Experimental RAFL05-13-J07 AV783835;AV822955;AY054618 hydroxyproline-rich glycoprotein homolog (Z97337.18)
4 1 9 3 RAFL05-13-J05 AY054617 Experimental RAFL05-13-J05 AV783834;AV822954;AY054617 biotin carboxyl carrier protein of acetyl-CoA carboxylase precursor (BCCP) (sp|Q42533)
4 1 9 4 RAFL05-12-G24 AY065197 Experimental RAFL05-12-G24 AV783715;AV822854;AY065197 RING zinc finger like protein
4 1 9 5 RAFL05-12-I22 BP560900 Experimental RAFL05-12-I22 AV783725;BP560900;AY042847 nitrilase 1
4 1 9 6 RAFL05-11-E13 AY054616 Experimental RAFL05-11-E13 AV783588;AV822757;AY054616 60S ribosomal protein L31
4 1 9 7 RAFL05-07-H01 AY090928 Experimental RAFL05-07-H01 AV783205;AV822438;AY090928
4 1 9 8 RAFL05-07-F16 AV822430 Experimental RAFL05-07-F16 AV783196;AV822430;AF370167 putative RNA-binding protein
4 1 9 9 RAFL05-07-E10 AY039976 Experimental RAFL05-07-E10 AV783186;AV822423;AY039976 chaperonin gamma chain - like protein
4 1 9 10 RAFL05-08-F17 BP560830 Experimental RAFL05-08-F17 AV783314;BP560830 putative glucose regulated repressor protein
4 1 9 11 RAFL05-08-D14 AY034953 Experimental RAFL05-08-D14 AV783299;AV822514;AY034953 putative SET-domain transcriptional regulator
4 1 9 12 RAFL05-08-C09 AY034912 Experimental RAFL05-08-C09 AV783290;AV822506;AY034912 putative RAD23 protein
4 1 9 13 RAFL05-07-E06 AY039984 Experimental RAFL05-07-E06 AV783185;AV822422;AY039984 unknown protein
4 1 9 14 RAFL05-07-D14 AY035033 Experimental RAFL05-07-D14 AV783176;AV822416;AY035033 peroxidase like protein
4 1 10 1 RAFL05-13-D01 AY054624 Experimental RAFL05-13-D01 AV783792;AV822918;AY054624 protein kinase like protein
4 1 10 2 RAFL05-11-N14 AY059820 Experimental RAFL05-11-N14 AV783649;AV822804;AY059820 Myb-related transcription factor-like protein
4 1 10 3 RAFL05-13-F11 AY065093 Experimental RAFL05-13-F11 AV783810;AV822934;AY065093 putative preprotein translocase SECY protein
4 1 10 4 RAFL05-13-A08 AV822906 Experimental RAFL05-13-A08 AV783775;AV822906 basic chitinase, putative
4 1 10 5 RAFL05-13-E03 BP560914 Experimental RAFL05-13-E03 AV783798;BP560914;AY092964 eukaryotic cap-binding protein (gb|AAC17220.1)
4 1 10 6 RAFL05-12-M22 AY128315 Experimental RAFL05-12-M22 AV783752;AV822887;AY128315 unknown protein
4 1 10 7 RAFL05-12-H19 BT001994 Experimental RAFL05-12-H19 AV783720;AV822859;BT001994 protein disulfide isomerase precursor - like
4 1 10 8 RAFL05-12-K17 AY042862 Experimental RAFL05-12-K17 AV783734;AV822870;AY042862 ribosomal protein L17-like protein
4 1 10 9 RAFL05-13-K15 AY059818 Experimental RAFL05-13-K15 AV783841;AV822961;AY059818 putative protein
4 1 10 10 RAFL05-13-K07 AV822959 Experimental RAFL05-13-K07 AV783839;AV822959;AF386941 S18.A ribosomal protein
4 1 10 11 RAFL05-13-A06 AV822905 Experimental RAFL05-13-A06 AV783774;AV822905;AF386942 Avr9 elicitor response protein-like
4 1 10 12 RAFL05-13-C03 BP560910 Experimental RAFL05-13-C03 AV783789;BP560910;AY081273 putative protein
4 1 10 13 RAFL05-12-L24 AY092963 Experimental RAFL05-12-L24 AV783745;AV822881;AY092963 putative glucosyltransferase
4 1 10 14 RAFL05-11-I16 BP560879 Experimental RAFL05-11-I16 AV783620;BP560879;AY120717 putative copper amine oxidase
4 1 11 1 RAFL05-17-M03 AY050393 Experimental RAFL05-17-M03 AV784252;AV823312;AY050393 60S ribosomal protein L31
4 1 11 2 RAFL05-18-A06 AV823328 Experimental RAFL05-18-A06 AV784275;AV823328;AF462838 putative cinnamyl alcohol dehydrogenase
4 1 11 3 RAFL05-16-K16 AY074847 Experimental RAFL05-16-K16 AV784144;AV823212;AY074847 unknown protein
4 1 11 4 RAFL05-17-I24 AV823294 Experimental RAFL05-17-I24 AV784233;AV823294;AF462831 scarecrow-like 6 (SCL6)
4 1 11 5 RAFL05-16-L12 AY091774 Experimental RAFL05-16-L12 AV784150;AV823218;AY091774 putative sucrose transport protein, SUC2
4 1 11 6 RAFL05-16-H09 BP560969 Experimental RAFL05-16-H09 AV784118;BP560969;AY074857 unknown protein
4 1 11 7 RAFL05-16-J05 AY050444 Experimental RAFL05-16-J05 AV784133;AV823201;AY050444
4 1 11 8 RAFL05-16-K01 AY074850 Experimental RAFL05-16-K01 AV784137;AV823205;AY074850
4 1 11 9 RAFL05-15-L02 AY050386 Experimental RAFL05-15-L02 AV784043;AY050386 unknown protein
4 1 11 10 RAFL05-14-G24 AY050435 Experimental RAFL05-14-G24 AV783911;AV823020;AY050435 thioredoxin o (TRXO2)
4 1 11 11 RAFL05-12-O04 AY054657 Experimental RAFL05-12-O04 AV783759;AV822892;AY054657 Unknown protein (At1g16010; T24D18.11)
4 1 11 12 RAFL05-12-M02 BP560903 Experimental RAFL05-12-M02 AV783746;BP560903;AY054656 unknown protein
4 1 11 13 RAFL05-11-O24 AV822813 Experimental RAFL05-11-O24 AV783659;AV822813;AF386929 floral homeotic protein AGL8
4 1 11 14 RAFL05-13-G03 AV822938 Experimental RAFL05-13-G03 AV783815;AV822938 putative ribophorin I
4 1 12 1 RAFL05-16-K10 AY050453 Experimental RAFL05-16-K10 AV784141;AV823209;AY050453 unknown protein
4 1 12 2 RAFL05-17-O20 AY050449 Experimental RAFL05-17-O20 AV784265;AV823322;AY050449 Sodium Bile acid symporter (SBF) like protein
4 1 12 3 RAFL05-17-J18 AY050443 Experimental RAFL05-17-J18 AV784237;AV823297;AY050443
4 1 12 4 RAFL05-17-P08 AY050440 Experimental RAFL05-17-P08 AV784268;AV823325;AY050440 ids-4 protein - like
4 1 12 5 RAFL05-17-F04 AY050439 Experimental RAFL05-17-F04 AV784207;AV823273;AY050439 putative wound induced protein
4 1 12 6 RAFL05-16-O24 AV823236 Experimental RAFL05-16-O24 AV784169;AV823236;AF462834 putative protein
4 1 12 7 RAFL05-18-C06 AY050451 Experimental RAFL05-18-C06 AV784288;AV823338;AY050451 putative amino acid transport protein
4 1 12 8 RAFL05-16-K13 AY050450 Experimental RAFL05-16-K13 AV784143;AV823210;AY050450 putative peptidyl-prolyl cis-trans isomerase
4 1 12 9 RAFL05-17-J22 AY050441 Experimental RAFL05-17-J22 AV784238;AV823298;AY050441 unknown protein
4 1 12 10 RAFL05-17-G20 AY050389 Experimental RAFL05-17-G20 AV784218;AV823284;AY050389 dTDP-glucose 4-6-dehydratase homolog D18
4 1 12 11 RAFL05-17-F18 AY050436 Experimental RAFL05-17-F18 AV784211;AV823277;AY050436 unknown protein
4 1 12 12 RAFL05-17-L14 AV823306 Experimental RAFL05-17-L14 AV784246;AV823306;AF462833 urophorphyrin III methylase (gb|AAB92676.1)
4 1 12 13 RAFL05-17-H16 AV823289 Experimental RAFL05-17-H16 AV784226;AV823289;AF462845 unknown protein
4 1 12 14 RAFL05-18-C18 AY050448 Experimental RAFL05-18-C18 AV784289;AV823340;AY050448 putative ABC transporter
4 1 13 1 RAFL05-20-L13 AY050786 Experimental RAFL05-20-L13 AV823525;AY050786 actin like protein
4 1 13 2 RAFL05-21-K20 AY096642 Experimental RAFL05-21-K20 AV784603;AV823600;AY096642 pseudogene
4 1 13 3 RAFL05-21-F13 AV823578 Experimental RAFL05-21-F13 AV784575;AV823578 putative protein
4 1 13 4 RAFL05-21-G06 AV823580 Experimental RAFL05-21-G06 AV784578;AV823580 plasma membrane proton ATPase (PMA)
4 1 13 5 RAFL05-21-F01 AY045836 Experimental RAFL05-21-F01 AV784572;AV823576;AY045836 unknown protein
4 1 13 6 RAFL05-21-P22 AY045808 Experimental RAFL05-21-P22 AV784641;AV823637;AY045808 Unknown protein (K15C23.2)
4 1 13 7 RAFL05-21-F20 AY045984 Experimental RAFL05-21-F20 AV784576;AV823579;AY045984 unknown protein
4 1 13 8 RAFL05-21-P14 AY059722 Experimental RAFL05-21-P14 AV784635;AV823631;AY059722 unknown protein
4 1 13 9 RAFL05-21-C06 AV823560 Experimental RAFL05-21-C06 AV784556;AV823560 putative tyrosine aminotransferase
4 1 13 10 RAFL05-21-L02 AV823602 Experimental RAFL05-21-L02 AV784607;AV823602 polyubiquitin (ubq3)
4 1 13 11 RAFL05-20-M22 AY059728 Experimental RAFL05-20-M22 AV784520;AV823531;AY059728 putative protein
4 1 13 12 RAFL05-20-L11 AY045882 Experimental RAFL05-20-L11 AV784510;AV823524;AY045882 putative protein
4 1 13 13 RAFL05-19-E04 AV823440 Experimental RAFL05-19-E04 AV823440 putative protein
4 1 13 14 RAFL05-19-F23 AY045952 Experimental RAFL05-19-F23 AV784421;AV823453;AY045952 heme A farnesyltransferase like protein
4 1 14 1 RAFL06-07-P18 AY062790 Experimental RAFL06-07-P18 AV784754;AV823722;AY062790 proteasome component C5
4 1 14 2 RAFL06-09-F12 AY059925 Experimental RAFL06-09-F12 AV784897;AV823832;AY059925 Unknown protein
4 1 14 3 RAFL06-09-D24 AY062788 Experimental RAFL06-09-D24 AV784886;AV823825;AY062788
4 1 14 4 RAFL06-09-B22 AY062787 Experimental RAFL06-09-B22 AV784875;AV823816;AY062787 unknown protein
4 1 14 5 RAFL05-21-I19 AV823592 Experimental RAFL05-21-I19 AV784592;AV823592 fructose 1,6-bisphosphatase, putative
4 1 14 6 RAFL05-21-A12 AV823551 Experimental RAFL05-21-A12 AV823551 unknown protein
4 1 14 7 RAFL05-20-P23 AY045840 Experimental RAFL05-20-P23 AV784540;AV823545;AY045840 putative xyloglucan endo-transglycosylase
4 1 14 8 RAFL05-20-L14 AV823526 Experimental RAFL05-20-L14 AV784511;AV823526 unknown protein
4 1 14 9 RAFL05-21-C22 AY056221 Experimental RAFL05-21-C22 AV784559;AV823563;AY056221 predicted GPI-anchored protein
4 1 14 10 RAFL05-21-E19 AY059723 Experimental RAFL05-21-E19 AY059723 unknown protein
4 1 14 11 RAFL05-21-D15 AY080725 Experimental RAFL05-21-D15 AV784564;AV823568;AY080725 putative protein
4 1 14 12 RAFL05-21-F11 AY074341 Experimental RAFL05-21-F11 AV784574;AV823577;AY074341 unknown protein
4 1 14 13 RAFL05-21-L06 AV823605 Experimental RAFL05-21-L06 AV823605 unknown protein
4 1 14 14 RAFL05-21-L03 AV823603 Experimental RAFL05-21-L03 AV784608;AV823603 unknown protein
4 2 1 1 RAFL02-01-K01 AY039560 Experimental RAFL02-01-K01 AV781346;AV821097;AY039560 superoxide dismutase (EC 1.15.1.1) (Fe)
4 2 1 2 RAFL02-04-I04 AY039557 Experimental RAFL02-04-I04 AV781384;AV821125;AY039557 unknown protein
4 2 1 3 RAFL02-01-D07 AY039574 Experimental RAFL02-01-D07 AV781342;AV821092;AY039574 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative
4 2 1 4 RAFL02-04-I03 AY070466 Experimental RAFL02-04-I03 AV781383;AY070466 26S proteasome AAA-ATPase subunit RPT3 (gb|AAF22523.1)
4 2 1 5 RAFL02-03-C02 AV821113 Experimental RAFL02-03-C02 AV781369;AV821113;AF361856 unknown protein (At1g14290)
4 2 1 6 RAFL02-02-B08 AY039562 Experimental RAFL02-02-B08 AV821104;AY039562 RAD23 like protein
4 2 1 7 RAFL02-05-B05 AV781392 Experimental RAFL02-05-B05 AV781392;AF375404 unknown protein
4 2 1 8 RAFL02-01-C03 AV821091 Experimental RAFL02-01-C03 AV781341;AV821091;AF375397 putative protein
4 2 1 9 RAFL02-10-I13 AV821219 Experimental RAFL02-10-I13 AV781553;AV821219;AF375418 arabinogalactan-protein AGP15
4 2 1 10 RAFL02-06-A08 AY070469 Experimental RAFL02-06-A08 AV781409;AV821139;AY070469 23 kDa polypeptide of oxygen-evolving comlex (OEC)
4 2 1 11 RAFL02-10-J19 AY070461 Experimental RAFL02-10-J19 AV781559;AY070461 unknown protein
4 2 1 12 RAFL02-10-H10 AV781548 Experimental RAFL02-10-H10 AV781548;AF361851 ribosomal S29 -like protein
4 2 1 13 RAFL02-02-A04 AV821100 Experimental RAFL02-02-A04 AV781350;AV821100;AF361847 chlorophyll a/b-binding protein
4 2 1 14 RAFL02-05-J08 AY039558 Experimental RAFL02-05-J08 AV821136;AY039558 unknown protein
4 2 2 1 RAFL04-10-E22 AY080743 Experimental RAFL04-10-E22 AV781888;AY080743 similar to unknown protein (pir||S75584)
4 2 2 2 RAFL04-10-B13 BP560571 Experimental RAFL04-10-B13 BP560571 unknown protein
4 2 2 3 RAFL04-10-F21 AY045788 Experimental RAFL04-10-F21 AV781894;AY045788 unknown protein
4 2 2 4 RAFL04-10-G12 AY034921 Experimental RAFL04-10-G12 AV781899;AV821446;AY034921 protein kinase like protein
4 2 2 5 RAFL02-03-L10 AY039569 Experimental RAFL02-03-L10 AV781378;AV821121;AY039569 hypothetical protein
4 2 2 6 RAFL02-03-B07 BP560430 Experimental RAFL02-03-B07 BP560430;AY070468 SNF1-like protein kinase (AKin11)
4 2 2 7 RAFL02-02-L10 AY039565 Experimental RAFL02-02-L10 AV781366;AV821111;AY039565 putative photosystem I reaction center subunit II precursor
4 2 2 8 RAFL02-06-B15 AF375408 Experimental RAFL02-06-B15 AF375408 unknown protein
4 2 2 9 RAFL02-02-C03 AY039559 Experimental RAFL02-02-C03 AV781356;AV821105;AY039559 unknown protein
4 2 2 10 RAFL02-05-K05 AV821138 Experimental RAFL02-05-K05 AV781407;AV821138;AF361843 40S ribosomal protein S17
4 2 2 11 RAFL02-06-A10 AY039575 Experimental RAFL02-06-A10 AV781410;AV821140;AY039575 unknown protein
4 2 2 12 RAFL02-01-K03 AY070470 Experimental RAFL02-01-K03 AV781347;AV821098;AY070470 S-ribonuclease binding protein SBP1, putative
4 2 2 13 RAFL02-10-G21 AV821215 Experimental RAFL02-10-G21 AV781545;AV821215;AF361855 putative protein
4 2 2 14 RAFL02-10-D09 AV821206 Experimental RAFL02-10-D09 AV781532;AV821206;AF375415 putative RNA-binding protein
4 2 3 1 RAFL04-13-G16 AV821551 Experimental RAFL04-13-G16 AV782046;AV821551;AF370295 unknown protein
4 2 3 2 RAFL04-13-O14 AY035014 Experimental RAFL04-13-O14 AV782094;AV821590;AY035014 unknown protein
4 2 3 3 RAFL04-13-H12 AY035160 Experimental RAFL04-13-H12 AV782050;AV821555;AY035160 VAMP (vesicle-associated membrane protein)-associated protein-like
4 2 3 4 RAFL04-13-A06 AV782013 Experimental RAFL04-13-A06 AV782013;AF370257 ubiquitin-conjugating enzyme E2-17 kD 8 (ubiquitin-protein ligase 8) (ubiquitin carrier protein 8) (sp|P35131)
4 2 3 5 RAFL04-13-I01 AF370237 Experimental RAFL04-13-I01 AF370237 unknown protein
4 2 3 6 RAFL04-12-P22 AY046018 Experimental RAFL04-12-P22 AV782009;AV821520;AY046018
4 2 3 7 RAFL04-13-A03 AY056190 Experimental RAFL04-13-A03 AV782010;AV821522;AY056190 putative protein
4 2 3 8 RAFL04-13-C01 BT006187 Experimental RAFL04-13-C01 AV782024;BT006187 elongation factor, putative
4 2 3 9 RAFL04-14-C18 AV821610 Experimental RAFL04-14-C18 AV782118;AV821610;AF370270 ornithine carbamoyltransferase precursor
4 2 3 10 RAFL04-14-C06 AY034981 Experimental RAFL04-14-C06 AV782112;AY034981
4 2 3 11 RAFL04-13-F21 AY080782 Experimental RAFL04-13-F21 AV782040;AV821545;AY080782 putative protein
4 2 3 12 RAFL04-13-O15 AY056188 Experimental RAFL04-13-O15 AV782095;AV821591;AY056188 unknown protein
4 2 3 13 RAFL04-10-E08 AY046008 Experimental RAFL04-10-E08 AV781885;AV821437;AY046008 splicing factor At-SRp40
4 2 3 14 RAFL04-10-A08 AV821421 Experimental RAFL04-10-A08 AV781864;AV821421 hypothetical protein
4 2 4 1 RAFL04-16-P04 AV821826 Experimental RAFL04-16-P04 AV782380;AV821826 putative protein
4 2 4 2 RAFL04-17-B12 AY072302 Experimental RAFL04-17-B12 AV782391;AY072302 cold-regulated protein COR6.6 (KIN2)
4 2 4 3 RAFL04-15-O08 AY042872 Experimental RAFL04-15-O08 AV782281;AV821743;AY042872 ribosomal protein L32
4 2 4 4 RAFL04-16-M08 AY042831 Experimental RAFL04-16-M08 AV782368;AV821816;AY042831 SigA binding protein
4 2 4 5 RAFL04-16-K06 AY054681 Experimental RAFL04-16-K06 AV782351;AV821805;AY054681 unknown protein
4 2 4 6 RAFL04-16-P22 AY042868 Experimental RAFL04-16-P22 AV782383;AV821829;AY042868 Unknown protein
4 2 4 7 RAFL04-15-L14 AV821727 Experimental RAFL04-15-L14 AV782263;AV821727 putative dehydroquinase shikimate dehydrogenase
4 2 4 8 RAFL04-16-C15 AY054680 Experimental RAFL04-16-C15 AV782307;AV821768;AY054680 unknown protein
4 2 4 9 RAFL04-12-H17 AY039949 Experimental RAFL04-12-H17 AV781970;AY039949 putative dimethyladenosine transferase
4 2 4 10 RAFL04-13-M21 AV821579 Experimental RAFL04-13-M21 AV782081;AV821579
4 2 4 11 RAFL04-13-H20 AY035164 Experimental RAFL04-13-H20 AV782053;AY035164 glucosyltransferase like protein
4 2 4 12 RAFL04-13-J16 AV821564 Experimental RAFL04-13-J16 AV782063;AV821564;AF370259 unknown protein
4 2 4 13 RAFL04-13-P14 AY035180 Experimental RAFL04-13-P14 AV782100;AV821595;AY035180 unknown protein
4 2 4 14 RAFL04-13-K08 AY034926 Experimental RAFL04-13-K08 AV782067;AY034926 unknown protein
4 2 5 1 RAFL04-16-G03 AY042884 Experimental RAFL04-16-G03 AV782322;AV821781;AY042884 polyubiquitin
4 2 5 2 RAFL04-16-M24 AY042877 Experimental RAFL04-16-M24 AV782371;AV821818;AY042877 unknown protein
4 2 5 3 RAFL04-16-I19 AV821794 Experimental RAFL04-16-I19 AV782340;AV821794;AF386983 unknown protein
4 2 5 4 RAFL04-16-M15 BP560647 Experimental RAFL04-16-M15 AV782370;BP560647 hypothetical protein
4 2 5 5 RAFL04-15-P13 AV821752 Experimental RAFL04-15-P13 AV782291;AV821752 lactate dehydrogenase (LDH1)
4 2 5 6 RAFL04-16-E14 AY054685 Experimental RAFL04-16-E14 AV782317;AV821775;AY054685 Unknown protein (At1g53590)
4 2 5 7 RAFL04-16-C10 AY081261 Experimental RAFL04-16-C10 AV782305;AV821766;AY081261 putative protein
4 2 5 8 RAFL04-16-G05 AV821782 Experimental RAFL04-16-G05 AV782323;AV821782 tubulin beta-4 chain (sp|P24636)
4 2 5 9 RAFL04-15-M22 AV821735 Experimental RAFL04-15-M22 AV782272;AV821735;AF386968 unknown protein
4 2 5 10 RAFL04-17-A14 AY054684 Experimental RAFL04-17-A14 AV782386;AV821832;AY054684 AUX1-like amino acid permease
4 2 5 11 RAFL04-16-O18 AV821823 Experimental RAFL04-16-O18 AV821823 putative WD-40 repeat protein
4 2 5 12 RAFL04-16-C17 AY059808 Experimental RAFL04-16-C17 AV782308;AV821769;AY059808 Unknown protein (T30F21.11)
4 2 5 13 RAFL04-16-A14 AY042834 Experimental RAFL04-16-A14 AV782298;AV821758;AY042834 unknown protein
4 2 5 14 RAFL04-15-P04 AY092956 Experimental RAFL04-15-P04 AV782289;AV821750;AY092956 unknown protein
4 2 6 1 RAFL04-20-M14 BP560701 Experimental RAFL04-20-M14 AV782719;BP560701;AF389300
4 2 6 2 RAFL04-20-L08 AY049302 Experimental RAFL04-20-L08 AV782712;AV822076;AY049302 senescence-associated protein sen1-like protein; ketoconazole resistance protein-like
4 2 6 3 RAFL04-20-H24 AY079024 Experimental RAFL04-20-H24 AV782686;AV822058;AY079024 unknown protein
4 2 6 4 RAFL04-20-P10 AY079022 Experimental RAFL04-20-P10 AV782739;AV822095;AY079022 putative protein
4 2 6 5 RAFL04-20-M04 AV822080 Experimental RAFL04-20-M04 AV782715;AV822080;AF389278 auxin-binding protein 1 precursor
4 2 6 6 RAFL04-20-O20 AY094415 Experimental RAFL04-20-O20 AV782733;AV822090;AY094415 unknown protein
4 2 6 7 RAFL04-20-P19 AY049304 Experimental RAFL04-20-P19 AV782742;AV822097;AY049304 peroxidase
4 2 6 8 RAFL04-20-K03 AY039550 Experimental RAFL04-20-K03 AV782704;AV822071;AY039550 unknown protein
4 2 6 9 RAFL04-20-N19 AY065053 Experimental RAFL04-20-N19 AV782728;AV822088;AY065053 isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase
4 2 6 10 RAFL04-20-H12 AY094413 Experimental RAFL04-20-H12 AV782681;AV822054;AY094413 unknown protein
4 2 6 11 RAFL04-20-E10 AY049294 Experimental RAFL04-20-E10 AV782665;AY049294 guard cell outward rectifying K+ channel
4 2 6 12 RAFL04-20-F07 AV782669 Experimental RAFL04-20-F07 AV782669 putative mitochondrial processing peptidase
4 2 6 13 RAFL04-16-J10 AV821801 Experimental RAFL04-16-J10 AV782347;AV821801 unknown protein
4 2 6 14 RAFL04-15-N01 AY081254 Experimental RAFL04-15-N01 AV821736;AY081254 putative aminolevulinate dehydratase
4 2 7 1 RAFL05-10-E17 AV822681 Experimental RAFL05-10-E17 AV783499;AV822681;AF370334 dUTP pyrophosphatase-like protein
4 2 7 2 RAFL05-10-F10 AY133723 Experimental RAFL05-10-F10 AV783503;AV822685;AY133723 putative protein
4 2 7 3 RAFL05-01-M23 AV822143 Experimental RAFL05-01-M23 AV782807;AV822143;AF389299 putative protein
4 2 7 4 RAFL05-01-N17 AY049299 Experimental RAFL05-01-N17 AV782812;AV822147;AY049299 putative protein
4 2 7 5 RAFL05-01-O08 AV822149 Experimental RAFL05-01-O08 AV782816;AV822149;AF389292 unknown
4 2 7 6 RAFL05-01-N01 AV782808 Experimental RAFL05-01-N01 AV782808;AF389301 copine-like protein
4 2 7 7 RAFL05-01-J11 AV822134 Experimental RAFL05-01-J11 AV782793;AV822134;AF389281 unknown protein
4 2 7 8 RAFL05-01-K23 BP560723 Experimental RAFL05-01-K23 AV782799;BP560723;AY049291 unknown protein
4 2 7 9 RAFL04-20-J15 AY079029 Experimental RAFL04-20-J15 AV782698;AV822066;AY079029 urophorphyrin III methylase (gb|AAB92676.1)
4 2 7 10 RAFL04-20-J09 AY049303 Experimental RAFL04-20-J09 AV782697;AV822065;AY049303 protein-methionine-S-oxide reductase
4 2 7 11 RAFL04-20-K02 AV822070 Experimental RAFL04-20-K02 AV782703;AV822070 cyclin like protein
4 2 7 12 RAFL04-20-J19 AY065051 Experimental RAFL04-20-J19 AV782701;AV822068;AY065051 unknown protein
4 2 7 13 RAFL04-20-N11 AY039547 Experimental RAFL04-20-N11 AV782726;AV822087;AY039547 putative DNA repair protein and transcription factor (XPB1)
4 2 7 14 RAFL04-20-L06 AV782711 Experimental RAFL04-20-L06 AV782711 putative sun (fmu) protein
4 2 8 1 RAFL05-07-E15 AY035016 Experimental RAFL05-07-E15 AV783188;AV822425;AY035016 unknown protein
4 2 8 2 RAFL05-08-F21 BP560831 Experimental RAFL05-08-F21 AV783316;BP560831;AF370349 unknown protein
4 2 8 3 RAFL05-08-D17 AV783301 Experimental RAFL05-08-D17 AV783301;AF370335 unknown protein (At1g63720)
4 2 8 4 RAFL05-08-C13 AV822507 Experimental RAFL05-08-C13 AV783291;AV822507;AF370315 thioredoxin, putative
4 2 8 5 RAFL05-05-L05 BP560799 Experimental RAFL05-05-L05 AV783117;BP560799;AY039982 unknown protein
4 2 8 6 RAFL05-05-K17 AY040010 Experimental RAFL05-05-K17 AV783116;AV822371;AY040010 methionine synthase like protein
4 2 8 7 RAFL05-05-K13 AY035148 Experimental RAFL05-05-K13 AV783114;AV822370;AY035148 ubiquitin / ribosomal protein CEP52
4 2 8 8 RAFL05-10-F07 AV822684 Experimental RAFL05-10-F07 AV783502;AV822684;AF370348 unknown protein
4 2 8 9 RAFL05-10-E13 AY034948 Experimental RAFL05-10-E13 AV783498;AV822680;AY034948 magnesium-protoporphyrin IX methyltransferase like protein
4 2 8 10 RAFL05-10-D01 AV822668 Experimental RAFL05-10-D01 AV783485;AV822668;AF370312 40S ribosomal protein S17
4 2 8 11 RAFL05-10-F15 AY046035 Experimental RAFL05-10-F15 AV783505;AV822686;AY046035 unknown protein (At1g71900)
4 2 8 12 RAFL05-10-F02 AV822683 Experimental RAFL05-10-F02 AV783501;AV822683;AF370161 sorbitol dehydrogenase-like protein
4 2 8 13 RAFL05-10-H10 BP560854 Experimental RAFL05-10-H10 AV783511;BP560854;AY035146 unknown protein
4 2 8 14 RAFL05-10-E02 AY034971 Experimental RAFL05-10-E02 AV783496;AV822678;AY034971 unknown protein
4 2 9 1 RAFL05-10-L05 AY042895 Experimental RAFL05-10-L05 AV783533;AV822713;AY042895 unknown protein
4 2 9 2 RAFL05-10-J02 BP560856 Experimental RAFL05-10-J02 AV783518;BP560856;AY072314 putative protein
4 2 9 3 RAFL05-10-L20 AY128305 Experimental RAFL05-10-L20 AV783539;AV822718;AY128305 putative protein
4 2 9 4 RAFL05-10-J10 AY054646 Experimental RAFL05-10-J10 AV783522;AV822702;AY054646 unknown protein
4 2 9 5 RAFL05-10-I23 AY062632 Experimental RAFL05-10-I23 AV783517;AV822698;AY062632 Unknown protein (At1g16720; F17F16.7)
4 2 9 6 RAFL05-10-K03 AY054609 Experimental RAFL05-10-K03 AV783525;AV822707;AY054609 putative protein
4 2 9 7 RAFL05-09-B17 AV822582 Experimental RAFL05-09-B17 AV783387;AV822582;AF370190 unknown protein
4 2 9 8 RAFL05-07-L13 AV822461 Experimental RAFL05-07-L13 AV783235;AV822461;AF370166 alternative oxidase 1a precursor
4 2 9 9 RAFL05-07-J24 AY045917 Experimental RAFL05-07-J24 AV783226;AV822453;AY045917 unknown protein
4 2 9 10 RAFL05-07-G03 AV822432 Experimental RAFL05-07-G03 AV783198;AV822432
4 2 9 11 RAFL05-07-E24 AY034952 Experimental RAFL05-07-E24 AV783189;AV822426;AY034952 unknown protein
4 2 9 12 RAFL05-07-C13 AY046012 Experimental RAFL05-07-C13 AV783169;AV822411;AY046012 unknown protein
4 2 9 13 RAFL05-08-O09 AV822562 Experimental RAFL05-08-O09 AV783362;AV822562;AF370187 putative diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase
4 2 9 14 RAFL05-08-K02 AY035032 Experimental RAFL05-08-K02 AV783340;AV822543;AY035032 palmitoyl-protein thioesterase precursor like
4 2 10 1 RAFL05-13-G16 BP560917 Experimental RAFL05-13-G16 AV783820;BP560917;AF370543 leucine-rich repeat protein
4 2 10 2 RAFL05-12-G03 AY065089 Experimental RAFL05-12-G03 AV783708;AV822850;AY065089 allene oxide synthase (emb|CAA73184.1)
4 2 10 3 RAFL05-11-L07 AV822791 Experimental RAFL05-11-L07 AV783633;AV822791;AF370557 putative chlorophyll A-B binding protein
4 2 10 4 RAFL05-11-L05 AY065087 Experimental RAFL05-11-L05 AV783632;AV822790;AY065087 GDP dissociation inhibitor
4 2 10 5 RAFL05-12-F09 AY092962 Experimental RAFL05-12-F09 AV783702;AV822846;AY092962 Unknown protein (At5g64430; T12B11.2)
4 2 10 6 RAFL05-13-E16 AY054613 Experimental RAFL05-13-E16 AV783804;AV822927;AY054613
4 2 10 7 RAFL05-12-D03 AV822831 Experimental RAFL05-12-D03 AV783685;AV822831 AT3g01540/F4P13_9
4 2 10 8 RAFL05-12-E01 AY059802 Experimental RAFL05-12-E01 AV783692;AV822837;AY059802 leucine-rich repeat protein FLR1
4 2 10 9 RAFL05-10-K11 AY128308 Experimental RAFL05-10-K11 AV783527;AV822709;AY128308 hypothetical protein
4 2 10 10 RAFL05-10-N24 AY128307 Experimental RAFL05-10-N24 AV783552;AV822729;AY128307 hypothetical protein
4 2 10 11 RAFL05-10-J16 AV822703 Experimental RAFL05-10-J16 AV783523;AV822703;AF327534 AT3g28710/MZN14_20
4 2 10 12 RAFL05-10-N04 BT001997 Experimental RAFL05-10-N04 AV783545;AV822723;BT001997 unknown
4 2 10 13 RAFL05-10-J18 AY065086 Experimental RAFL05-10-J18 AV822704;AY065086 unknown protein
4 2 10 14 RAFL05-10-O15 AY059815 Experimental RAFL05-10-O15 AV783556;AV822732;AY059815 AIM1 protein
4 2 11 1 RAFL05-16-G20 AY048223 Experimental RAFL05-16-G20 AV784113;AV823186;AY048223 unknown protein
4 2 11 2 RAFL05-16-H14 AY048221 Experimental RAFL05-16-H14 AV784120;AV823191;AY048221 putative 40S ribosomal protein S15
4 2 11 3 RAFL05-14-J20 AV823038 Experimental RAFL05-14-J20 AV823038 AT4g03280/F4C21_21
4 2 11 4 RAFL05-14-H15 AY070478 Experimental RAFL05-14-H15 AV783916;AY070478 unknown protein
4 2 11 5 RAFL05-15-H17 BP560952 Experimental RAFL05-15-H17 BP560952 Col-0 casein kinase I like protein
4 2 11 6 RAFL05-15-A16 AV823074 Experimental RAFL05-15-A16 AV783980;AV823074 spermidine synthase
4 2 11 7 RAFL05-15-E14 BP560948 Experimental RAFL05-15-E14 AV784010;BP560948;AY048228 60S ribosomal protein L27A
4 2 11 8 RAFL05-15-D10 BP560947 Experimental RAFL05-15-D10 AV784002;BP560947;AY070486 v-SNARE AtVTI1a
4 2 11 9 RAFL05-15-F08 AY125497 Experimental RAFL05-15-F08 AV784016;AY125497 UVB-resistance protein UVR8 (gb|AAD43920.1)
4 2 11 10 RAFL05-14-H24 AY048211 Experimental RAFL05-14-H24 AV783920;AV823025;AY048211 40S ribosomal protein S25
4 2 11 11 RAFL05-11-M07 AY065090 Experimental RAFL05-11-M07 AV783642;AV822797;AY065090 protein anti-phosphatase pepino (pep)
4 2 11 12 RAFL05-11-A06 BT001989 Experimental RAFL05-11-A06 AV783565;AV822737;BT001989 unknown protein
4 2 11 13 RAFL05-12-C11 AV822821 Experimental RAFL05-12-C11 AV783675;AV822821 unknown protein
4 2 11 14 RAFL05-13-G18 AV822943 Experimental RAFL05-13-G18 AV783822;AV822943
4 2 12 1 RAFL05-14-J01 AV823032 Experimental RAFL05-14-J01 AV783929;AV823032 glutathione S-transferase
4 2 12 2 RAFL05-16-E22 AV823175 Experimental RAFL05-16-E22 AV784103;AV823175 translation elongation factor eEF-1 alpha chain (gene A4)
4 2 12 3 RAFL05-16-A12 AY090255 Experimental RAFL05-16-A12 AV823155;AY090255 unknown protein
4 2 12 4 RAFL05-14-O18 AY074581 Experimental RAFL05-14-O18 AV783971;AV823066;AY074581 fibrillin precursor-like protein
4 2 12 5 RAFL05-14-I17 AY125502 Experimental RAFL05-14-I17 AV783926;AV823030;AY125502 mutT domain protein-like
4 2 12 6 RAFL05-15-M21 AY048213 Experimental RAFL05-15-M21 AV784059;AV823137;AY048213 ribosomal protein L7Ae-like
4 2 12 7 RAFL05-14-H17 AV823024 Experimental RAFL05-14-H17 AV783917;AV823024 unknown protein
4 2 12 8 RAFL05-15-L21 AY139777 Experimental RAFL05-15-L21 AV784050;AV823129;AY139777 unknown protein
4 2 12 9 RAFL05-14-N10 BP560942 Experimental RAFL05-14-N10 AV783965;BP560942;AY074582 putative eukaryotic translation initiation factor 3 subunit
4 2 12 10 RAFL05-15-G16 AY125496 Experimental RAFL05-15-G16 AV784022;AV823106;AY125496 putative adenylate kinase
4 2 12 11 RAFL05-15-N14 AV823143 Experimental RAFL05-15-N14 AV784065;AV823143 hypothetical protein
4 2 12 12 RAFL05-15-H10 AV823109 Experimental RAFL05-15-H10 AV784026;AV823109 glutathione S-transferase like protein
4 2 12 13 RAFL05-15-J19 AY070488 Experimental RAFL05-15-J19 AV784038;AV823118;AY070488 unknown protein
4 2 12 14 RAFL05-15-M17 AV823136 Experimental RAFL05-15-M17 AV784058;AV823136 unknown protein
4 2 13 1 RAFL05-18-L06 BP561008 Experimental RAFL05-18-L06 AV784354;BP561008;AY045986 unknown protein
4 2 13 2 RAFL05-18-I01 AY096494 Experimental RAFL05-18-I01 AV784327;AV823373;AY096494 unknown protein
4 2 13 3 RAFL05-18-K18 AY080882 Experimental RAFL05-18-K18 AV784349;AY080882
4 2 13 4 RAFL05-18-G08 BP561004 Experimental RAFL05-18-G08 AV784309;BP561004;AY063820 unknown protein
4 2 13 5 RAFL05-18-J04 AY045835 Experimental RAFL05-18-J04 AV784336;AV823381;AY045835 arginine/serine-rich protein
4 2 13 6 RAFL05-19-B10 AY045807 Experimental RAFL05-19-B10 AV784391;AY045807 short-chain type dehydrogenase/reductase like protein
4 2 13 7 RAFL05-18-P21 AY045983 Experimental RAFL05-18-P21 AV784381;AV823423;AY045983 unknown protein
4 2 13 8 RAFL05-18-I15 AY045953 Experimental RAFL05-18-I15 AV784331;AV823377;AY045953 beta-glucosidase-like protein
4 2 13 9 RAFL05-19-A06 AY074349 Experimental RAFL05-19-A06 AV784382;AV823424;AY074349 unknown protein
4 2 13 10 RAFL05-18-J16 AV823384 Experimental RAFL05-18-J16 AV784339;AV823384 alanine-glyoxylate aminotransferase
4 2 13 11 RAFL05-18-K12 AV823392 Experimental RAFL05-18-K12 AV784347;AV823392 unknown protein
4 2 13 12 RAFL05-18-L07 AY045805 Experimental RAFL05-18-L07 AV784355;AV823397;AY045805 unknown protein
4 2 13 13 RAFL05-18-H02 AV823364 Experimental RAFL05-18-H02 AV784316;AV823364 cucumisin-like serine protease; subtilisin-like protease, 5'partial
4 2 13 14 RAFL05-18-J21 AY051000 Experimental RAFL05-18-J21 AV784340;AV823385;AY051000 putative protein
4 2 14 1 RAFL06-10-I09 AY065110 Experimental RAFL06-10-I09 AV785021;AV823933;AY065110
4 2 14 2 RAFL06-11-P15 BT000456 Experimental RAFL06-11-P15 AV785124;AV824011;BT000456 unknown protein
4 2 14 3 RAFL06-10-C06 AY062769 Experimental RAFL06-10-C06 AV784977;AV823897;AY062769 unknown protein
4 2 14 4 RAFL06-11-G09 AY062768 Experimental RAFL06-11-G09 AV785077;AV823977;AY062768 11-beta-hydroxysteroid dehydrogenase-like
4 2 14 5 RAFL05-19-A18 BP561012 Experimental RAFL05-19-A18 AV784386;BP561012 natural resistance-associated macrophage protein
4 2 14 6 RAFL05-18-K22 BP561007 Experimental RAFL05-18-K22 BP561007 major latex protein, putative
4 2 14 7 RAFL05-18-O17 AY074339 Experimental RAFL05-18-O17 AV784375;AV823415;AY074339 indole-3-acetate beta-glucosyltransferase like protein
4 2 14 8 RAFL05-18-E12 BP561001 Experimental RAFL05-18-E12 AV784299;BP561001;AY045810 unknown protein
4 2 14 9 RAFL05-18-G05 AY096645 Experimental RAFL05-18-G05 AV784308;AV823358;AY096645 CP12 protein precursor-like protein
4 2 14 10 RAFL05-18-I22 AV823379 Experimental RAFL05-18-I22 AV784333;AV823379 PsbS protein (PsbS)
4 2 14 11 RAFL05-19-A14 AY096651 Experimental RAFL05-19-A14 AV784385;AV823426;AY096651 putative protein
4 2 14 12 RAFL05-18-L20 AV823400 Experimental RAFL05-18-L20 AV784358;AV823400 cytochrome P450 like protein
4 2 14 13 RAFL05-18-E17 AY045838 Experimental RAFL05-18-E17 AV784301;AV823353;AY045838 putative protein
4 2 14 14 RAFL05-18-G13 AY059726 Experimental RAFL05-18-G13 AV784311;AY059726 unknown protein
4 3 1 1 RAFL03-09-B11 AY039582 Experimental RAFL03-09-B11 AV781742;AY039582 unknown protein
4 3 1 2 RAFL03-08-F09 AV821324 Experimental RAFL03-08-F09 AV781719;AV821324;AF380630 putative protein
4 3 1 3 RAFL03-04-F03 AY045699 Experimental RAFL03-04-F03 AY045699 IMMUTANS (IM)
4 3 1 4 RAFL03-06-F11 AY075687 Experimental RAFL03-06-F11 AV781649;AV821289;AY075687 unknown protein
4 3 1 5 RAFL03-05-E07 AV781624 Experimental RAFL03-05-E07 AV781624 elongation factor 1-alpha
4 3 1 6 RAFL03-10-E10 AY045687 Experimental RAFL03-10-E10 AV781769;AV821349;AY045687 unknown protein
4 3 1 7 RAFL03-05-E09 AV821271 Experimental RAFL03-05-E09 AV781626;AV821271;AF380639 putative protein
4 3 1 8 RAFL03-05-B03 AV821265 Experimental RAFL03-05-B03 AV781619;AV821265;AF380626 unknown protein
4 3 1 9 RAFL03-01-H06 AV821238 Experimental RAFL03-01-H06 AV781579;AV821238;AF380660 farnesylated protein (ATFP6)
4 3 1 10 RAFL03-05-H04 AV821274 Experimental RAFL03-05-H04 AV781629;AV821274;AF380652 putative protein
4 3 1 11 RAFL03-02-C09 AY039587 Experimental RAFL03-02-C09 AV781588;AV821242;AY039587 unknown protein
4 3 1 12 RAFL03-06-B01 AY075683 Experimental RAFL03-06-B01 AY075683 23 kDa polypeptide of oxygen-evolving comlex (OEC)
4 3 1 13 RAFL03-05-G04 AY045683 Experimental RAFL03-05-G04 AV781628;AV821273;AY045683 predicted GPI-anchored protein
4 3 1 14 RAFL03-04-G02 AY049306 Experimental RAFL03-04-G02 AV781611;AY049306 nodulin like protein
4 3 2 1 RAFL04-12-B18 AV821475 Experimental RAFL04-12-B18 AV781937;AV821475 Shaggy related protein kinase tetha
4 3 2 2 RAFL04-13-I22 AV821559 Experimental RAFL04-13-I22 AV782056;AV821559;AF370253 putative transcription factor BTF3 (RNA polymerase B transcription factor 3)
4 3 2 3 RAFL04-12-E10 AY045925 Experimental RAFL04-12-E10 AV781951;AV821482;AY045925 putative ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit N-methyltransferase I
4 3 2 4 RAFL04-12-F07 AY034920 Experimental RAFL04-12-F07 AV781955;AV821484;AY034920 prefoldin like protein
4 3 2 5 RAFL03-08-D18 AV821323 Experimental RAFL03-08-D18 AV781717;AV821323;AF380661
4 3 2 6 RAFL03-07-L21 AY102097 Experimental RAFL03-07-L21 AV781701;AY102097 unknown
4 3 2 7 RAFL03-09-J12 AV821344 Experimental RAFL03-09-J12 AV781755;AV821344;AF380651 putative small nuclear ribonucleoprotein Sm D3
4 3 2 8 RAFL03-08-N24 AV821337 Experimental RAFL03-08-N24 AV781738;AV821337;AF380640 carnitine racemase like protein
4 3 2 9 RAFL03-07-E18 AY045678 Experimental RAFL03-07-E18 AV781689;AV821311;AY045678 unknown protein
4 3 2 10 RAFL03-06-L21 AV821297 Experimental RAFL03-06-L21 AV781664;AV821297;AF380625 unknown protein
4 3 2 11 RAFL03-07-K22 AV821317 Experimental RAFL03-07-K22 AV781700;AV821317;AF380659 putative protein
4 3 2 12 RAFL03-07-N14 AY045694 Experimental RAFL03-07-N14 AV781711;AV821321;AY045694 putative adenylate kinase
4 3 2 13 RAFL03-07-M07 AY039589 Experimental RAFL03-07-M07 AV781705;AV821318;AY039589 unknown protein
4 3 2 14 RAFL03-07-I22 AV781694 Experimental RAFL03-07-I22 AV781694;AF380644 unknown protein
4 3 3 1 RAFL04-12-M16 AY096496 Experimental RAFL04-12-M16 AV781992;AY096496 unknown protein
4 3 3 2 RAFL04-12-F14 AY035013 Experimental RAFL04-12-F14 AV781956;AV821485;AY035013 succinate dehydrogenase iron-protein subunit, putative
4 3 3 3 RAFL04-12-K10 AY091129 Experimental RAFL04-12-K10 AV781983;AV821502;AY091129
4 3 3 4 RAFL04-13-N15 AV821583 Experimental RAFL04-13-N15 AV782086;AV821583;AF370256 cytochrome b5 (dbj|BAA74840.1)
4 3 3 5 RAFL04-12-A03 AY039929 Experimental RAFL04-12-A03 AV781932;AY039929 AtRer1A
4 3 3 6 RAFL04-13-O07 AY034923 Experimental RAFL04-13-O07 AV782090;AV821586;AY034923 aminotransferase like protein
4 3 3 7 RAFL04-13-L15 AV821573 Experimental RAFL04-13-L15 AV782074;AV821573;AF370293 calmodulin-4
4 3 3 8 RAFL04-13-M11 AV821576 Experimental RAFL04-13-M11 AV782078;AV821576;AF370283 unknown protein
4 3 3 9 RAFL04-10-K16 AV821456 Experimental RAFL04-10-K16 AV781913;AV821456;AF370269 putative zinc finger protein
4 3 3 10 RAFL04-13-J02 BP560596 Experimental RAFL04-13-J02 AV782057;BP560596;AY039934 fructose-bisphosphatase precursor
4 3 3 11 RAFL04-12-H20 AY035178 Experimental RAFL04-12-H20 AV781972;AV821495;AY035178 unknown protein
4 3 3 12 RAFL04-12-H18 AY039925 Experimental RAFL04-12-H18 AV781971;AV821494;AY039925 unknown protein
4 3 3 13 RAFL04-10-G08 AY039947 Experimental RAFL04-10-G08 AV781898;AV821445;AY039947 topoisomerase-like protein
4 3 3 14 RAFL04-10-P04 AY035009 Experimental RAFL04-10-P04 AV781930;AV821469;AY035009 putative ADP-ribosylation factor
4 3 4 1 RAFL04-18-P17 AV821958 Experimental RAFL04-18-P17 AV782549;AV821958 adenylate kinase -like protein
4 3 4 2 RAFL04-20-A09 AV782640 Experimental RAFL04-20-A09 AV782640 putative APG protein
4 3 4 3 RAFL04-17-B06 AV821835 Experimental RAFL04-17-B06 AV782390;AV821835 DNAJ PROTEIN HOMOLOG ATJ
4 3 4 4 RAFL04-17-F04 AY042829 Experimental RAFL04-17-F04 AV782423;AV821859;AY042829 Unknown protein
4 3 4 5 RAFL04-17-I01 AY054690 Experimental RAFL04-17-I01 AV782449;AY054690 beta-1,3-glucanase - like predicted GPI-anchored protein
4 3 4 6 RAFL04-20-D12 AY042867 Experimental RAFL04-20-D12 AV782658;AV822036;AY042867 putative 2Fe-2S iron-sulfur cluster protein
4 3 4 7 RAFL04-18-L04 AY128330 Experimental RAFL04-18-L04 AV782532;AV821944;AY128330 hypothetical protein
4 3 4 8 RAFL04-17-D24 AY128350 Experimental RAFL04-17-D24 AV782412;AV821851;AY128350 Cf-5 disease resistance protein - like
4 3 4 9 RAFL04-15-B07 AY045926 Experimental RAFL04-15-B07 AV782188;AV821667;AY045926 3-oxo-5-alpha-steroid 4-dehydrogenase
4 3 4 10 RAFL04-14-P20 AV821656 Experimental RAFL04-14-P20 AV782176;AV821656;AF370286 chloroplast GrpE protein
4 3 4 11 RAFL04-14-K02 AY035163 Experimental RAFL04-14-K02 AV782148;AV821635;AY035163 contains similarity to GTP-binding protein CGPA
4 3 4 12 RAFL04-15-L06 BP560627 Experimental RAFL04-15-L06 AV782259;BP560627;AY096639 unknown protein
4 3 4 13 RAFL04-15-F02 AY063807 Experimental RAFL04-15-F02 AV782219;AV821691;AY063807 unknown protein
4 3 4 14 RAFL04-14-J20 AY034925 Experimental RAFL04-14-J20 AV782147;AV821634;AY034925 putative methionyl-tRNA synthetase
4 3 5 1 RAFL04-17-E21 BT002032 Experimental RAFL04-17-E21 AV782418;AV821855;BT002032 hypothetical protein
4 3 5 2 RAFL04-17-P18 AV821917 Experimental RAFL04-17-P18 AV782501;AV821917;AF386980 putative protein
4 3 5 3 RAFL04-17-H14 AV821876 Experimental RAFL04-17-H14 AV782445;AV821876;AF386978 ribosomal protein L29, putative
4 3 5 4 RAFL04-17-D11 AV821845 Experimental RAFL04-17-D11 AV782405;AV821845 unknown protein
4 3 5 5 RAFL04-19-C23 AY128354 Experimental RAFL04-19-C23 AV821975;AY128354 putative signal peptidase I
4 3 5 6 RAFL04-17-P20 AV821918 Experimental RAFL04-17-P20 AV782502;AV821918;AF387007 Similar to Synechocystis antiviral protein (At1g70070)
4 3 5 7 RAFL04-19-D15 AV821976 Experimental RAFL04-19-D15 AV782571;AV821976 ankyrin - like protein
4 3 5 8 RAFL04-19-B13 AY054687 Experimental RAFL04-19-B13 AV782562;AV821969;AY054687 GTPase like protein
4 3 5 9 RAFL04-17-N12 AV821902 Experimental RAFL04-17-N12 AV782486;AV821902 elongation factor, putative
4 3 5 10 RAFL04-17-N10 AY065193 Experimental RAFL04-17-N10 AV821901;AY065193 D-tyrosyl-tRNA(Tyr) deacylase like protein
4 3 5 11 RAFL04-17-J20 AY072306 Experimental RAFL04-17-J20 AV782463;AV821886;AY072306 ARP protein (At1g49670; F14J22.10)
4 3 5 12 RAFL04-17-D18 AV821849 Experimental RAFL04-17-D18 AV782410;AV821849 putative homeodomain protein
4 3 5 13 RAFL04-17-G16 BP560659 Experimental RAFL04-17-G16 BP560659;AY072305 unknown protein
4 3 5 14 RAFL04-17-M08 AY042870 Experimental RAFL04-17-M08 AV782480;AV821898;AY042870 1-aminocyclopropane-1-carboxylate oxidase
4 3 6 1 RAFL05-05-E05 AY039905 Experimental RAFL05-05-E05 AV783083;AV822345;AY039905 glutathione S-transferase (GST6)
4 3 6 2 RAFL05-03-O21 AY039893 Experimental RAFL05-03-O21 AV782967;AV822257;AY039893 leucoanthocyanidin dioxygenase-like protein
4 3 6 3 RAFL05-03-N22 BP560764 Experimental RAFL05-03-N22 AV782957;BP560764;AY123995 unknown protein
4 3 6 4 RAFL05-03-M12 AY039873 Experimental RAFL05-03-M12 AV782953;AV822248;AY039873 putative cytidine deaminase - like
4 3 6 5 RAFL05-04-L07 AY123991 Experimental RAFL05-04-L07 AV783035;AV822312;AY123991
4 3 6 6 RAFL05-04-J20 AY094428 Experimental RAFL05-04-J20 AV783028;AV822305;AY094428 nonspecific lipid-transfer protein precursor - like
4 3 6 7 RAFL05-02-M09 AY039899 Experimental RAFL05-02-M09 AV782874;AV822188;AY039899 unknown protein
4 3 6 8 RAFL05-02-I04 AY039896 Experimental RAFL05-02-I04 AV782853;AV822175;AY039896 unknown protein (At1g71810)
4 3 6 9 RAFL05-03-D24 AY039882 Experimental RAFL05-03-D24 AV782915;AV822216;AY039882 unknown protein
4 3 6 10 RAFL05-02-H23 AY039878 Experimental RAFL05-02-H23 AV782852;AV822174;AY039878 putative cyclin-dependent protein kinase
4 3 6 11 RAFL05-02-A20 AY039862 Experimental RAFL05-02-A20 AV782825;AV822153;AY039862 putative ATP-dependent RNA helicase
4 3 6 12 RAFL05-02-N06 AY039858 Experimental RAFL05-02-N06 AV782881;AV822192;AY039858 36kDa-peroxisomal membrane protein (PMP36)
4 3 6 13 RAFL04-17-O24 AV821912 Experimental RAFL04-17-O24 AV782496;AV821912;AF387018 citrate synthase
4 3 6 14 RAFL04-17-J22 AV821888 Experimental RAFL04-17-J22 AV782465;AV821888;AF386981 unknown protein
4 3 7 1 RAFL05-07-H19 AY034946 Experimental RAFL05-07-H19 AV783212;AV822443;AY034946 unknown protein
4 3 7 2 RAFL05-08-J06 AV822541 Experimental RAFL05-08-J06 AV783336;AV822541;AF370309 small GTP-binding protein - like
4 3 7 3 RAFL05-04-C09 AY039908 Experimental RAFL05-04-C09 AV782989;AV822272;AY039908 predicted GPI-anchored protein
4 3 7 4 RAFL05-03-P24 BP560768 Experimental RAFL05-03-P24 AV782973;BP560768;AY039891 unknown protein
4 3 7 5 RAFL05-05-B17 AV822339 Experimental RAFL05-05-B17 AV783075;AV822339;AF462806 putative mudrA protein
4 3 7 6 RAFL05-04-P01 AY039870 Experimental RAFL05-04-P01 AV783059;AV822329;AY039870 unknown protein
4 3 7 7 RAFL05-03-K22 AY037251 Experimental RAFL05-03-K22 AV782943;AV822241;AY037251
4 3 7 8 RAFL05-03-J08 AY039859 Experimental RAFL05-03-J08 AV782939;AV822237;AY039859 low temperature and salt responsive protein LTI6A
4 3 7 9 RAFL05-04-F21 AY039903 Experimental RAFL05-04-F21 AV783012;AV822289;AY039903 lipid transfer like protein
4 3 7 10 RAFL05-04-D11 AY039889 Experimental RAFL05-04-D11 AV782995;AV822278;AY039889 unknown protein
4 3 7 11 RAFL05-04-C07 AY048208 Experimental RAFL05-04-C07 AY048208 putative cold-acclimation protein
4 3 7 12 RAFL05-04-A24 BP560769 Experimental RAFL05-04-A24 AV782980;BP560769;AY039872 unknown protein
4 3 7 13 RAFL05-03-N24 AY039864 Experimental RAFL05-03-N24 AV782959;AV822250;AY039864 AT3g28710/MZN14_20
4 3 7 14 RAFL05-04-M14 AY039860 Experimental RAFL05-04-M14 AV783041;AV822318;AY039860 unknown protein
4 3 8 1 RAFL05-08-P24 AY035015 Experimental RAFL05-08-P24 AV783376;AV822572;AY035015 nonspecific lipid-transfer protein precursor - like
4 3 8 2 RAFL05-08-M19 AY091153 Experimental RAFL05-08-M19 AV783353;AV822553;AY091153
4 3 8 3 RAFL05-08-L05 AY039962 Experimental RAFL05-08-L05 AV783346;AV822549;AY039962 unknown protein
4 3 8 4 RAFL05-08-J11 AV822542 Experimental RAFL05-08-J11 AV783337;AV822542;AF370314 putative transport protein SEC61 beta-subunit
4 3 8 5 RAFL05-09-D01 AV822586 Experimental RAFL05-09-D01 AV783392;AV822586;AF370184 putative protein
4 3 8 6 RAFL05-09-B06 BP560843 Experimental RAFL05-09-B06 AV783382;BP560843;AF370163 unknown protein
4 3 8 7 RAFL05-07-L21 AY096498 Experimental RAFL05-07-L21 AV783239;AV822465;AY096498 alanine-glyoxylate aminotransferase
4 3 8 8 RAFL05-07-L02 AY045909 Experimental RAFL05-07-L02 AV783231;AV822458;AY045909 putative DNA-binding protein
4 3 8 9 RAFL05-07-J06 AY039961 Experimental RAFL05-07-J06 AV783222;AV822449;AY039961 putative glyceraldehyde-3-phosphate dehydrogenase (At1g42970)
4 3 8 10 RAFL05-07-H20 AV822444 Experimental RAFL05-07-H20 AV783213;AV822444;AF370311 B-box zinc finger protein (STH)
4 3 8 11 RAFL05-09-C24 AY039981 Experimental RAFL05-09-C24 AV822585;AY039981 unknown protein
4 3 8 12 RAFL05-09-B05 AV783381 Experimental RAFL05-09-B05 AV783381 putative glycerol kinase
4 3 8 13 RAFL05-07-L19 AY035145 Experimental RAFL05-07-L19 AV783238;AV822464;AY035145 transcription factor-like protein
4 3 8 14 RAFL05-07-L01 AY039967 Experimental RAFL05-07-L01 AV783230;AV822457;AY039967 serine/threonine kinase-like protein
4 3 9 1 RAFL05-11-D09 AV822749 Experimental RAFL05-11-D09 AV783579;AV822749 unknown protein
4 3 9 2 RAFL05-11-C07 AY128312 Experimental RAFL05-11-C07 AV783577;AY128312 unknown protein
4 3 9 3 RAFL05-11-B04 AY065094 Experimental RAFL05-11-B04 AV783572;AV822744;AY065094 putative protein
4 3 9 4 RAFL05-11-A02 BP560868 Experimental RAFL05-11-A02 AV783564;BP560868;AY062634 selenium-binding protein like
4 3 9 5 RAFL05-12-K08 BP560901 Experimental RAFL05-12-K08 AV783733;BP560901;AY042845 heat-shock protein
4 3 9 6 RAFL05-13-H15 AV822947 Experimental RAFL05-13-H15 AV822947
4 3 9 7 RAFL05-09-F21 AV822605 Experimental RAFL05-09-F21 AV783410;AV822605;AF370189 unknown protein
4 3 9 8 RAFL05-09-D23 AV822596 Experimental RAFL05-09-D23 AV783401;AV822596;AF370165 peptidyl-prolyl cis-trans isomerase - like protein
4 3 9 9 RAFL05-07-O06 AY035018 Experimental RAFL05-07-O06 AV783262;AV822484;AY035018 phosphatidate cytidylyltransferase - like protein
4 3 9 10 RAFL05-07-N09 AY034974 Experimental RAFL05-07-N09 AV783252;AV822474;AY034974 unknown protein
4 3 9 11 RAFL05-07-L06 AY034951 Experimental RAFL05-07-L06 AV783233;AV822459;AY034951 unknown protein
4 3 9 12 RAFL05-08-M23 AV822554 Experimental RAFL05-08-M23 AV783354;AV822554;AF370317 putative prohibitin 2
4 3 9 13 RAFL05-09-D02 AV822587 Experimental RAFL05-09-D02 AV783393;AV822587;AF370186 phosphatidylglycerophosphate synthase - like protein
4 3 9 14 RAFL05-09-B07 AY035031 Experimental RAFL05-09-B07 AV783383;AV822578;AY035031 unknown protein (MPE11.29)
4 3 10 1 RAFL05-12-L10 AY092965 Experimental RAFL05-12-L10 AV822876;AY092965 monogalactosyldiacylglycerol synthase - like protein
4 3 10 2 RAFL05-13-A16 AV822909 Experimental RAFL05-13-A16 AV783777;AV822909;AF370538 unknown protein
4 3 10 3 RAFL05-12-E15 AY054622 Experimental RAFL05-12-E15 AV783694;AV822839;AY054622 40S ribosomal protein; contains C-terminal domain
4 3 10 4 RAFL05-12-L13 AV822877 Experimental RAFL05-12-L13 AV783741;AV822877
4 3 10 5 RAFL05-12-C12 AY120708 Experimental RAFL05-12-C12 AV783676;AV822822;AY120708 s-adenosylmethionine synthetase like protein
4 3 10 6 RAFL05-13-F24 BT001996 Experimental RAFL05-13-F24 AV783813;AV822937;BT001996 unknown protein
4 3 10 7 RAFL05-13-I20 AV822951 Experimental RAFL05-13-I20 AV783831;AV822951 unknown protein
4 3 10 8 RAFL05-13-A18 BP560908 Experimental RAFL05-13-A18 AV783779;BP560908;AY054620 unknown protein
4 3 10 9 RAFL05-11-G13 AY065091 Experimental RAFL05-11-G13 AV783606;AV822771;AY065091 unknown protein
4 3 10 10 RAFL05-11-D11 AV822750 Experimental RAFL05-11-D11 AV783580;AV822750;AF386945 Rubisco subunit binding-protein beta subunit
4 3 10 11 RAFL05-12-H13 AV822858 Experimental RAFL05-12-H13 AV783719;AV822858 putative protein
4 3 10 12 RAFL05-11-B02 AY042848 Experimental RAFL05-11-B02 AV783571;AV822743;AY042848 unknown protein
4 3 10 13 RAFL05-12-L08 AY128314 Experimental RAFL05-12-L08 AV783739;AV822875;AY128314 60S ribosomal protein L2
4 3 10 14 RAFL05-12-G07 BP560897 Experimental RAFL05-12-G07 AV783710;BP560897;AY065198 Sec12p-like protein (St12p)
4 3 11 1 RAFL05-18-C21 AY102103 Experimental RAFL05-18-C21 AV784290;AV823341;AY102103 unknown protein
4 3 11 2 RAFL05-17-D12 AY074854 Experimental RAFL05-17-D12 AV784192;AV823259;AY074854 putative protein
4 3 11 3 RAFL05-17-I08 AY074846 Experimental RAFL05-17-I08 AV784229;AV823292;AY074846 putative amine oxidase
4 3 11 4 RAFL05-17-I01 AV823291 Experimental RAFL05-17-I01 AV784228;AV823291 nucleic acid binding protein - like
4 3 11 5 RAFL05-16-G10 AY074860 Experimental RAFL05-16-G10 AV784111;AV823183;AY074860 At1g48640/F11I4_17
4 3 11 6 RAFL05-16-A02 AY125504 Experimental RAFL05-16-A02 AV784075;AV823152;AY125504 hypothetical protein
4 3 11 7 RAFL05-15-O22 AV823148 Experimental RAFL05-15-O22 AV784070;AV823148 succinyl-CoA ligase beta subunit
4 3 11 8 RAFL05-15-L20 AY050387 Experimental RAFL05-15-L20 AV784049;AV823128;AY050387 zinc finger protein ZFP6
4 3 11 9 RAFL05-15-F17 AY091771 Experimental RAFL05-15-F17 AV784019;AV823103;AY091771 cysteine protease-like protein
4 3 11 10 RAFL05-15-N15 AY050433 Experimental RAFL05-15-N15 AV784066;AV823144;AY050433 putative RING zinc finger protein
4 3 11 11 RAFL05-12-M17 AY042904 Experimental RAFL05-12-M17 AV783750;AV822885;AY042904 putative chloroplast prephenate dehydratase
4 3 11 12 RAFL05-11-G07 BP560876 Experimental RAFL05-11-G07 AV783603;BP560876;AF386991 putative leucine rich protein
4 3 11 13 RAFL05-11-O04 AY120709 Experimental RAFL05-11-O04 AV783652;AV822807;AY120709 uridine diphosphate glucose epimerase
4 3 11 14 RAFL05-11-L02 BP560883 Experimental RAFL05-11-L02 AV783631;BP560883;AY054654 possible apospory-associated like protein
4 3 12 1 RAFL05-16-N16 AV823231 Experimental RAFL05-16-N16 AV784164;AV823231
4 3 12 2 RAFL05-17-M20 AY074859 Experimental RAFL05-17-M20 AV784257;AV823316;AY074859 ADP-ribosylation factor 1
4 3 12 3 RAFL05-17-N14 AV823318 Experimental RAFL05-17-N14 AV784259;AV823318;AF462840 unknown protein
4 3 12 4 RAFL05-17-J10 AV823295 Experimental RAFL05-17-J10 AV784235;AV823295 unknown protein
4 3 12 5 RAFL05-17-H06 BP560985 Experimental RAFL05-17-H06 AV784223;BP560985 cysteine proteinase like protein
4 3 12 6 RAFL05-17-A02 AY091769 Experimental RAFL05-17-A02 AV784176;AV823243;AY091769 unknown protein
4 3 12 7 RAFL05-17-A13 AV823246 Experimental RAFL05-17-A13 AV823246;AF462844 putative cytochrome P450
4 3 12 8 RAFL05-16-L24 AY050446 Experimental RAFL05-16-L24 AV823224;AY050446 glycine decarboxylase complex H-protein
4 3 12 9 RAFL05-16-L16 AV823221 Experimental RAFL05-16-L16 AV784152;AV823221 unknown protein
4 3 12 10 RAFL05-17-J24 AY074852 Experimental RAFL05-17-J24 AV784239;AV823299;AY074852 unknown protein
4 3 12 11 RAFL05-17-F20 AV823278 Experimental RAFL05-17-F20 AV784212;AV823278 unknown protein
4 3 12 12 RAFL05-17-D18 AY074845 Experimental RAFL05-17-D18 AV784197;AV823264;AY074845 unknown protein
4 3 12 13 RAFL05-17-G22 AY091775 Experimental RAFL05-17-G22 AV784220;AV823286;AY091775 putative protein
4 3 12 14 RAFL05-17-L17 AY050445 Experimental RAFL05-17-L17 AV784248;AV823308;AY050445 ribosomal L23a - like protein
4 3 13 1 RAFL05-20-P12 AY045985 Experimental RAFL05-20-P12 AV784536;AV823542;AY045985 unknown protein
4 3 13 2 RAFL05-20-N04 AY080786 Experimental RAFL05-20-N04 AV784522;AV823533;AY080786 putative bHLH transcription factor (bHLH047)
4 3 13 3 RAFL05-21-A08 AY080881 Experimental RAFL05-21-A08 AV784543;AV823549;AY080881 unknown protein
4 3 13 4 RAFL05-21-P04 AV823628 Experimental RAFL05-21-P04 AV784632;AV823628 unknown protein
4 3 13 5 RAFL05-20-O22 AY091134 Experimental RAFL05-20-O22 AV784531;AV823540;AY091134 Bax inhibitor-1 like
4 3 13 6 RAFL05-21-O22 AY045806 Experimental RAFL05-21-O22 AV784631;AV823627;AY045806
4 3 13 7 RAFL05-21-L18 AY045982 Experimental RAFL05-21-L18 AV784611;AV823608;AY045982
4 3 13 8 RAFL05-21-N12 AY080785 Experimental RAFL05-21-N12 AV784623;AV823619;AY080785 unknown protein
4 3 13 9 RAFL05-19-E20 AY074348 Experimental RAFL05-19-E20 AV784412;AV823445;AY074348 putative protein disulfide-isomerase
4 3 13 10 RAFL05-19-H16 AY080868 Experimental RAFL05-19-H16 AV823468;AY080868 putative PRP19-like spliceosomal protein
4 3 13 11 RAFL05-19-D07 AY050771 Experimental RAFL05-19-D07 AV784404;AV823438;AY050771 unknown protein
4 3 13 12 RAFL05-19-H01 AY045881 Experimental RAFL05-19-H01 AV784433;AV823464;AY045881 unknown protein
4 3 13 13 RAFL05-19-O22 AV823508 Experimental RAFL05-19-O22 AV784490;AV823508
4 3 13 14 RAFL05-19-H13 BT000674 Experimental RAFL05-19-H13 AV784436;AV823466;BT000674 AALP protein
4 3 14 1 RAFL06-08-I12 BT002420 Experimental RAFL06-08-I12 AV784813;AV823768;BT002420 polyubiquitin (ubq3)
4 3 14 2 RAFL06-08-F07 BP561082 Experimental RAFL06-08-F07 AV784791;BP561082;AY062803 plasma membrane intrinsic protein PIP3
4 3 14 3 RAFL06-09-H20 AY062795 Experimental RAFL06-09-H20 AV784917;AV823849;AY062795 putative ferritin
4 3 14 4 RAFL06-09-G07 AY065123 Experimental RAFL06-09-G07 AV784907;AV823842;AY065123
4 3 14 5 RAFL05-21-O13 AY080883 Experimental RAFL05-21-O13 AV784629;AV823626;AY080883 putative protein
4 3 14 6 RAFL05-21-E09 AV823574 Experimental RAFL05-21-E09 AV784569;AV823574 unknown protein
4 3 14 7 RAFL05-21-M03 AV823611 Experimental RAFL05-21-M03 AV784614;AV823611 unknown protein
4 3 14 8 RAFL05-20-N18 AY045809 Experimental RAFL05-20-N18 AV784526;AV823537;AY045809 cold-regulated protein cor15b precursor
4 3 14 9 RAFL05-20-P04 AY045987 Experimental RAFL05-20-P04 AV784534;AY045987 putative protein
4 3 14 10 RAFL05-21-M20 AY045955 Experimental RAFL05-21-M20 AV784620;AV823615;AY045955 oxidoreductase like protein
4 3 14 11 RAFL05-21-C17 AV823562 Experimental RAFL05-21-C17 AV784558;AV823562 unknown protein
4 3 14 12 RAFL05-21-H13 BP561045 Experimental RAFL05-21-H13 AV784588;BP561045;AY080869 unknown protein
4 3 14 13 RAFL05-21-J08 BP561048 Experimental RAFL05-21-J08 AV784595;BP561048;AY045837 cytoplasmic ribosomal protein S15a -like
4 3 14 14 RAFL05-21-L01 AY091156 Experimental RAFL05-21-L01 AV784606;AV823601;AY091156 putative protein
4 4 1 1 RAFL02-10-H11 AV821217 Experimental RAFL02-10-H11 AV781549;AV821217;AF361849 putative protein
4 4 1 2 RAFL02-02-B06 AV821102 Experimental RAFL02-02-B06 AV781354;AV821102;AF361846 putative auxin-regulated protein
4 4 1 3 RAFL02-04-G03 AY039577 Experimental RAFL02-04-G03 AV781381;AV821123;AY039577 pathogenesis-related protein 1 precursor, 19.3K
4 4 1 4 RAFL02-10-L13 AY070465 Experimental RAFL02-10-L13 AV781562;AV821224;AY070465 putative protein
4 4 1 5 RAFL02-10-M07 AV821225 Experimental RAFL02-10-M07 AV781563;AV821225;AF361854 unknown protein
4 4 1 6 RAFL02-06-B17 AV821144 Experimental RAFL02-06-B17 AV821144;AF375409 unknown protein (At1g70310)
4 4 1 7 RAFL02-01-A03 AY061751 Experimental RAFL02-01-A03 AV781338;AV821088;AY061751 phosphoglucomutase-like protein
4 4 1 8 RAFL02-04-A09 AV821122 Experimental RAFL02-04-A09 AV781380;AV821122;AF375398 putative protein
4 4 1 9 RAFL02-10-H19 AY039573 Experimental RAFL02-10-H19 AV781551;AV821218;AY039573 unknown protein
4 4 1 10 RAFL02-02-F05 AY070467 Experimental RAFL02-02-F05 AV781359;AV821107;AY070467 ribosomal protein S4 - like
4 4 1 11 RAFL02-05-D06 AY061754 Experimental RAFL02-05-D06 AV781398;AV821133;AY061754 RuvB DNA helicase-like protein
4 4 1 12 RAFL02-04-I12 AV821127 Experimental RAFL02-04-I12 AV781386;AV821127;AF375411 putative RNA-binding protein
4 4 1 13 RAFL02-06-H10 AV821149 Experimental RAFL02-06-H10 AV781422;AV821149;AF375405 unknown protein
4 4 1 14 RAFL02-05-F08 BP560441 Experimental RAFL02-05-F08 AV781401;BP560441;AF361838 putative major latex protein
4 4 2 1 RAFL04-10-F11 BP560574 Experimental RAFL04-10-F11 AV781889;BP560574;AY035157 cytoplasmic ribosomal protein S15a - like
4 4 2 2 RAFL04-10-E15 AV821438 Experimental RAFL04-10-E15 AV781886;AV821438;AF370252 unknown protein
4 4 2 3 RAFL04-10-C15 BT000775 Experimental RAFL04-10-C15 AV781873;AV821429;BT000775 putative 60S ribosomal protein L21
4 4 2 4 RAFL04-10-B18 AY091124 Experimental RAFL04-10-B18 AV781869;AV821426;AY091124
4 4 2 5 RAFL02-03-E08 AV821114 Experimental RAFL02-03-E08 AV821114;AF375421 unknown protein
4 4 2 6 RAFL02-06-G14 AY070471 Experimental RAFL02-06-G14 AV821148;AY070471 2-isopropylmalate synthase-like; homocitrate synthase-like
4 4 2 7 RAFL02-01-A08 AY126990 Experimental RAFL02-01-A08 AV821089;AY126990 putative mitochondrial processing peptidase
4 4 2 8 RAFL02-04-I05 AV821126 Experimental RAFL02-04-I05 AV821126;AF361850 unknown protein
4 4 2 9 RAFL02-10-F12 AV821213 Experimental RAFL02-10-F12 AV781541;AV821213;AF375406 putative protein
4 4 2 10 RAFL02-02-I08 AV821109 Experimental RAFL02-02-I08 AV781362;AV821109;AF361839 ubiquinol-cytochrome c reductase - like protein
4 4 2 11 RAFL02-10-A09 AV821202 Experimental RAFL02-10-A09 AV781525;AV821202;AF375419 ribosomal protein L9, putative
4 4 2 12 RAFL02-06-D19 AY070464 Experimental RAFL02-06-D19 AV781416;AV821146;AY070464 symbiosis-related like protein
4 4 2 13 RAFL02-05-C07 AY061752 Experimental RAFL02-05-C07 AV781396;AV821132;AY061752 protein phosphatase-2C PP2C-like
4 4 2 14 RAFL02-04-K03 AV821128 Experimental RAFL02-04-K03 AV781388;AV821128;AF361853 unknown protein
4 4 3 1 RAFL04-14-A14 AV821601 Experimental RAFL04-14-A14 AV782105;AV821601;AF370294 ribosomal protein
4 4 3 2 RAFL04-13-K21 AY035012 Experimental RAFL04-13-K21 AV782068;AV821568;AY035012
4 4 3 3 RAFL04-13-H19 AY035159 Experimental RAFL04-13-H19 AV782052;AY035159 chromatin remodelling complex ATPase chain ISWI -like protein
4 4 3 4 RAFL04-13-L14 AV821572 Experimental RAFL04-13-L14 AV782073;AV821572;AF370255 Ca-dependent solute carrier - like protein
4 4 3 5 RAFL04-13-G10 AY035179 Experimental RAFL04-13-G10 AV782044;AV821549;AY035179 unknown protein
4 4 3 6 RAFL04-13-C04 AY045783 Experimental RAFL04-13-C04 AV782026;AV821533;AY045783 unknown protein
4 4 3 7 RAFL04-13-C12 AV821535 Experimental RAFL04-13-C12 AV782028;AV821535;AF370292 unknown protein
4 4 3 8 RAFL04-10-N12 AY035010 Experimental RAFL04-10-N12 AV781925;AV821466;AY035010 photosystem I subunit V precursor, putative
4 4 3 9 RAFL04-10-K01 AY035158 Experimental RAFL04-10-K01 AV781910;AV821454;AY035158 3-isopropylmalate dehydratase, small subunit
4 4 3 10 RAFL04-10-F17 AY039933 Experimental RAFL04-10-F17 AV781892;AV821440;AY039933 putative DNA-binding protein
4 4 3 11 RAFL04-10-B09 AV821422 Experimental RAFL04-10-B09 AV781865;AV821422 unknown protein
4 4 3 12 RAFL04-10-D23 AY116672 Experimental RAFL04-10-D23 AV781882;AV821434;AY116672 MtN3-like protein
4 4 3 13 RAFL04-10-D21 AY035107 Experimental RAFL04-10-D21 AV781881;AV821433;AY035107 acetylglutamate kinase-like protein
4 4 3 14 RAFL04-10-C21 AV821431 Experimental RAFL04-10-C21 AV781876;AV821431 putative myosin heavy chain
4 4 4 1 RAFL04-15-P16 AV821753 Experimental RAFL04-15-P16 AV782292;AV821753 GDP-mannose 3"",5""-epimerase
4 4 4 2 RAFL04-16-E15 BT002389 Experimental RAFL04-16-E15 AV821776;BT002389 amino acid permease AAP5
4 4 4 3 RAFL04-16-F11 BT002011 Experimental RAFL04-16-F11 AV782319;BP560637;BT002011 putative protein
4 4 4 4 RAFL04-16-H04 AV821791 Experimental RAFL04-16-H04 AV782332;AV821791;AF370559 unknown protein
4 4 4 5 RAFL04-17-A10 AY054595 Experimental RAFL04-17-A10 AV782385;AV821831;AY054595 ubiquitin-conjugating enzyme E2-17 kD 8 (ubiquitin-protein ligase 8) (ubiquitin carrier protein 8) (sp|P35131)
4 4 4 6 RAFL04-16-I18 BP560641 Experimental RAFL04-16-I18 AV782339;BP560641;AY065079 unknown protein
4 4 4 7 RAFL04-16-H06 AY065077 Experimental RAFL04-16-H06 AV782333;AV821792;AY065077 putative ribosomal protein L10
4 4 4 8 RAFL04-15-O23 AY065074 Experimental RAFL04-15-O23 AV782287;AV821749;AY065074 unknown protein
4 4 4 9 RAFL04-10-K10 AY039948 Experimental RAFL04-10-K10 AV781912;AV821455;AY039948 predicted GPI-anchored protein
4 4 4 10 RAFL04-10-G06 AV821443 Experimental RAFL04-10-G06 AV781896;AV821443;AF370285 phosphatidylinositol-4-phosphate 5-kinase like protein
4 4 4 11 RAFL04-14-E18 AY035162 Experimental RAFL04-14-E18 AV782126;AV821616;AY035162 putative phosphatidyl-inositol-transfer protein
4 4 4 12 RAFL04-14-B14 AV782109 Experimental RAFL04-14-B14 AV782109 unknown
4 4 4 13 RAFL04-14-D08 AV821611 Experimental RAFL04-14-D08 AV782119;AV821611;AF370238 unknown protein
4 4 4 14 RAFL04-13-L21 AY034924 Experimental RAFL04-13-L21 AV782075;AV821574;AY034924 unknown protein
4 4 5 1 RAFL04-15-M01 AV821729 Experimental RAFL04-15-M01 AV782266;AV821729 D-xylose-H+ symporter - like protein
4 4 5 2 RAFL04-16-E03 AV821773 Experimental RAFL04-16-E03 AV782315;AV821773 hypothetical protein
4 4 5 3 RAFL04-17-B14 AY042873 Experimental RAFL04-17-B14 AV782392;AV821837;AY042873 H+-transporting ATP synthase chain 9 - like protein
4 4 5 4 RAFL04-16-O21 AV821824 Experimental RAFL04-16-O21 AV782378;AV821824;AF386975 flavanone 3-hydroxylase-like protein
4 4 5 5 RAFL04-16-L21 AY081260 Experimental RAFL04-16-L21 AV782365;AV821813;AY081260 putative protein
4 4 5 6 RAFL04-15-M13 AV821732 Experimental RAFL04-15-M13 AV782269;AV821732 HEAT SHOCK PROTEIN 81-2 (HSP81-2) (sp|P55737)
4 4 5 7 RAFL04-16-I15 BP560639 Experimental RAFL04-16-I15 AV782337;BP560639;AF370536 hevein-like protein precursor
4 4 5 8 RAFL04-16-N11 AY081252 Experimental RAFL04-16-N11 AV782373;AY081252 glutamate-ammonia ligase (EC 6.3.1.2) precursor, chloroplast (clone lambdaAtgsl1) (pir||S18600)
4 4 5 9 RAFL04-16-A07 AV821757 Experimental RAFL04-16-A07 AV782297;AV821757;AF370550 transfactor-like protein
4 4 5 10 RAFL04-16-G24 AY054594 Experimental RAFL04-16-G24 AV782329;AV821789;AY054594 acetylornithine transaminase like protein
4 4 5 11 RAFL04-16-A17 AY065190 Experimental RAFL04-16-A17 AV782300;AV821760;AY065190 unknown protein
4 4 5 12 RAFL04-15-P08 AY065075 Experimental RAFL04-15-P08 AV782290;AV821751;AY065075 UDP-glucuronic acid decarboxylase (UXS1)
4 4 5 13 RAFL04-16-N08 AV782372 Experimental RAFL04-16-N08 AV782372 Lil3 protein
4 4 5 14 RAFL04-16-L04 BP560645 Experimental RAFL04-16-L04 AV782358;BP560645;AY054683 predicted GPI-anchored protein
4 4 6 1 RAFL04-20-N10 AV822086 Experimental RAFL04-20-N10 AV782725;AV822086;AF389298 ras-related GTP-binding protein RHA1 (sp|P31582)
4 4 6 2 RAFL04-20-J04 AY049298 Experimental RAFL04-20-J04 AV782696;AV822064;AY049298 putative protein
4 4 6 3 RAFL04-20-M20 AV822083 Experimental RAFL04-20-M20 AV782720;AV822083;AF389291 unknown protein
4 4 6 4 RAFL04-20-L13 AY079021 Experimental RAFL04-20-L13 AV782714;AV822078;AY079021 unknown protein
4 4 6 5 RAFL04-20-L10 AV822077 Experimental RAFL04-20-L10 AV782713;AV822077;AF389280 cyclophilin protein (ROC10)
4 4 6 6 RAFL04-20-P03 AY124002 Experimental RAFL04-20-P03 AV782736;AV822093;AY124002
4 4 6 7 RAFL04-20-E07 AY039554 Experimental RAFL04-20-E07 AV782663;AV822040;AY039554 myb like transcription factor
4 4 6 8 RAFL04-20-F15 AY039553 Experimental RAFL04-20-F15 AV782672;AV822046;AY039553 unknown protein
4 4 6 9 RAFL04-20-D22 BP560691 Experimental RAFL04-20-D22 AV782660;BP560691;AY079025 unknown protein
4 4 6 10 RAFL04-20-D21 AY094412 Experimental RAFL04-20-D21 AV782659;AV822037;AY094412 putative receptor-like protein kinase
4 4 6 11 RAFL04-20-E20 AY065049 Experimental RAFL04-20-E20 AV782667;AV822043;AY065049 unknown protein
4 4 6 12 RAFL04-20-E04 AY139775 Experimental RAFL04-20-E04 AV782662;AV822039;AY139775 oligouridylate binding protein, putative
4 4 6 13 RAFL04-16-H12 AY081253 Experimental RAFL04-16-H12 AV782334;AV821793;AY081253 putative lipoxygenase
4 4 6 14 RAFL04-16-C09 AY081262 Experimental RAFL04-16-C09 AV782304;AV821765;AY081262 nuclear RNA binding protein A-like protein
4 4 7 1 RAFL05-10-A17 AV822661 Experimental RAFL05-10-A17 AV783475;AV822661 putative beta-ketoacyl-CoA synthase
4 4 7 2 RAFL05-10-A05 AY034909 Experimental RAFL05-10-A05 AV783472;AV822657;AY034909 unknown protein
4 4 7 3 RAFL05-01-N13 AY079030 Experimental RAFL05-01-N13 AV782811;AV822146;AY079030 unknown protein
4 4 7 4 RAFL05-01-J08 AY039552 Experimental RAFL05-01-J08 AV782792;AV822133;AY039552 putative NifU-like metallocluster assembly factor
4 4 7 5 RAFL05-01-E17 AY065052 Experimental RAFL05-01-E17 AV782770;AV822114;AY065052 CCAAT box binding factor/ transcription factor Hap2a
4 4 7 6 RAFL04-20-J03 AV782695 Experimental RAFL04-20-J03 AV782695 Ribosomal protein L7Ae - like (fragment)
4 4 7 7 RAFL04-20-H16 AV822057 Experimental RAFL04-20-H16 AV782684;AV822057;AF389284 predicted protein of unknown function
4 4 7 8 RAFL04-20-N09 AV822085 Experimental RAFL04-20-N09 AV782724;AV822085 putative protein
4 4 7 9 RAFL04-20-K18 AY065056 Experimental RAFL04-20-K18 AV782709;AV822074;AY065056 putative protein
4 4 7 10 RAFL04-20-K11 AY079026 Experimental RAFL04-20-K11 AV782707;AV822073;AY079026 peroxisomal-3-keto-acyl-CoA thiolase 1 (PKT1)
4 4 7 11 RAFL04-20-H02 AY049295 Experimental RAFL04-20-H02 AY049295 unknown protein
4 4 7 12 RAFL04-20-O21 AV822091 Experimental RAFL04-20-O21 AV782734;AV822091;AF389289 ABC transporter like protein
4 4 7 13 RAFL04-20-I11 AY094417 Experimental RAFL04-20-I11 AV782690;AV822060;AY094417 hypothetical protein
4 4 7 14 RAFL04-20-I24 AY049292 Experimental RAFL04-20-I24 AV782693;AV822062;AY049292 phytocyanin, blue copper-binding protein II
4 4 8 1 RAFL05-05-K10 AY045916 Experimental RAFL05-05-K10 AV783112;AV822369;AY045916 putative protein
4 4 8 2 RAFL05-05-K08 AY039968 Experimental RAFL05-05-K08 AV822368;AY039968 unknown protein
4 4 8 3 RAFL05-05-M16 AY034950 Experimental RAFL05-05-M16 AV783127;AV822378;AY034950 nematode resistance protein-like protein
4 4 8 4 RAFL05-05-M12 AY039955 Experimental RAFL05-05-M12 AV783126;AV822377;AY039955 dynamin, putative
4 4 8 5 RAFL05-10-F16 AV822687 Experimental RAFL05-10-F16 AV783506;AV822687;AF370183 putative serine rich protein
4 4 8 6 RAFL05-10-H11 AV822693 Experimental RAFL05-10-H11 AV783512;AV822693;AF324676 unknown protein
4 4 8 7 RAFL05-10-A07 AY039975 Experimental RAFL05-10-A07 AV783473;AV822658;AY039975 putative nucleoid chloroplast DNA-binding protein
4 4 8 8 RAFL05-10-B21 AV822662 Experimental RAFL05-10-B21 AV783478;AV822662;AF370347 unknown protein
4 4 8 9 RAFL05-10-D11 AY045929 Experimental RAFL05-10-D11 AV783490;AV822672;AY045929 putative lysophospholipase (At1g73480)
4 4 8 10 RAFL05-10-A21 AV783476 Experimental RAFL05-10-A21 AV783476;AF370310 unknown protein
4 4 8 11 RAFL05-10-E23 AY039980 Experimental RAFL05-10-E23 AV783500;AV822682;AY039980 unknown
4 4 8 12 RAFL05-10-D10 AY035030 Experimental RAFL05-10-D10 AV783489;AV822671;AY035030 beta-ketoacyl-CoA synthase
4 4 8 13 RAFL05-10-B02 BP560851 Experimental RAFL05-10-B02 AV783477;BP560851;AY035144 putative phosphoglycerate mutase
4 4 8 14 RAFL05-10-H03 AV822689 Experimental RAFL05-10-H03 AV783508;AV822689;AF326908
4 4 9 1 RAFL05-10-J03 AY120705 Experimental RAFL05-10-J03 AV783519;AV822699;AY120705 putative aminolevulinate dehydratase
4 4 9 2 RAFL05-10-P13 AY054644 Experimental RAFL05-10-P13 AV783561;AV822735;AY054644 NAM, no apical meristem, - like protein
4 4 9 3 RAFL05-10-I03 AY065088 Experimental RAFL05-10-I03 AV783515;AV822696;AY065088 unknown protein
4 4 9 4 RAFL05-10-J19 AV822705 Experimental RAFL05-10-J19 AV783524;AV822705;AF337913 POZ/BTB containing-protein AtPOB1
4 4 9 5 RAFL05-10-M11 AY059816 Experimental RAFL05-10-M11 AV822719;AY059816 putative 3-oxoacyl [acyl-carrier protein] reductase
4 4 9 6 RAFL05-10-L11 AV822715 Experimental RAFL05-10-L11 AV783535;AV822715 autophagocytosis protein - like
4 4 9 7 RAFL05-08-D18 AV822516 Experimental RAFL05-08-D18 AV783302;AV822516;AF370188 putative protein
4 4 9 8 RAFL05-08-C18 AV822508 Experimental RAFL05-08-C18 AV783292;AV822508;AF370164 hypothetical protein; similar to ESTs gb|T43487.1, gb|AA067480.1, gb|H76402.1, gb|AI999760.1
4 4 9 9 RAFL05-09-E15 BP560845 Experimental RAFL05-09-E15 AV783403;BP560845;AY035017 pyruvate dehydrogenase like kinase
4 4 9 10 RAFL05-09-D07 AY034973 Experimental RAFL05-09-D07 AV822590;AY034973 peroxidase like protein
4 4 9 11 RAFL05-07-N12 AY039963 Experimental RAFL05-07-N12 AV783254;AV822477;AY039963 putative WD-repeat protein
4 4 9 12 RAFL05-07-M06 AY034911 Experimental RAFL05-07-M06 AV783244;AV822468;AY034911 unknown protein
4 4 9 13 RAFL05-05-M24 AY039983 Experimental RAFL05-05-M24 AV783131;AV822382;AY039983 unknown protein
4 4 9 14 RAFL05-05-L23 AY080753 Experimental RAFL05-05-L23 AV783121;AV822374;AY080753
4 4 10 1 RAFL05-12-D20 AV822836 Experimental RAFL05-12-D20 AV783691;AV822836;AF370525 Medicago nodulin N21-like protein
4 4 10 2 RAFL05-11-E10 AY072316 Experimental RAFL05-11-E10 AV783585;AV822754;AY072316 unknown protein
4 4 10 3 RAFL05-13-D04 BP560912 Experimental RAFL05-13-D04 AV783793;BP560912;AY054612 Unknown protein (At2g37970; T8P21.12)
4 4 10 4 RAFL05-11-A17 AY128310 Experimental RAFL05-11-A17 AV783567;AV822739;AY128310 putative bHLH transcription factor (bHLH083)
4 4 10 5 RAFL05-11-M11 AY128309 Experimental RAFL05-11-M11 AV783644;AV822799;AY128309 putative AP2 domain transcription factor
4 4 10 6 RAFL05-11-G05 AY042859 Experimental RAFL05-11-G05 AV783602;AV822768;AY042859 putative mitochondrial uncoupling protein
4 4 10 7 RAFL05-11-B01 AV822742 Experimental RAFL05-11-B01 AV783570;AV822742;AF370544 cyclin delta-3 (F28A23.80)
4 4 10 8 RAFL05-10-N18 AV822726 Experimental RAFL05-10-N18 AV783549;AV822726 unknown protein
4 4 10 9 RAFL05-10-L06 AV822714 Experimental RAFL05-10-L06 AV783534;AV822714 alanine-glyoxylate aminotransferase
4 4 10 10 RAFL05-10-N23 AY065085 Experimental RAFL05-10-N23 AV783551;AV822728;AY065085 beta-1,3-glucanase like protein
4 4 10 11 RAFL05-10-K08 AY081270 Experimental RAFL05-10-K08 AV783526;AV822708;AY081270 unknown protein
4 4 10 12 RAFL05-10-L02 AV822712 Experimental RAFL05-10-L02 AV783531;AV822712
4 4 10 13 RAFL05-10-L17 BP560861 Experimental RAFL05-10-L17 AV783538;BP560861;AY054647 putative protein
4 4 10 14 RAFL05-10-P12 BP560866 Experimental RAFL05-10-P12 AV783560;BP560866 fimbrin-like protein (ATFIM1)
4 4 11 1 RAFL05-15-B03 AY070487 Experimental RAFL05-15-B03 AV783982;AY070487 putative UDP-galactose-4-epimerase
4 4 11 2 RAFL05-14-J24 AY048219 Experimental RAFL05-14-J24 AV783935;AV823039;AY048219 putative protein
4 4 11 3 RAFL05-14-H20 BP560930 Experimental RAFL05-14-H20 AV783918;BP560930;AY125525
4 4 11 4 RAFL05-15-G19 AV823107 Experimental RAFL05-15-G19 AV784023;AV823107
4 4 11 5 RAFL05-14-M16 AV823059 Experimental RAFL05-14-M16 AV783958;AV823059 hypothetical protein
4 4 11 6 RAFL05-14-I12 AY149440 Experimental RAFL05-14-I12 AV783925;AV823029;AY149440 amine oxidase, putative
4 4 11 7 RAFL05-14-H10 AY074585 Experimental RAFL05-14-H10 AV783914;AV823022;AY074585 unknown protein
4 4 11 8 RAFL05-15-C14 AY090252 Experimental RAFL05-15-C14 AV783993;AV823083;AY090252 hypothetical protein
4 4 11 9 RAFL05-15-B10 BP560944 Experimental RAFL05-15-B10 AV783983;BP560944;AY070484 unknown protein
4 4 11 10 RAFL05-15-E08 AY048209 Experimental RAFL05-15-E08 AV784009;AV823097;AY048209 putative inorganic pyrophosphatase
4 4 11 11 RAFL05-13-H06 AY081271 Experimental RAFL05-13-H06 AV783824;AV822945;AY081271 putative bHLH transcription factor (bHLH065)
4 4 11 12 RAFL05-13-A02 AV822903 Experimental RAFL05-13-A02 AV783772;AV822903
4 4 11 13 RAFL05-12-K23 AV822873 Experimental RAFL05-12-K23 AV783737;AV822873 unknown protein
4 4 11 14 RAFL05-12-A22 AY059804 Experimental RAFL05-12-A22 AV783667;AV822816;AY059804 Unknown protein (MAH20.14)
4 4 12 1 RAFL05-15-B18 BP560945 Experimental RAFL05-15-B18 AV783985;BP560945 putative protein
4 4 12 2 RAFL05-15-K12 AV823120 Experimental RAFL05-15-K12 AV784041;AV823120 Eukaryotic Initiation Factor 4A-2
4 4 12 3 RAFL05-15-P08 AY048227 Experimental RAFL05-15-P08 AV784071;AV823149;AY048227 cyclophilin ROC7
4 4 12 4 RAFL05-16-D21 AY070485 Experimental RAFL05-16-D21 AV784093;AV823168;AY070485 unknown protein
4 4 12 5 RAFL05-16-H11 AY149441 Experimental RAFL05-16-H11 AV784119;AV823190;AY149441 unknown protein
4 4 12 6 RAFL05-16-C09 AY070479 Experimental RAFL05-16-C09 AV784086;AV823163;AY070479 nucleoid DNA-binding - like protein
4 4 12 7 RAFL05-15-K08 AV823119 Experimental RAFL05-15-K08 AV784040;AV823119 xylose isomerase
4 4 12 8 RAFL05-15-B01 AY048233 Experimental RAFL05-15-B01 AV783981;AV823075;AY048233 stearoyl-ACP desaturase
4 4 12 9 RAFL05-14-N22 AY090256 Experimental RAFL05-14-N22 AV783967;AV823063;AY090256 putative acyl-CoA binding protein
4 4 12 10 RAFL05-14-K20 AY074579 Experimental RAFL05-14-K20 AV783943;AV823045;AY074579 unknown protein
4 4 12 11 RAFL05-14-J18 AY070482 Experimental RAFL05-14-J18 AV823037;AY070482 unknown protein
4 4 12 12 RAFL05-15-N23 AY048216 Experimental RAFL05-15-N23 AV784067;AV823145;AY048216 unknown protein
4 4 12 13 RAFL05-15-H14 AY074587 Experimental RAFL05-15-H14 AV784027;AV823111;AY074587 3-isopropylmalate dehydrogenase
4 4 12 14 RAFL05-14-I04 AY139758 Experimental RAFL05-14-I04 AV783922;AV823026;AY139758 hypothetical protein
4 4 13 1 RAFL05-18-N02 AV823406 Experimental RAFL05-18-N02 AV784364;AV823406 putative protein
4 4 13 2 RAFL05-19-A12 AY080755 Experimental RAFL05-19-A12 AV784384;AV823425;AY080755 putative protein
4 4 13 3 RAFL05-18-H06 AV823366 Experimental RAFL05-18-H06 AV784318;AV823366 putative protein
4 4 13 4 RAFL05-18-K02 AV823388 Experimental RAFL05-18-K02 AV784343;AV823388 unknown protein
4 4 13 5 RAFL05-18-L23 AY080774 Experimental RAFL05-18-L23 AV823402;AY080774 phospholipase like protein
4 4 13 6 RAFL05-18-D20 AV823349 Experimental RAFL05-18-D20 AV784297;AV823349 putative protein
4 4 13 7 RAFL05-18-H15 AV823371 Experimental RAFL05-18-H15 AV784323;AV823371 similar to O-succinylhomoserine sulfhydrylase
4 4 13 8 RAFL05-18-M07 AY051001 Experimental RAFL05-18-M07 AV784361;AV823404;AY051001 putative sucrose synthetase
4 4 13 9 RAFL05-18-J12 AY080880 Experimental RAFL05-18-J12 AV784338;AV823383;AY080880 unknown protein
4 4 13 10 RAFL05-18-K07 AY080867 Experimental RAFL05-18-K07 AV784345;AV823390;AY080867 adenylosuccinate lyase-like protein
4 4 13 11 RAFL05-19-B03 AY045834 Experimental RAFL05-19-B03 AV784388;AY045834 beta-amylase
4 4 13 12 RAFL05-18-K19 AY045804 Experimental RAFL05-18-K19 AV784350;AV823394;AY045804 alpha-soluble NSF attachment like protein
4 4 13 13 RAFL05-18-I12 AY045981 Experimental RAFL05-18-I12 AV784330;AV823376;AY045981 unknown protein
4 4 13 14 RAFL05-18-L03 AY045951 Experimental RAFL05-18-L03 AV784353;AY045951 cell division protease FtsH, putative
4 4 14 1 RAFL06-10-F06 AY062783 Experimental RAFL06-10-F06 AV785005;AV823920;AY062783 dof6 zinc finger protein
4 4 14 2 RAFL06-10-C04 AY128401 Experimental RAFL06-10-C04 AV784976;AV823896;AY128401 putative protein
4 4 14 3 RAFL06-11-I10 AV823983 Experimental RAFL06-11-I10 AV785088;AV823983 putative folylpolyglutamate synthetase
4 4 14 4 RAFL06-11-E05 BT002416 Experimental RAFL06-11-E05 AV785065;AV823966;BT002416
4 4 14 5 RAFL05-18-K13 AY074351 Experimental RAFL05-18-K13 AV784348;AV823393;AY074351 putative protein
4 4 14 6 RAFL05-18-F05 BP561002 Experimental RAFL05-18-F05 AV784304;BP561002;AY074342 unknown protein
4 4 14 7 RAFL05-18-L01 AY045839 Experimental RAFL05-18-L01 AV784352;AV823396;AY045839 unknown protein
4 4 14 8 RAFL05-18-H22 AY080768 Experimental RAFL05-18-H22 AV784326;AV823372;AY080768 putative arginase
4 4 14 9 RAFL05-18-G17 AV823361 Experimental RAFL05-18-G17 AV784313;AV823361 protein kinase (cdc2)
4 4 14 10 RAFL05-18-N06 BP561009 Experimental RAFL05-18-N06 AV784365;BP561009;AY045954 unknown protein
4 4 14 11 RAFL05-18-K24 AY074350 Experimental RAFL05-18-K24 AV784351;AV823395;AY074350 profilin 2
4 4 14 12 RAFL05-18-N15 AY074340 Experimental RAFL05-18-N15 AV784368;AV823409;AY074340 unknown protein
4 4 14 13 RAFL05-18-N11 AY059729 Experimental RAFL05-18-N11 AV784366;AV823407;AY059729 receptor kinase-like protein
4 4 14 14 RAFL05-18-J06 AY056222 Experimental RAFL05-18-J06 AV784337;AV823382;AY056222 phosphoprotein phosphatase 2A isoform 4
5 1 1 1 RAFL06-08-D11 AY062840 Experimental RAFL06-08-D11 AV823745;AY062840 unknown protein
5 1 1 2 RAFL06-09-J08 AY059938 Experimental RAFL06-09-J08 AV784927;AV823857;AY059938 unknown protein
5 1 1 3 RAFL06-09-H15 AY062839 Experimental RAFL06-09-H15 AY062839 putative chloroplast protein CP12
5 1 1 4 RAFL06-09-G03 AY128410 Experimental RAFL06-09-G03 AV784905;AV823840;AY128410 putative protein
5 1 1 5 RAFL06-09-F01 AY065153 Experimental RAFL06-09-F01 AV784894;AV823831;AY065153 putative protein
5 1 1 6 RAFL06-09-D14 AV823822 Experimental RAFL06-09-D14 AV784883;AV823822 NWMU2 - 2S albumin 2 precursor
5 1 1 7 RAFL06-10-D01 AY062831 Experimental RAFL06-10-D01 AV784985;AV823904;AY062831
5 1 1 8 RAFL06-10-C01 AY065149 Experimental RAFL06-10-C01 AV784975;AV823895;AY065149 unknown protein
5 1 1 9 RAFL06-11-I04 AY065148 Experimental RAFL06-11-I04 AV785087;AV823982;AY065148 unknown protein
5 1 1 10 RAFL06-11-E04 AY062829 Experimental RAFL06-11-E04 AV785064;AV823965;AY062829 unknown protein
5 1 1 11 RAFL06-10-O13 AY065147 Experimental RAFL06-10-O13 AV785042;AY065147 unknown protein (At1g70180)
5 1 1 12 RAFL06-10-F03 BP561118 Experimental RAFL06-10-F03 BP561118;AY065146 unknown protein
5 1 1 13 RAFL06-10-H12 AY093001 Experimental RAFL06-10-H12 AV785017;AV823929;AY093001 stress-induced protein OZI1 precursor
5 1 1 14 RAFL06-10-D20 AY062822 Experimental RAFL06-10-D20 AV784991;AV823910;AY062822 putative protein
5 1 2 1 RAFL06-13-A09 AY094440 Experimental RAFL06-13-A09 AV785203;AV824065;AY094440 unknown
5 1 2 2 RAFL06-16-J02 AV824250 Experimental RAFL06-16-J02 AV785461;AV824250;AF410267 unknown protein
5 1 2 3 RAFL06-13-E13 AV785220 Experimental RAFL06-13-E13 AV785220;AF410332
5 1 2 4 RAFL06-15-H18 AV824178 Experimental RAFL06-15-H18 AV824178;AF410315 light regulated protein, putative
5 1 2 5 RAFL06-15-F22 AV824172 Experimental RAFL06-15-F22 AV785348;AV824172;AF410313 caltractin like protein
5 1 2 6 RAFL06-15-B17 AY048294 Experimental RAFL06-15-B17 AV785330;AV824161;AY048294 aquaporin (plasma membrane intrinsic protein 1B)
5 1 2 7 RAFL06-16-K15 AV824256 Experimental RAFL06-16-K15 AV785471;AV824256;AF410288 gibberellin 20-oxidase - like protein
5 1 2 8 RAFL06-14-F15 AV824148 Experimental RAFL06-14-F15 AV785312;AV824148;AF410275 unknown protein
5 1 2 9 RAFL06-09-D22 AV823824 Experimental RAFL06-09-D22 AV784885;AV823824 unknown protein
5 1 2 10 RAFL06-09-B20 AY062845 Experimental RAFL06-09-B20 AV784874;AV823815;AY062845 putative RING zinc finger protein
5 1 2 11 RAFL06-07-I03 AY072348 Experimental RAFL06-07-I03 AV784698;AV823684;AY072348 hypothetical protein
5 1 2 12 RAFL06-08-N04 BP561096 Experimental RAFL06-08-N04 AV784842;BP561096
5 1 2 13 RAFL06-08-J24 AY120779 Experimental RAFL06-08-J24 AV784821;AV823773;AY120779 ACTIN 2/7 (sp|P53492)
5 1 2 14 RAFL06-08-F04 BT002443 Experimental RAFL06-08-F04 AV784790;AV823753;BT002443 unknown protein
5 1 3 1 RAFL06-15-M10 AV824191 Experimental RAFL06-15-M10 AV785380;AV824191;AF410310 RNA and export factor binding protein, putative
5 1 3 2 RAFL06-13-C10 BP561157 Experimental RAFL06-13-C10 BP561157 Mlo like protein
5 1 3 3 RAFL06-15-G10 AV824173 Experimental RAFL06-15-G10 AV785351;AV824173;AF410281 AIG2-like protein
5 1 3 4 RAFL06-15-D17 AV785340 Experimental RAFL06-15-D17 AV785340;AF410272 unknown protein
5 1 3 5 RAFL06-13-I15 AV824102 Experimental RAFL06-13-I15 AV785250;AV824102;AF410339 unknown protein
5 1 3 6 RAFL06-13-H13 BP561162 Experimental RAFL06-13-H13 AV785241;BP561162;AF410323 unknown protein
5 1 3 7 RAFL06-15-M08 AY094443 Experimental RAFL06-15-M08 AV785379;AV824190;AY094443 fasciclin-like arabinogalactan protein FLA8
5 1 3 8 RAFL06-15-K14 AV824185 Experimental RAFL06-15-K14 AV785370;AV824185;AF410299 putative NAM (no apical meristem)-like protein
5 1 3 9 RAFL06-13-A12 AV824066 Experimental RAFL06-13-A12 AV785204;AV824066;AF410287 putative cell wall-plasma membrane disconnecting CLCT protein (AIR1A)
5 1 3 10 RAFL06-12-P08 AV824054 Experimental RAFL06-12-P08 AV785194;AV824054;AF410264 unknown protein
5 1 3 11 RAFL06-13-I10 AY125511 Experimental RAFL06-13-I10 AV824101;AY125511 putative protein
5 1 3 12 RAFL06-13-H12 AY094441 Experimental RAFL06-13-H12 AV824093;AY094441 Short-chain acyl CoA oxidase
5 1 3 13 RAFL06-13-E14 AV785221 Experimental RAFL06-13-E14 AV785221;AF410308 globulin like protein
5 1 3 14 RAFL06-13-C07 AV785212 Experimental RAFL06-13-C07 AV785212;AF410296 AT4g03280/F4C21_21
5 1 4 1 RAFL07-08-A21 AY045884 Experimental RAFL07-08-A21 AV790918;AV825306;AY045884 putative protein
5 1 4 2 RAFL07-08-F20 AY080799 Experimental RAFL07-08-F20 AV790995;AY080799 PRT1
5 1 4 3 RAFL07-08-N19 AY050873 Experimental RAFL07-08-N19 AV791105;AV825371;AY050873 putative protein phosphatase 2C
5 1 4 4 RAFL07-08-J19 AY045903 Experimental RAFL07-08-J19 AV791053;AV825351;AY045903 adenine nucleotide translocase
5 1 4 5 RAFL07-08-E19 AY059775 Experimental RAFL07-08-E19 AV790978;AV825325;AY059775
5 1 4 6 RAFL07-08-N18 AY080831 Experimental RAFL07-08-N18 AV791104;AV825370;AY080831 serine protease-like protein
5 1 4 7 RAFL07-08-O14 BP561426 Experimental RAFL07-08-O14 AV791115;BP561426 putative protein
5 1 4 8 RAFL07-08-K14 AY050896 Experimental RAFL07-08-K14 AV791065;AV825355;AY050896 heat-shock protein (At-hsc70-3)
5 1 4 9 RAFL07-08-G14 AY046041 Experimental RAFL07-08-G14 AV791006;AV825333;AY046041 40S ribosomal protein; contains C-terminal domain
5 1 4 10 RAFL07-08-B14 AY059733 Experimental RAFL07-08-B14 AV790929;AV825309;AY059733 unknown protein
5 1 4 11 RAFL07-08-O13 BP561425 Experimental RAFL07-08-O13 AV791114;BP561425 unknown protein
5 1 4 12 RAFL07-08-K13 AY056202 Experimental RAFL07-08-K13 AV791064;AV825354;AY056202 unknown protein
5 1 4 13 RAFL06-13-I16 AV824103 Experimental RAFL06-13-I16 AV785251;AV824103;AF410328 unknown protein
5 1 4 14 RAFL06-13-H14 AV824094 Experimental RAFL06-13-H14 AV785242;AV824094;AF410318 31 kDa RNA binding protein (rbp31)
5 1 5 1 RAFL07-12-F16 AY081311 Experimental RAFL07-12-F16 AV791863;AY081311 unknown protein
5 1 5 2 RAFL07-12-L15 AY062473 Experimental RAFL07-12-L15 AV791949;AY062473 putative pyrophosphate-fructose-6-phosphate 1-phosphotransferase
5 1 5 3 RAFL07-09-L10 BP561435 Experimental RAFL07-09-L10 AV791262;BP561435;AY056302 unknown protein
5 1 5 4 RAFL07-09-B09 AV825386 Experimental RAFL07-09-B09 AV791146;AV825386 small Ras-like GTP-binding protein
5 1 5 5 RAFL07-09-O08 AY045905 Experimental RAFL07-09-O08 AV791298;AV825447;AY045905 putative protein
5 1 5 6 RAFL07-09-D08 AY059734 Experimental RAFL07-09-D08 AV791173;AV825394;AY059734 NAC2-like protein
5 1 5 7 RAFL07-09-N07 AY064004 Experimental RAFL07-09-N07 AV791287;AV825440;AY064004 unknown protein
5 1 5 8 RAFL07-09-J05 BT000658 Experimental RAFL07-09-J05 AV791240;BP561433;BT000658 ubiquitin-specific protease 6 (UBP6)
5 1 5 9 RAFL07-09-I02 AY050797 Experimental RAFL07-09-I02 AV791230;AV825414;AY050797 putative protein
5 1 5 10 RAFL07-09-G02 AY051009 Experimental RAFL07-09-G02 AV791203;AV825404;AY051009 putative serine protease
5 1 5 11 RAFL07-09-M01 AY045904 Experimental RAFL07-09-M01 AV791270;AV825432;AY045904 unknown protein
5 1 5 12 RAFL07-09-K01 AV825422 Experimental RAFL07-09-K01 AV791248;AV825422 glucosyltransferase like protein
5 1 5 13 RAFL07-09-D01 AY080838 Experimental RAFL07-09-D01 AV791169;AY080838 putative protein
5 1 5 14 RAFL07-08-J24 AY080832 Experimental RAFL07-08-J24 AV791056;AV825352;AY080832 auxin response factor 4
5 1 6 1 RAFL07-13-P10 AV792210 Experimental RAFL07-13-P10 AV792210
5 1 6 2 RAFL07-13-M09 AY081313 Experimental RAFL07-13-M09 AV792171;AY081313
5 1 6 3 RAFL07-13-K09 AV792151 Experimental RAFL07-13-K09 AV792151 putative potassium transport protein
5 1 6 4 RAFL07-13-H08 AY081302 Experimental RAFL07-13-H08 AV792104;AY081302 heat shock protein 90
5 1 6 5 RAFL07-13-E01 AY062484 Experimental RAFL07-13-E01 AV792064;AV825711;AY062484 plasma membrane-type calcium ATPase (ACA2)
5 1 6 6 RAFL07-12-E24 AV825655 Experimental RAFL07-12-E24 AV791854;AV825655 tri-thorax like protein (At1g05830)
5 1 6 7 RAFL07-12-I23 AY062483 Experimental RAFL07-12-I23 AV791908;AV825666;AY062483 putative glucosyltransferase
5 1 6 8 RAFL07-12-F22 AY062481 Experimental RAFL07-12-F22 AV791867;AY062481 putative beta-fructosidase (At1g62660)
5 1 6 9 RAFL07-12-C22 BT002413 Experimental RAFL07-12-C22 AV791824;BT002413 GPAA1 - like protein
5 1 6 10 RAFL07-12-N21 AY062478 Experimental RAFL07-12-N21 AV791984;AY062478 unknown protein
5 1 6 11 RAFL07-12-J17 AY054489 Experimental RAFL07-12-J17 AV791920;AV825671;AY054489
5 1 6 12 RAFL07-12-D17 AY062472 Experimental RAFL07-12-D17 AV791836;AV825646;AY062472 xyloglucan endo-1,4-beta-D-glucanase (XTR-6)
5 1 6 13 RAFL07-12-A17 AV791796 Experimental RAFL07-12-A17 AV791796 unknown protein
5 1 6 14 RAFL07-12-K16 AY065071 Experimental RAFL07-12-K16 AV791936;AY065071 putative protein
5 1 7 1 RAFL07-18-B05 AV825963 Experimental RAFL07-18-B05 AV793090;AV825963;AF462855 putative cytochrome P450 monooxygenase
5 1 7 2 RAFL07-18-K04 BP561513 Experimental RAFL07-18-K04 AV793233;BP561513;AY049274 Similar to beta-glucosidases (At1g02850)
5 1 7 3 RAFL07-18-K03 AY049266 Experimental RAFL07-18-K03 AV793232;AV826003;AY049266 diaminopimelate decarboxylase - like protein
5 1 7 4 RAFL07-18-H03 AY065010 Experimental RAFL07-18-H03 AV793191;AV825991;AY065010 unknown protein
5 1 7 5 RAFL07-18-L02 AY049251 Experimental RAFL07-18-L02 AV793250;AV826007;AY049251 60S ribosomal protein L30
5 1 7 6 RAFL07-18-A02 AV825958 Experimental RAFL07-18-A02 AV793076;AV825958;AF462846 unknown protein
5 1 7 7 RAFL07-13-L20 AY062499 Experimental RAFL07-13-L20 AV792169;AV825734;AY062499 putative protein kinase
5 1 7 8 RAFL07-13-D20 AY054500 Experimental RAFL07-13-D20 AV792061;AV825709;AY054500 putative proteasome regulatory subunit
5 1 7 9 RAFL07-13-M19 BT000445 Experimental RAFL07-13-M19 AV792176;BT000445 hypothetical protein
5 1 7 10 RAFL07-13-J18 AY059849 Experimental RAFL07-13-J18 AV792141;AY059849 40S ribosomal protein S5
5 1 7 11 RAFL07-13-L17 AV792167 Experimental RAFL07-13-L17 AV792167 inorganic pyrophosphatase -like protein
5 1 7 12 RAFL07-13-A17 AY054499 Experimental RAFL07-13-A17 AV792022;AY054499 prohibitin (gb|AAC49691.1)
5 1 7 13 RAFL07-13-K13 AY062492 Experimental RAFL07-13-K13 AV792153;AV825730;AY062492 putative VP1/ABI3 family regulatory protein
5 1 7 14 RAFL07-13-J11 BT002048 Experimental RAFL07-13-J11 AV792137;AV825726;BT002048 unknown protein
5 1 8 1 RAFL07-18-C21 BP561509 Experimental RAFL07-18-C21 AV793118;BP561509;AY049249 H+-transporting ATPase 16K chain P2, vacuolar
5 1 8 2 RAFL07-18-J20 AY049242 Experimental RAFL07-18-J20 AV793228;AY049242 ribitol dehydrogenase-like
5 1 8 3 RAFL07-18-P17 AY049280 Experimental RAFL07-18-P17 AV793328;AV826027;AY049280
5 1 8 4 RAFL07-18-I17 BP561511 Experimental RAFL07-18-I17 AV793212;BP561511;AY049271 transposon protein, putative
5 1 8 5 RAFL07-18-G17 AV825990 Experimental RAFL07-18-G17 AV793183;AV825990;AF462852
5 1 8 6 RAFL07-18-B17 AY049257 Experimental RAFL07-18-B17 AV793098;AV825965;AY049257 unknown protein
5 1 8 7 RAFL07-18-I16 AV793211 Experimental RAFL07-18-I16 AV793211 unknown protein
5 1 8 8 RAFL07-18-B16 AV825964 Experimental RAFL07-18-B16 AV793097;AV825964 ABC transporter - like protein
5 1 8 9 RAFL07-18-F12 AV825987 Experimental RAFL07-18-F12 AV793163;AV825987 unknown protein
5 1 8 10 RAFL07-18-L11 BP561515 Experimental RAFL07-18-L11 AV793257;BP561515;AY049278 unknown protein
5 1 8 11 RAFL07-18-P10 BP561518 Experimental RAFL07-18-P10 AV793322;BP561518;AY049264 unknown protein
5 1 8 12 RAFL07-18-J10 AY049259 Experimental RAFL07-18-J10 AV793224;AV826001;AY049259
5 1 8 13 RAFL07-18-P09 AV793321 Experimental RAFL07-18-P09 AV793321 putative Ta11-like non-LTR retroelement protein
5 1 8 14 RAFL07-18-I09 AY065001 Experimental RAFL07-18-I09 AV793209;AV825996;AY065001
5 1 9 1 RAFL08-12-I10 AY050943 Experimental RAFL08-12-I10 AV794359;AY050943 unknown protein
5 1 9 2 RAFL08-12-O09 AY050974 Experimental RAFL08-12-O09 AV794442;AV826335;AY050974 Serine/arginine-rich protein
5 1 9 3 RAFL08-12-A09 AY056236 Experimental RAFL08-12-A09 AV794237;AV826274;AY056236 unknown protein
5 1 9 4 RAFL08-12-J08 AY050917 Experimental RAFL08-12-J08 AV794373;AV826314;AY050917 unknown protein
5 1 9 5 RAFL08-12-A05 AY056182 Experimental RAFL08-12-A05 AV794234;AV826272;AY056182 NADH dehydrogenase (ubiquinone)
5 1 9 6 RAFL08-12-H04 BT000812 Experimental RAFL08-12-H04 AV794338;AV826307;BT000812 putative nitrate transporter
5 1 9 7 RAFL08-12-E04 AY056272 Experimental RAFL08-12-E04 AV794290;AV826293;AY056272 uncoupling protein (ucp/PUMP)
5 1 9 8 RAFL08-12-A04 AY050932 Experimental RAFL08-12-A04 AV794233;AV826271;AY050932 superoxidase dismutase
5 1 9 9 RAFL08-12-I03 BP561569 Experimental RAFL08-12-I03 AV794354;BP561569;AY056233 histidyl-tRNA synthetase
5 1 9 10 RAFL08-12-D03 AY050809 Experimental RAFL08-12-D03 AV794276;AV826286;AY050809 putative protein
5 1 9 11 RAFL07-18-E24 AY049289 Experimental RAFL07-18-E24 AV793155;AV825985;AY049289 putative 1-aminocyclopropane-1-carboxylate oxidase
5 1 9 12 RAFL07-18-M23 AY049273 Experimental RAFL07-18-M23 AV793277;AV826013;AY049273 hypothetical protein
5 1 9 13 RAFL07-18-O21 AV826025 Experimental RAFL07-18-O21 AV793314;AV826025;AF462850 unknown protein
5 1 9 14 RAFL07-18-M21 AY049254 Experimental RAFL07-18-M21 AV793275;AV826012;AY049254 putative transcription factor IIA large subunit protein
5 1 10 1 RAFL08-13-D04 AY080624 Experimental RAFL08-13-D04 AV794509;AV826351;AY080624 putative hexose transporter
5 1 10 2 RAFL08-13-B03 BP561575 Experimental RAFL08-13-B03 AV794481;BP561575 GTPase activator protein of Rab-like small GTPases-like protein
5 1 10 3 RAFL08-13-F02 AY056318 Experimental RAFL08-13-F02 AV794539;AV826356;AY056318 selenium-binding protein-like
5 1 10 4 RAFL08-13-K01 BT000700 Experimental RAFL08-13-K01 AV794611;AV826373;BT000700 G-box binding bZIP transcription factor GBF5 / AtbZip2
5 1 10 5 RAFL08-12-L24 AY050826 Experimental RAFL08-12-L24 AV794412;AV826327;AY050826 putative ribosomal-protein S6 kinase (ATPK19)
5 1 10 6 RAFL08-12-I24 AV794367 Experimental RAFL08-12-I24 AV794367 unknown protein
5 1 10 7 RAFL08-12-I18 AY059798 Experimental RAFL08-12-I18 AV794363;AV826311;AY059798 putative alcohol dehydrogenase
5 1 10 8 RAFL08-12-D18 BT000734 Experimental RAFL08-12-D18 AV794285;AV826291;BT000734 geranylgeranyl reductase
5 1 10 9 RAFL08-12-L17 BT000705 Experimental RAFL08-12-L17 AV794409;AV826326;BT000705 Unknown protein (F24O1.10)
5 1 10 10 RAFL08-12-G17 BT000676 Experimental RAFL08-12-G17 AV794330;AV826305;BT000676 AALP protein
5 1 10 11 RAFL08-12-E16 BP561568 Experimental RAFL08-12-E16 AV794298;BP561568;AY080802 unknown protein (At1g22620)
5 1 10 12 RAFL08-12-B15 AY050811 Experimental RAFL08-12-B15 AV794257;AV826279;AY050811 phosphate/triose-phosphate translocator precursor (gb|AAC83815.1)
5 1 10 13 RAFL08-12-B11 AY063911 Experimental RAFL08-12-B11 AV794254;AV826277;AY063911 unknown protein
5 1 10 14 RAFL08-12-L10 AY059793 Experimental RAFL08-12-L10 AV794406;AV826324;AY059793 putative protein
5 1 11 1 RAFL08-19-E03 AV826619 Experimental RAFL08-19-E03 AV795813;AV826619 putative thioredoxin
5 1 11 2 RAFL08-19-A01 AY062733 Experimental RAFL08-19-A01 AV795755;AY062733 putative retroelement pol polyprotein
5 1 11 3 RAFL08-18-A19 AY059896 Experimental RAFL08-18-A19 AV795534;AV826565;AY059896 similar to DNA binding protein (At1g23260)
5 1 11 4 RAFL08-18-D18 AY062587 Experimental RAFL08-18-D18 AV795580;AV826576;AY062587 protein phosphatase 2C-like protein
5 1 11 5 RAFL08-18-J17 AY120761 Experimental RAFL08-18-J17 AV795662;AV826594;AY120761
5 1 11 6 RAFL08-18-E17 AV826580 Experimental RAFL08-18-E17 AV795591;AV826580 hypothetical protein
5 1 11 7 RAFL08-18-O15 AY059895 Experimental RAFL08-18-O15 AV795737;AV826608;AY059895 unknown protein
5 1 11 8 RAFL08-18-F15 AY062722 Experimental RAFL08-18-F15 AV795605;AY062722 unknown protein
5 1 11 9 RAFL08-18-I11 BT002039 Experimental RAFL08-18-I11 AV795647;BP561632;BT002039 hypothetical protein
5 1 11 10 RAFL08-18-M10 AY062717 Experimental RAFL08-18-M10 AV795701;AV826603;AY062717 histone H4-like protein
5 1 11 11 RAFL08-18-C10 AY062582 Experimental RAFL08-18-C10 AV795559;AY062582 fructose bisphosphate aldolase like protein
5 1 11 12 RAFL08-18-L09 AY062715 Experimental RAFL08-18-L09 AV795684;AV826601;AY062715 zinc finger protein OBP2 like
5 1 11 13 RAFL08-18-G09 AY062581 Experimental RAFL08-18-G09 AV795618;AV826584;AY062581 putative translation initiation factor EIF-2B alpha subunit
5 1 11 14 RAFL08-18-P08 AY062579 Experimental RAFL08-18-P08 AV795745;AV826610;AY062579 putative protein
5 1 12 5 RAFL08-19-A17 AY062745 Experimental RAFL08-19-A17 AV795768;AY062745 Unknown protein (At1g55150; T7N22.9)
5 1 12 6 RAFL08-19-L15 AY062605 Experimental RAFL08-19-L15 AV795910;AV826634;AY062605 photosystem II 5 kD protein precursor
5 1 12 7 RAFL08-19-N14 AY120762 Experimental RAFL08-19-N14 AV795936;AV826640;AY120762 KNAT3 homeodomain protein
5 1 12 8 RAFL08-19-N11 AY062603 Experimental RAFL08-19-N11 AV795934;AV826639;AY062603 putative protein
5 1 12 9 RAFL08-19-J11 AY062602 Experimental RAFL08-19-J11 AV795880;AV826629;AY062602 unknown protein
5 1 12 10 RAFL08-19-F11 BT002387 Experimental RAFL08-19-F11 AV795826;BT002387
5 1 12 11 RAFL08-19-I05 AY062736 Experimental RAFL08-19-I05 AV795862;AV826626;AY062736 telomere repeat binding factor 1 (TRB1)/DNA-binding protein PcMYB1, putative
5 1 12 12 RAFL08-19-P04 AY062735 Experimental RAFL08-19-P04 AV795954;AV826642;AY062735 similar to mammalian MHC III region protein G9a
5 1 12 13 RAFL08-19-J04 AY062593 Experimental RAFL08-19-J04 AV795874;AV826627;AY062593 putative spermidine synthase
5 1 12 14 RAFL08-19-A04 AY062592 Experimental RAFL08-19-A04 AV795757;AV826611;AY062592 unknown protein
5 1 13 1 RAFL09-09-L03 AV796816 Experimental RAFL09-09-L03 AV796816 putative O-linked GlcNAc transferase
5 1 13 2 RAFL09-09-J03 AY128282 Experimental RAFL09-09-J03 AV796776;AV826920;AY128282 unknown protein
5 1 13 3 RAFL09-09-H03 AY090354 Experimental RAFL09-09-H03 AV796741;AY090354 peptide transporter PTR2-B, putative
5 1 13 4 RAFL09-09-C03 AV826873 Experimental RAFL09-09-C03 AV796652;AV826873 putative protein
5 1 13 5 RAFL09-09-I02 AV826908 Experimental RAFL09-09-I02 AV796758;AV826908 H+-transporting ATP synthase beta chain (mitochondrial) -like protein
5 1 13 6 RAFL09-09-F02 AY090348 Experimental RAFL09-09-F02 AV796704;AY090348 unknown protein
5 1 14 1 RAFL09-12-B06 AV827169 Experimental RAFL09-12-B06 AV797424;AV827169;AF367304
5 1 14 2 RAFL09-12-N05 AY094394 Experimental RAFL09-12-N05 AV797617;AV827240;AY094394 cycloartenol synthase
5 1 14 3 RAFL09-12-B03 AV827167 Experimental RAFL09-12-B03 AV797422;AV827167;AF367320 beta-glucosidase
5 1 14 4 RAFL09-12-M02 AV827232 Experimental RAFL09-12-M02 AV797596;AV827232;AF361614 putative protein
5 1 14 5 RAFL09-12-G02 AY094393 Experimental RAFL09-12-G02 AV797504;AV827201;AY094393 pseudo-response regulator 1
5 1 14 6 RAFL09-12-N01 AY037178 Experimental RAFL09-12-N01 AV797613;AV827238;AY037178
5 1 14 7 RAFL09-12-E01 AY048200 Experimental RAFL09-12-E01 AV797471;AY048200 protein kinase, putative
5 1 14 8 RAFL09-11-H24 AV797279 Experimental RAFL09-11-H24 AV797279;AF367300 unknown protein
5 1 14 9 RAFL09-09-G07 AY128291 Experimental RAFL09-09-G07 AV796725;AY128291 hypothetical protein
5 1 14 10 RAFL09-09-B07 AV796637 Experimental RAFL09-09-B07 AV796637 putative protein
5 1 14 11 RAFL09-09-O06 AV796872 Experimental RAFL09-09-O06 AV796872
5 1 14 12 RAFL09-09-M06 AY090352 Experimental RAFL09-09-M06 AV796836;AV826942;AY090352 putative protein
5 1 14 13 RAFL09-09-D06 BP561670 Experimental RAFL09-09-D06 AV796668;BP561670;AF462820 unknown protein
5 1 14 14 RAFL09-09-O05 AY090349 Experimental RAFL09-09-O05 AV796871;AY090349 2-dehydro-3-deoxyphosphoheptonate aldolase
5 2 1 1 RAFL06-07-A09 AV823643 Experimental RAFL06-07-A09 AV784647;AV823643 unknown protein
5 2 1 2 RAFL06-07-B18 AY080779 Experimental RAFL06-07-B18 AV784655;AV823650;AY080779 NWMU3 - 2S albumin 3 precursor
5 2 1 3 RAFL06-07-D06 AY080773 Experimental RAFL06-07-D06 AV784665;AV823658;AY080773 unknown protein
5 2 1 4 RAFL06-07-E15 AY045801 Experimental RAFL06-07-E15 AV784675;AV823666;AY045801 unknown protein
5 2 1 5 RAFL06-07-A05 AY045977 Experimental RAFL06-07-A05 AV784645;AV823641;AY045977 putative protein
5 2 1 6 RAFL06-07-C24 AV823656 Experimental RAFL06-07-C24 AV784663;AV823656 putative isocitrate lyase
5 2 1 7 RAFL05-20-O07 AY074347 Experimental RAFL05-20-O07 AV823539;AY074347
5 2 1 8 RAFL05-20-M01 AY045861 Experimental RAFL05-20-M01 AV784516;AY045861 protein kinase C inhibitor-like protein
5 2 1 9 RAFL05-21-A20 BP561039 Experimental RAFL05-21-A20 AV784546;BP561039;AY050770 unknown protein
5 2 1 10 RAFL05-21-P15 AY091133 Experimental RAFL05-21-P15 AV784636;AV823632;AY091133 cyclic nucleotide and calmodulin-regulated ion channel (emb|CAB40130.1)
5 2 1 11 RAFL05-21-L12 AY045974 Experimental RAFL05-21-L12 AV784610;AV823606;AY045974 putative heat shock protein
5 2 1 12 RAFL05-21-M07 AV823613 Experimental RAFL05-21-M07 AV784616;AV823613 drought-inducible cysteine proteinase RD19A precursor
5 2 1 13 RAFL05-20-L15 AV823527 Experimental RAFL05-20-L15 AV823527 putative protein
5 2 1 14 RAFL05-20-L07 AY045858 Experimental RAFL05-20-L07 AV784508;AV823522;AY045858
5 2 2 1 RAFL06-08-E17 AY062853 Experimental RAFL06-08-E17 AV784787;AV823751;AY062853 cytochrome C like protein
5 2 2 2 RAFL06-09-K11 AV823862 Experimental RAFL06-09-K11 AV784933;AV823862 26S proteasome AAA-ATPase subunit RPT6a - like protein
5 2 2 3 RAFL06-08-N16 AY062849 Experimental RAFL06-08-N16 AV784849;AV823796;AY062849 cold and ABA inducible protein kin1
5 2 2 4 RAFL06-08-K15 AV823777 Experimental RAFL06-08-K15 AV784827;AV823777 unknown protein
5 2 2 5 RAFL06-08-F19 AY062846 Experimental RAFL06-08-F19 AV784796;AV823757;AY062846 one helix protein (OHP)
5 2 2 6 RAFL06-09-K10 AY065162 Experimental RAFL06-09-K10 AV784932;AV823861;AY065162 unknown protein
5 2 2 7 RAFL06-09-I24 AY120781 Experimental RAFL06-09-I24 AV784923;AV823855;AY120781 WD40-repeat protein
5 2 2 8 RAFL06-09-G22 AY093007 Experimental RAFL06-09-G22 AV784912;AV823846;AY093007 hypothetical protein
5 2 2 9 RAFL06-07-B08 AV823648 Experimental RAFL06-07-B08 AV784653;AV823648 putative protein kinase
5 2 2 10 RAFL06-07-C21 AY050793 Experimental RAFL06-07-C21 AV784661;AY050793 unknown protein
5 2 2 11 RAFL06-07-F14 AY045833 Experimental RAFL06-07-F14 AV784683;AV823672;AY045833 scarecrow-like 1 (SCL1)
5 2 2 12 RAFL06-07-C20 AY045803 Experimental RAFL06-07-C20 AV784660;AV823655;AY045803 unknown protein
5 2 2 13 RAFL06-07-F10 AY045980 Experimental RAFL06-07-F10 AV784682;AV823671;AY045980 unknown protein
5 2 2 14 RAFL06-07-C12 AV823654 Experimental RAFL06-07-C12 AV784659;AV823654 CBL-interacting protein kinase 1 (CIPK1)
5 2 3 1 RAFL06-09-O23 AV823882 Experimental RAFL06-09-O23 AV784958;AV823882 unknown protein
5 2 3 2 RAFL06-09-O18 AY062867 Experimental RAFL06-09-O18 AV784957;AV823881;AY062867 transporter-like protein
5 2 3 3 RAFL06-09-O15 AY062865 Experimental RAFL06-09-O15 AV784956;AV823880;AY062865 putative RING zinc finger protein
5 2 3 4 RAFL06-09-M14 AV823873 Experimental RAFL06-09-M14 AV784945;AV823873 unknown protein
5 2 3 5 RAFL06-07-P06 BT002063 Experimental RAFL06-07-P06 AV784751;BP561076;BT002063 putative AP2 domain transcription factor
5 2 3 6 RAFL06-07-K07 AY093012 Experimental RAFL06-07-K07 AV784718;AV823698;AY093012 peroxidase ATP3a (emb|CAA67340.1)
5 2 3 7 RAFL06-07-J02 AY065176 Experimental RAFL06-07-J02 AV784707;AV823688;AY065176 putative protein
5 2 3 8 RAFL06-07-H09 AY093010 Experimental RAFL06-07-H09 AV784695;AV823681;AY093010 translocon Tic40-like protein
5 2 3 9 RAFL06-07-F18 AY081326 Experimental RAFL06-07-F18 AV784685;AV823674;AY081326 B12D-like protein
5 2 3 10 RAFL06-08-L02 BT002439 Experimental RAFL06-08-L02 AV784829;BP561093;BT002439 putative disease resistance response protein
5 2 3 11 RAFL06-09-A15 AY059945 Experimental RAFL06-09-A15 AV784871;AV823813;AY059945 Unknown protein (At2g31070; T16B12.12)
5 2 3 12 RAFL06-07-H08 AY062854 Experimental RAFL06-07-H08 AV784694;AV823680;AY062854 60S acidic ribosomal protein P2
5 2 3 13 RAFL06-07-F15 AY065169 Experimental RAFL06-07-F15 AV784684;AV823673;AY065169 unknown protein
5 2 3 14 RAFL06-08-K21 AY065167 Experimental RAFL06-08-K21 AV784828;AV823778;AY065167 cathepsin B-like cysteine protease
5 2 4 1 RAFL06-16-L24 AY127007 Experimental RAFL06-16-L24 AV785483;AY127007 hypothetical protein
5 2 4 2 RAFL06-16-N16 AY075603 Experimental RAFL06-16-N16 AV785492;AV824272;AY075603 ribosomal protein
5 2 4 3 RAFL06-16-O23 AV785502 Experimental RAFL06-16-O23 AV785502 unknown protein
5 2 4 4 RAFL06-16-O18 AV785501 Experimental RAFL06-16-O18 AV785501 cytochrome b5 (dbj|BAA74840.1)
5 2 4 5 RAFL06-16-L16 AY090362 Experimental RAFL06-16-L16 AV785481;AY090362 putative transcription factor BHLH11
5 2 4 6 RAFL06-15-A22 AY075597 Experimental RAFL06-15-A22 AV785327;AV824159;AY075597
5 2 4 7 RAFL06-13-H04 AV824090 Experimental RAFL06-13-H04 AV785237;AV824090 unknown protein (At1g70840)
5 2 4 8 RAFL06-13-F20 AY127012 Experimental RAFL06-13-F20 AV785227;AV824082;AY127012 unknown protein
5 2 4 9 RAFL06-13-E03 AV824073 Experimental RAFL06-13-E03 AV785217;AV824073 nitrilase 2
5 2 4 10 RAFL06-15-H04 AV824177 Experimental RAFL06-15-H04 AV785356;AV824177 cysteine synthase (cpACS1)
5 2 4 11 RAFL06-15-E15 AY090360 Experimental RAFL06-15-E15 AV785344;AV824169;AY090360 serine (threonine) protein kinase - like
5 2 4 12 RAFL06-12-L22 AY090357 Experimental RAFL06-12-L22 AV785179;AY090357 unknown protein
5 2 4 13 RAFL06-09-N12 AV823877 Experimental RAFL06-09-N12 AV784950;AV823877 scarecrow-like protein
5 2 4 14 RAFL06-09-O24 AY093014 Experimental RAFL06-09-O24 AV784959;AV823883;AY093014 putative VAMP-associated protein
5 2 5 1 RAFL07-10-H14 AY057576 Experimental RAFL07-10-H14 AV791427;AV825507;AY057576 monodehydroascorbate reductase (NADH) - like protein
5 2 5 2 RAFL07-10-N13 AV825553 Experimental RAFL07-10-N13 AV791519;AV825553 unknown protein
5 2 5 11 RAFL06-16-O17 AV824277 Experimental RAFL06-16-O17 AV785500;AV824277 unknown protein
5 2 5 12 RAFL06-16-L15 AY090367 Experimental RAFL06-16-L15 AV824264;AY090367 putative protein
5 2 5 13 RAFL06-16-L09 AY125521 Experimental RAFL06-16-L09 AV785475;AV824259;AY125521 putative protein
5 2 5 14 RAFL06-16-L06 AY090358 Experimental RAFL06-16-L06 AV785474;AV824258;AY090358 unknown protein
5 2 6 1 RAFL07-11-B05 BP561448 Experimental RAFL07-11-B05 AV791569;BP561448;AY050875 unknown protein
5 2 6 2 RAFL07-11-A04 AY080843 Experimental RAFL07-11-A04 AV791556;AV825564;AY080843 unknown protein
5 2 6 3 RAFL07-11-G02 AV791636 Experimental RAFL07-11-G02 AV791636 unknown
5 2 6 4 RAFL07-11-H01 AY056211 Experimental RAFL07-11-H01 AV791650;AY056211 unknown protein
5 2 6 5 RAFL07-10-J22 AY059758 Experimental RAFL07-10-J22 AV791460;AV825524;AY059758 unknown protein
5 2 6 6 RAFL07-10-F22 AY059780 Experimental RAFL07-10-F22 AV791400;AV825491;AY059780 AP3-complex beta-3A adaptin subunit-like protein
5 2 6 7 RAFL07-10-M21 AY056292 Experimental RAFL07-10-M21 AV791506;AV825548;AY056292
5 2 6 8 RAFL07-10-J21 AV825523 Experimental RAFL07-10-J21 AV791459;AV825523
5 2 6 9 RAFL07-10-F21 BP561440 Experimental RAFL07-10-F21 AV791399;BP561440 putative protein
5 2 6 10 RAFL07-10-E20 AY056204 Experimental RAFL07-10-E20 AV791380;AV825484;AY056204 unknown protein
5 2 6 11 RAFL07-10-G16 AY050795 Experimental RAFL07-10-G16 AV791414;AV825500;AY050795 pectate lyase
5 2 6 12 RAFL07-10-D16 AY050897 Experimental RAFL07-10-D16 AV791362;AV825476;AY050897 abscisic acid responsive elements-binding factor (ABRE/ABF4) / bZip transcription factor AtbZip38
5 2 6 13 RAFL07-10-K15 AY050870 Experimental RAFL07-10-K15 AV791473;AV825531;AY050870 putative receptor-like protein kinase
5 2 6 14 RAFL07-10-E15 AY045868 Experimental RAFL07-10-E15 AV791377;AV825483;AY045868 hypothetical protein
5 2 7 1 RAFL07-15-B13 AY054503 Experimental RAFL07-15-B13 AV792449;AV825802;AY054503 protein kinase -like protein
5 2 7 2 RAFL07-15-C12 AY054502 Experimental RAFL07-15-C12 AV792462;AV825804;AY054502
5 2 7 3 RAFL07-15-N11 AV825847 Experimental RAFL07-15-N11 AV792613;AV825847 Vacuolar H+-ATPase subunit H (VHA-H)
5 2 7 4 RAFL07-15-O10 AV825851 Experimental RAFL07-15-O10 AV792624;AV825851 nodulin-like protein
5 2 7 5 RAFL07-15-F10 AY062651 Experimental RAFL07-15-F10 AV792503;AV825817;AY062651 T-complex protein 1, beta subunit
5 2 7 6 RAFL07-15-N09 BT002414 Experimental RAFL07-15-N09 AV792611;BT002414 putative fibrillin
5 2 7 7 RAFL07-11-C21 BP561450 Experimental RAFL07-11-C21 AV791595;BP561450;AY056303 nucleotide sugar epimerase-like protein
5 2 7 8 RAFL07-11-A20 BP561447 Experimental RAFL07-11-A20 AV791567;BP561447;AY051010 unknown protein
5 2 7 9 RAFL07-11-B18 AY056129 Experimental RAFL07-11-B18 AV791578;AV825569;AY056129 kinesin-like protein
5 2 7 10 RAFL07-11-C17 AY050776 Experimental RAFL07-11-C17 AV791592;AY050776 putative alpha 1,2-mannosidase
5 2 7 11 RAFL07-11-D16 AY074372 Experimental RAFL07-11-D16 AV791605;AV825575;AY074372 unknown protein
5 2 7 12 RAFL07-11-A16 AY059749 Experimental RAFL07-11-A16 AV791564;AV825566;AY059749 lycopene beta cyclase
5 2 7 13 RAFL07-11-G07 AV791639 Experimental RAFL07-11-G07 AV791639 topoisomerase-like protein
5 2 7 14 RAFL07-11-I06 AY046047 Experimental RAFL07-11-I06 AV791665;AV825589;AY046047 unknown protein
5 2 8 1 RAFL07-16-E16 BT000444 Experimental RAFL07-16-E16 AV792713;BT000444 putative acetyltransferase
5 2 8 2 RAFL07-16-D14 AY059857 Experimental RAFL07-16-D14 AV792695;AY059857 putative helicase
5 2 8 3 RAFL07-16-B06 AY120753 Experimental RAFL07-16-B06 AV792659;AV825855;AY120753 maize crp1 protein-like
5 2 8 4 RAFL07-16-C04 AY128385 Experimental RAFL07-16-C04 AV792674;AY128385 putative disease resistance protein
5 2 8 5 RAFL07-16-E01 BP561490 Experimental RAFL07-16-E01 AV792702;BP561490;AY062517 unknown protein
5 2 8 6 RAFL07-15-M24 AY081305 Experimental RAFL07-15-M24 AV792607;AY081305 putative 60S ribosomal protein L6
5 2 8 7 RAFL07-15-D24 BP561482 Experimental RAFL07-15-D24 AV792481;BP561482;AY062516 peptidylprolyl isomerase (cyclophilin)-like
5 2 8 8 RAFL07-15-G23 AV825823 Experimental RAFL07-15-G23 AV792525;AV825823 serine/threonine-protein kinase
5 2 8 9 RAFL07-15-G18 AY062511 Experimental RAFL07-15-G18 AV792521;AV825822;AY062511 aberrant lateral root formation 5 (ALF5)
5 2 8 10 RAFL07-15-I17 AY081316 Experimental RAFL07-15-I17 AV792549;AV825834;AY081316 putative bHLH transcription factor (bHLH068)
5 2 8 11 RAFL07-15-E17 AY054506 Experimental RAFL07-15-E17 AV792491;AV825813;AY054506 anthranilate phosphoribosyltransferase, chloroplast precursor (sp|Q02166)
5 2 8 12 RAFL07-15-O16 BP561486 Experimental RAFL07-15-O16 AV792630;BP561486;AY062508 putative cationic amino acid transporter
5 2 8 13 RAFL07-15-I16 AY062507 Experimental RAFL07-15-I16 AV792548;AV825833;AY062507 predicted GPI-anchored protein
5 2 8 14 RAFL07-15-O15 AY062505 Experimental RAFL07-15-O15 AV792629;AV825852;AY062505 unknown protein
5 2 9 1 RAFL08-10-K01 BP561543 Experimental RAFL08-10-K01 AV793879;BP561543;AY048271 unknown protein
5 2 9 2 RAFL08-09-I24 AY048265 Experimental RAFL08-09-I24 AV793639;AV826118;AY048265 putative protein
5 2 9 3 RAFL08-09-I23 AY048255 Experimental RAFL08-09-I23 AV793638;AV826117;AY048255 unknown protein
5 2 9 4 RAFL08-09-C23 AY048242 Experimental RAFL08-09-C23 AV793554;AV826094;AY048242
5 2 9 5 RAFL08-09-C19 AY049239 Experimental RAFL08-09-C19 AV793551;AV826093;AY049239 acyl-CoA synthetase - like protein
5 2 9 6 RAFL08-09-K17 AY048280 Experimental RAFL08-09-K17 AV793668;AV826129;AY048280
5 2 9 7 RAFL08-09-D17 BP561528 Experimental RAFL08-09-D17 AV793565;BP561528;AY048273
5 2 9 8 RAFL08-09-J16 AY048270 Experimental RAFL08-09-J16 AV793649;AV826121;AY048270 unknown protein
5 2 9 9 RAFL08-09-L15 AY056780 Experimental RAFL08-09-L15 AV793678;AY056780 plasma membrane ATPase 3 (proton pump) (sp|P20431)
5 2 9 10 RAFL08-09-F15 AY048248 Experimental RAFL08-09-F15 AV793587;AV826103;AY048248 unknown protein
5 2 9 11 RAFL07-16-E20 BP561492 Experimental RAFL07-16-E20 AV792716;BP561492;AY128388 pyrophosphate-dependent phosphofructo-1-kinase-like protein
5 2 9 12 RAFL07-16-B19 BP561489 Experimental RAFL07-16-B19 AV792668;BP561489;AY062527 Unknown protein (At1g13190; F3F19.21)
5 2 9 13 RAFL07-16-B18 AY062526 Experimental RAFL07-16-B18 AV792667;AV825857;AY062526 plastid RNA polymerase sigma-subunit (SIG2)
5 2 9 14 RAFL07-16-D17 AY062524 Experimental RAFL07-16-D17 AV792698;AV825863;AY062524 unknown protein
5 2 10 1 RAFL08-10-H24 AY048293 Experimental RAFL08-10-H24 AV793851;AV826167;AY048293 unknown protein
5 2 10 2 RAFL08-10-E23 BP561539 Experimental RAFL08-10-E23 AV793805;BP561539;AY048281 ribosomal protein L27 - like
5 2 10 3 RAFL08-10-G22 BP561540 Experimental RAFL08-10-G22 AV793832;BP561540;AY056784 putative sucrose synthetase
5 2 10 4 RAFL08-10-M21 AY102108 Experimental RAFL08-10-M21 AV793921;AV826183;AY102108 DNA-binding protein, putative
5 2 10 5 RAFL08-10-F21 AY048260 Experimental RAFL08-10-F21 AV793817;AV826156;AY048260 putative DEAD/DEAH box helicase
5 2 10 6 RAFL08-10-I20 AY048247 Experimental RAFL08-10-I20 AV793863;AV826169;AY048247 myosin-like protein
5 2 10 7 RAFL08-10-H13 BP561541 Experimental RAFL08-10-H13 AV793842;BP561541;AY049238 putative protein
5 2 10 8 RAFL08-10-A13 AY048290 Experimental RAFL08-10-A13 AV793744;AV826145;AY048290 sulphite reductase
5 2 10 9 RAFL08-10-G12 AY049233 Experimental RAFL08-10-G12 AV793825;AV826160;AY049233 unknown protein
5 2 10 10 RAFL08-10-F11 AY048263 Experimental RAFL08-10-F11 AV793813;AV826155;AY048263 protochlorophyllide reductase like protein
5 2 10 11 RAFL08-10-G10 AY048251 Experimental RAFL08-10-G10 AV793824;AV826159;AY048251 putative RNA-binding protein
5 2 10 12 RAFL08-10-K09 AY049230 Experimental RAFL08-10-K09 AV793885;AV826176;AY049230 dynamin-like protein CF1
5 2 10 13 RAFL08-10-J04 AY049237 Experimental RAFL08-10-J04 AV793868;AY049237 homeotic protein BEL1 homolog
5 2 10 14 RAFL08-10-B03 AY048289 Experimental RAFL08-10-B03 AV793751;AV826147;AY048289 Spot 3 protein and vacuolar sorting receptor homolog/AtELP1
5 2 11 1 RAFL08-15-L22 AY050823 Experimental RAFL08-15-L22 AV795042;AV826463;AY050823 putative diaminopimelate decarboxylase
5 2 11 2 RAFL08-15-C22 AV794911 Experimental RAFL08-15-C22 AV794911 unknown protein
5 2 11 3 RAFL08-15-B15 AY063912 Experimental RAFL08-15-B15 AV794894;AV826436;AY063912 myb-related protein
5 2 11 4 RAFL08-15-F14 AY050850 Experimental RAFL08-15-F14 AV794957;AY050850 unknown protein
5 2 11 5 RAFL08-15-L13 AV826462 Experimental RAFL08-15-L13 AV795038;AV826462 putative protein
5 2 11 6 RAFL08-15-C12 BT000770 Experimental RAFL08-15-C12 AV794904;AV826440;BT000770 acyltransferase
5 2 11 7 RAFL08-15-G11 AY056237 Experimental RAFL08-15-G11 AV794970;AV826446;AY056237 putative RNA-binding protein LAH1
5 2 11 8 RAFL08-15-E10 BP561599 Experimental RAFL08-15-E10 AV794936;BP561599 glycolate oxidase like protein
5 2 11 9 RAFL08-15-B05 AY050960 Experimental RAFL08-15-B05 AV794889;AV826435;AY050960 unknown protein
5 2 11 10 RAFL08-15-O03 AY063907 Experimental RAFL08-15-O03 AV795073;AV826471;AY063907 putative endomembrane protein EMP70 precusor isolog (At1g10950)
5 2 11 11 RAFL08-15-B03 AY050942 Experimental RAFL08-15-B03 AV794888;AY050942 unknown protein
5 2 11 12 RAFL08-15-H02 AY050841 Experimental RAFL08-15-H02 AV794978;AV826449;AY050841 glycoprotein endopeptidase - like protein
5 2 11 13 RAFL08-15-D02 AY056234 Experimental RAFL08-15-D02 AV794914;AV826441;AY056234 translation releasing factor RF-2
5 2 11 14 RAFL08-15-N01 AY056249 Experimental RAFL08-15-N01 AV795058;AV826469;AY056249 EF-Hand containing protein -like
5 2 12 1 RAFL09-06-A19 AY120765 Experimental RAFL09-06-A19 AV795983;AV826649;AY120765 vacuolar processing enzyme/asparaginyl endopeptidase, putative
5 2 12 2 RAFL09-06-O18 BP561651 Experimental RAFL09-06-O18 AV796190;BP561651;AY062750 HEAT SHOCK PROTEIN 81-2 (HSP81-2) (sp|P55737)
5 2 12 3 RAFL09-06-K18 AY062749 Experimental RAFL09-06-K18 AV796127;AY062749
5 2 12 4 RAFL09-06-F18 AY120763 Experimental RAFL09-06-F18 AV796052;AV826687;AY120763 hypothetical protein
5 2 12 5 RAFL08-16-D23 BP561610 Experimental RAFL08-16-D23 AV795154;BP561610;AY063914 AAA-type like ATPase
5 2 12 6 RAFL08-16-B22 AY056148 Experimental RAFL08-16-B22 AV795125;AY056148 lactoylglutathione lyase-like protein
5 2 12 7 RAFL08-16-B20 AY050945 Experimental RAFL08-16-B20 AV795124;AV826478;AY050945 acid phosphatase-like protein
5 2 12 8 RAFL08-16-E19 AY080617 Experimental RAFL08-16-E19 AV795165;AV826488;AY080617
5 2 12 9 RAFL08-16-D18 AY056257 Experimental RAFL08-16-D18 AV795151;AV826486;AY056257 putative serine/threonine kinase
5 2 12 10 RAFL08-16-D16 AY050812 Experimental RAFL08-16-D16 AV795149;AV826485;AY050812 acid phosphatase-like protein
5 2 12 11 RAFL08-16-A05 BP561605 Experimental RAFL08-16-A05 AV795105;BP561605;AY063946
5 2 12 12 RAFL08-16-F02 AY050851 Experimental RAFL08-16-F02 AV795170;AY050851 putative protein
5 2 12 13 RAFL08-16-F01 AY056274 Experimental RAFL08-16-F01 AV795169;AY056274 unknown protein
5 2 12 14 RAFL08-15-L23 AY056285 Experimental RAFL08-15-L23 AV795043;AV826464;AY056285 beta-galactosidase like protein
5 2 13 1 RAFL09-07-C11 AY092982 Experimental RAFL09-07-C11 AV796240;AV826778;AY092982 unknown protein
5 2 13 2 RAFL09-07-D10 AY059915 Experimental RAFL09-07-D10 AV796256;AV826787;AY059915 unknown protein
5 2 13 3 RAFL09-07-B09 AY062762 Experimental RAFL09-07-B09 AV796225;AV826773;AY062762 Similar to auxin-independent growth promoter (axi 1)
5 2 13 4 RAFL09-07-F08 AY059914 Experimental RAFL09-07-F08 AV796290;AV826803;AY059914 ribosomal protein S1
5 2 13 5 RAFL09-07-D08 AY059913 Experimental RAFL09-07-D08 AV796254;AV826786;AY059913 unknown protein
5 2 13 6 RAFL09-07-F07 AY062761 Experimental RAFL09-07-F07 AV796289;AV826802;AY062761 unknown protein
5 2 13 7 RAFL09-07-D01 AY059906 Experimental RAFL09-07-D01 AV796248;AV826782;AY059906 Mg-chelatase like protein
5 2 13 8 RAFL09-06-M23 AY062760 Experimental RAFL09-06-M23 AV796158;AV826738;AY062760 putative ubiquitin-conjugating enzyme
5 2 13 9 RAFL09-06-J23 AY059903 Experimental RAFL09-06-J23 AV796112;AV826714;AY059903 putative lectin
5 2 13 10 RAFL09-06-D23 AY059902 Experimental RAFL09-06-D23 AV796023;AV826674;AY059902 putative U2 small nuclear ribonucleoprotein A' (U2 SNRNP-A')
5 2 13 11 RAFL09-06-N22 AY120775 Experimental RAFL09-06-N22 AV796177;AY120775 unknown protein
5 2 13 12 RAFL09-06-K22 AV826721 Experimental RAFL09-06-K22 AV796130;AV826721 putative protein
5 2 13 13 RAFL09-06-N19 BP561650 Experimental RAFL09-06-N19 AV796175;BP561650;AY059900 unknown protein
5 2 13 14 RAFL09-06-E19 AY092981 Experimental RAFL09-06-E19 AV796037;AV826682;AY092981 putative protein-tyrosine phosphatase 2
5 2 14 1 RAFL09-10-C09 AY069876 Experimental RAFL09-10-C09 AV796932;AV826982;AY069876 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
5 2 14 2 RAFL09-10-N08 AY058159 Experimental RAFL09-10-N08 AV797116;AV827055;AY058159 putative protein
5 2 14 3 RAFL09-10-K05 AY058199 Experimental RAFL09-10-K05 AV797067;AV827029;AY058199 tubulin alpha-2/alpha-4 chain
5 2 14 4 RAFL09-10-I05 AV827014 Experimental RAFL09-10-I05 AV797032;AV827014 unknown protein
5 2 14 5 RAFL09-10-M04 AY058188 Experimental RAFL09-10-M04 AV797096;AV827043;AY058188 homeobox protein (HAT5)
5 2 14 6 RAFL09-10-K04 AY058170 Experimental RAFL09-10-K04 AV797066;AV827028;AY058170 unknown protein
5 2 14 7 RAFL09-10-E04 AY058167 Experimental RAFL09-10-E04 AV796960;AV826989;AY058167 putative cyclic nucleotide-regulated ion channel protein
5 2 14 8 RAFL09-10-I03 AY058155 Experimental RAFL09-10-I03 AV797031;AV827013;AY058155 chalcone synthase (naringenin-chalcone synthase) (testa 4 protein) (sp|P13114)
5 2 14 9 RAFL09-07-C24 AV826781 Experimental RAFL09-07-C24 AV796247;AV826781 hypothetical protein
5 2 14 10 RAFL09-07-D23 AY092985 Experimental RAFL09-07-D23 AV796266;AV826793;AY092985 unknown protein
5 2 14 11 RAFL09-07-D22 AY059921 Experimental RAFL09-07-D22 AV796265;AV826792;AY059921 Unknown protein (At1g16670)
5 2 14 12 RAFL09-07-E21 BP561657 Experimental RAFL09-07-E21 AV796280;BP561657;AY092983 unknown protein
5 2 14 13 RAFL09-07-A21 AY059919 Experimental RAFL09-07-A21 AV796219;AV826768;AY059919
5 2 14 14 RAFL09-07-D20 AY059918 Experimental RAFL09-07-D20 AV796263;AV826790;AY059918 unknown protein
5 3 1 1 RAFL06-07-J06 AV823689 Experimental RAFL06-07-J06 AV823689
5 3 1 2 RAFL06-07-H22 AY062836 Experimental RAFL06-07-H22 AV784696;AV823682;AY062836
5 3 1 3 RAFL06-08-M21 AY062835 Experimental RAFL06-08-M21 AV784840;AV823788;AY062835 photosystem I reaction centre subunit psaN precursor (PSI-N) (sp|P49107)
5 3 1 4 RAFL06-08-I05 AY062833 Experimental RAFL06-08-I05 AV784810;AV823766;AY062833 cytochrome P450 monooxygenase like protein
5 3 1 5 RAFL06-10-K09 AY062832 Experimental RAFL06-10-K09 AV823936;AY062832 heat shock protein 90
5 3 1 6 RAFL06-10-F05 AV823919 Experimental RAFL06-10-F05 AV785004;AV823919 unknown protein
5 3 1 7 RAFL06-11-P04 BP561140 Experimental RAFL06-11-P04 AV785121;BP561140;AY072347 Ca2+-dependent membrane-binding protein annexin
5 3 1 8 RAFL06-10-B17 AY062826 Experimental RAFL06-10-B17 AV784974;AV823894;AY062826 Unknown protein
5 3 1 9 RAFL06-10-A08 AY059934 Experimental RAFL06-10-A08 AV784966;AV823888;AY059934 Unknown protein
5 3 1 10 RAFL06-11-I01 BP561130 Experimental RAFL06-11-I01 AV785086;BP561130 unknown protein
5 3 1 11 RAFL06-11-D18 AY062824 Experimental RAFL06-11-D18 AV785063;AV823964;AY062824 copine - like protein
5 3 1 12 RAFL06-10-O11 AY062823 Experimental RAFL06-10-O11 AV785041;AV823946;AY062823 unknown protein
5 3 1 13 RAFL06-10-E23 AY062817 Experimental RAFL06-10-E23 AV785002;AV823917;AY062817 predicted GPI-anchored protein
5 3 1 14 RAFL06-10-C17 AY065157 Experimental RAFL06-10-C17 AV784983;AV823903;AY065157 Mago Nashi-like protein
5 3 2 1 RAFL06-13-H11 AV824092 Experimental RAFL06-13-H11 AV785240;AV824092;AF410283 ribulose bisphosphate carboxylase small chain 1b precursor (RuBisCO small subunit 1b) (sp|P10796)
5 3 2 2 RAFL06-13-G07 AV824086 Experimental RAFL06-13-G07 AV824086;AF410270
5 3 2 3 RAFL06-13-O22 AY125507 Experimental RAFL06-13-O22 AV785291;AV824133;AY125507 putative jasmonate inducible protein
5 3 2 4 RAFL06-13-N05 AV824124 Experimental RAFL06-13-N05 AV785281;AV824124;AF410320 stress response protein Nramp2
5 3 2 5 RAFL06-15-P19 AY125506 Experimental RAFL06-15-P19 AV785406;AY125506 putative glucosyltransferase
5 3 2 6 RAFL06-15-O16 AY125503 Experimental RAFL06-15-O16 AV785395;AV824203;AY125503 6-phosphogluconate dehydrogenase
5 3 2 7 RAFL06-15-N14 AY094436 Experimental RAFL06-15-N14 AV785388;AV824197;AY094436
5 3 2 8 RAFL06-15-L23 AV824188 Experimental RAFL06-15-L23 AV785376;AV824188;AF410273 RING finger - like protein
5 3 2 9 RAFL06-09-K20 AV823866 Experimental RAFL06-09-K20 AV784937;AV823866 putative leucoanthocyanidin dioxygenase (LDOX)
5 3 2 10 RAFL06-09-F02 BP561105 Experimental RAFL06-09-F02 AV784895;BP561105;AY062844 unknown protein
5 3 2 11 RAFL06-07-K15 AY062842 Experimental RAFL06-07-K15 AV784720;AV823700;AY062842 unknown protein
5 3 2 12 RAFL06-07-J07 AY128411 Experimental RAFL06-07-J07 AV784708;AV823690;AY128411 60S ribosomal protein L18A, putative
5 3 2 13 RAFL06-08-N24 AY065155 Experimental RAFL06-08-N24 AV784853;AV823800;AY065155 ethylene responsive element binding factor-like protein
5 3 2 14 RAFL06-08-N02 AY062841 Experimental RAFL06-08-N02 AV784841;AV823789;AY062841 putative protein
5 3 3 1 RAFL06-13-P22 AV824136 Experimental RAFL06-13-P22 AV785294;AV824136;AF410312
5 3 3 2 RAFL06-13-N20 AV824127 Experimental RAFL06-13-N20 AV824127;AF410301 unknown protein
5 3 3 3 RAFL06-13-M04 AV824120 Experimental RAFL06-13-M04 AV785272;AV824120;AF410290 unknown protein
5 3 3 4 RAFL06-13-K14 AV824111 Experimental RAFL06-13-K14 AV785260;AV824111;AF410274 Unknown protein (F2H15.9)
5 3 3 5 RAFL06-12-K17 AY094442 Experimental RAFL06-12-K17 AV785175;AV824042;AY094442 unknown protein
5 3 3 6 RAFL06-16-J10 AV824251 Experimental RAFL06-16-J10 AV785462;AV824251;AF410322 12-oxophytodienoate-10,11-reductase
5 3 3 7 RAFL06-16-H22 AV785450 Experimental RAFL06-16-H22 AV785450;AF410305 20S proteasome subunit PAB1
5 3 3 8 RAFL06-13-P21 AV824135 Experimental RAFL06-13-P21 AV785293;AV824135;AF410293 unknown protein
5 3 3 9 RAFL06-16-D16 AV824225 Experimental RAFL06-16-D16 AV785425;AV824225;AF410286 unknown protein
5 3 3 10 RAFL06-13-K10 AV824110 Experimental RAFL06-13-K10 AV785259;AV824110;AF410268 endonuclease III - like protein
5 3 3 11 RAFL06-16-H21 AY094439 Experimental RAFL06-16-H21 AV785449;AY094439 unknown protein
5 3 3 12 RAFL06-13-N10 AV824125 Experimental RAFL06-13-N10 AV785282;AV824125;AF410326 putative serine carboxypeptidase I
5 3 3 13 RAFL06-16-B16 AV824216 Experimental RAFL06-16-B16 AV785414;AV824216;AF410309 unknown protein
5 3 3 14 RAFL06-13-I09 AY094438 Experimental RAFL06-13-I09 AV785249;AV824100;AY094438 putative cystathionine gamma-synthase
5 3 4 1 RAFL07-08-H18 BP561420 Experimental RAFL07-08-H18 AV791023;BP561420;AY045883 ubiquitin-conjugating enzyme UBC3
5 3 4 2 RAFL07-08-P17 AY059779 Experimental RAFL07-08-P17 AV791129;AV825379;AY059779 unknown protein
5 3 4 3 RAFL07-08-J17 BP561422 Experimental RAFL07-08-J17 AV791051;BP561422;AY050871 proteasome epsilon chain precursor
5 3 4 4 RAFL07-08-H17 BP561419 Experimental RAFL07-08-H17 AV791022;BP561419;AY064008 unknown protein
5 3 4 5 RAFL07-08-P16 AY064003 Experimental RAFL07-08-P16 AV791128;AV825378;AY064003 unknown protein
5 3 4 6 RAFL07-08-B16 BP561412 Experimental RAFL07-08-B16 AV790930;BP561412;AY142544 ARF GAP-like zinc finger-containing protein ZIGA2
5 3 4 7 RAFL07-08-E13 AY050958 Experimental RAFL07-08-E13 AV790974;AV825321;AY050958 serine carboxypeptidase II like protein
5 3 4 8 RAFL07-08-A13 BP561409 Experimental RAFL07-08-A13 AV790910;BP561409;AY051008 HSP like protein
5 3 4 9 RAFL07-08-A12 AY056126 Experimental RAFL07-08-A12 AV790909;AV825304;AY056126 Exportin1 (XPO1) protein
5 3 4 10 RAFL07-08-J11 AY045902 Experimental RAFL07-08-J11 AV791050;AV825350;AY045902 putative protein
5 3 4 11 RAFL07-08-I10 AY050804 Experimental RAFL07-08-I10 AV791034;AV825343;AY050804 putative protein
5 3 4 12 RAFL07-08-E09 AY080830 Experimental RAFL07-08-E09 AV790971;AV825320;AY080830 isoleucyl-tRNA synthetase
5 3 4 13 RAFL06-16-K23 BP561207 Experimental RAFL06-16-K23 AV785473;BP561207;AF410331 putative protein
5 3 4 14 RAFL06-14-C19 AV824142 Experimental RAFL06-14-C19 AV785304;AV824142;AF410314 ribulose bisphosphate carboxylase small chain 3b precursor (RuBisCO small subunit 3b) (sp|P10798)
5 3 5 1 RAFL07-12-L12 AY062476 Experimental RAFL07-12-L12 AV791948;AV825681;AY062476 Unknown protein (At5g65920; K14B20.9)
5 3 5 2 RAFL07-12-B12 AV825636 Experimental RAFL07-12-B12 AV791807;AV825636 unknown protein
5 3 5 3 RAFL07-09-D05 AY059759 Experimental RAFL07-09-D05 AV791171;AV825393;AY059759 bZIP like protein
5 3 5 4 RAFL07-09-P04 BP561436 Experimental RAFL07-09-P04 AV791305;BP561436 protein phosphatase 2C-like
5 3 5 5 RAFL07-09-H04 BP561432 Experimental RAFL07-09-H04 AV791219;BP561432;AY056127 unknown protein (F18O14.20)
5 3 5 6 RAFL07-09-O03 AY051006 Experimental RAFL07-09-O03 AV791294;AV825443;AY051006 putative potassium transporter
5 3 5 7 RAFL07-09-H03 BP561431 Experimental RAFL07-09-H03 AV791218;BP561431;AY080839 transcription factor bZIP29 (BZIP29)
5 3 5 8 RAFL07-09-N02 AV791283 Experimental RAFL07-09-N02 AV791283 type 2A protein serine/threonine phosphatase 55kDa B regulatory subunit (F11A6.6)
5 3 5 9 RAFL07-08-G24 AY056301 Experimental RAFL07-08-G24 AV791010;AV825335;AY056301 AMP deaminase like protein
5 3 5 10 RAFL07-08-N23 AY050898 Experimental RAFL07-08-N23 AV791107;AV825372;AY050898 ser/thr protein phosphatase catalytic subunit-like protein
5 3 5 11 RAFL07-08-E22 BT000811 Experimental RAFL07-08-E22 AV790980;AV825326;BT000811 unknown protein
5 3 5 12 RAFL07-08-A22 AY045870 Experimental RAFL07-08-A22 AV790919;AY045870 unknown protein
5 3 5 13 RAFL07-08-J21 BP561423 Experimental RAFL07-08-J21 AV791054;BP561423;AY080837 RNA helicase like protein
5 3 5 14 RAFL07-08-F21 AY051004 Experimental RAFL07-08-F21 AV790996;AV825330;AY051004 arsA homolog (hASNA-I), putative
5 3 6 1 RAFL07-13-I05 AY062648 Experimental RAFL07-13-I05 AV792118;AV825723;AY062648 similar to latex allergen from Hevea brasiliensis
5 3 6 2 RAFL07-13-O03 AY062486 Experimental RAFL07-13-O03 AV792195;AV825737;AY062486 unknown protein
5 3 6 3 RAFL07-13-I02 AY062485 Experimental RAFL07-13-I02 AV792115;AV825722;AY062485 similar to Human XE169 protein
5 3 6 4 RAFL07-13-C02 AY059847 Experimental RAFL07-13-C02 AV792039;AV825704;AY059847 serine/threonine protein phosphatase, PP2A, catalytic subunit
5 3 6 5 RAFL07-12-M20 AY062477 Experimental RAFL07-12-M20 AV791970;AV825690;AY062477 putative protein
5 3 6 6 RAFL07-12-K19 AY062480 Experimental RAFL07-12-K19 AV791938;AV825677;AY062480 Unknown protein (At5g22620; MDJ22.4)
5 3 6 7 RAFL07-12-E19 AV825654 Experimental RAFL07-12-E19 AV791852;AV825654 zinc dependent protease (VAR2)
5 3 6 8 RAFL07-12-K18 AY062646 Experimental RAFL07-12-K18 AV791937;AV825676;AY062646
5 3 6 9 RAFL07-12-I18 AV825665 Experimental RAFL07-12-I18 AV791904;AV825665 putative transketolase precursor
5 3 6 10 RAFL07-12-B18 AY062474 Experimental RAFL07-12-B18 AV791809;AV825637;AY062474 bZip transcription factor AtbZip52
5 3 6 11 RAFL07-12-N14 AY081310 Experimental RAFL07-12-N14 AV791979;AV825695;AY081310 putative protein
5 3 6 12 RAFL07-12-M13 AY081314 Experimental RAFL07-12-M13 AV791963;AV825686;AY081314 putative C2H2-type zinc finger protein
5 3 6 13 RAFL07-12-C13 AY062491 Experimental RAFL07-12-C13 AV791818;AV825640;AY062491 putative protein
5 3 6 14 RAFL07-12-N12 AY054493 Experimental RAFL07-12-N12 AV791978;AV825694;AY054493 unknown protein
5 3 7 1 RAFL07-17-M24 AY049288 Experimental RAFL07-17-M24 AV793034;AV825947;AY049288 unknown protein
5 3 7 2 RAFL07-17-H23 AV825928 Experimental RAFL07-17-H23 AV792959;AV825928;AF462853 unknown protein
5 3 7 3 RAFL07-17-N22 AY049267 Experimental RAFL07-17-N22 AV793049;AV825953;AY049267 unknown protein
5 3 7 4 RAFL07-17-I21 AY065008 Experimental RAFL07-17-I21 AV792971;AV825932;AY065008 elongation factor 1-alpha
5 3 7 5 RAFL07-17-P20 AY125523 Experimental RAFL07-17-P20 AV793073;AY125523 hypothetical protein
5 3 7 6 RAFL07-17-K19 AY049243 Experimental RAFL07-17-K19 AV793003;AV825941;AY049243 glutamate dehydrogenase (EC 1.4.1.-) 1 (pir||S71217)
5 3 7 7 RAFL07-13-D16 AY054497 Experimental RAFL07-13-D16 AV792059;AV825708;AY054497 bZIP transcription factor AtbZip30
5 3 7 8 RAFL07-13-B16 AY054496 Experimental RAFL07-13-B16 AV792034;AV825703;AY054496 putative protein
5 3 7 9 RAFL07-13-P15 AY062496 Experimental RAFL07-13-P15 AV792212;AV825740;AY062496 protein phosphatase-2C (PP2C) like protein
5 3 7 10 RAFL07-13-F15 AV825716 Experimental RAFL07-13-F15 AV792085;AV825716 hypothetical protein
5 3 7 11 RAFL07-13-D14 AY054495 Experimental RAFL07-13-D14 AV792057;AV825707;AY054495 Unknown protein (At2g27460; F10A12.14)
5 3 7 12 RAFL07-13-O13 AY062493 Experimental RAFL07-13-O13 AV792201;AV825738;AY062493 putative protein kinase
5 3 7 13 RAFL07-13-B08 BP561466 Experimental RAFL07-13-B08 AV792029;BP561466;AY081301 unknown protein
5 3 7 14 RAFL07-13-K06 AY062497 Experimental RAFL07-13-K06 AV792148;AV825729;AY062497 DYW7 protein
5 3 8 1 RAFL07-18-E18 AY065004 Experimental RAFL07-18-E18 AV793150;AV825983;AY065004 P-Protein - like protein
5 3 8 2 RAFL07-18-B18 AY064999 Experimental RAFL07-18-B18 AV793099;AV825966;AY064999 unknown protein
5 3 8 3 RAFL07-18-K15 AY049285 Experimental RAFL07-18-K15 AV793242;AV826005;AY049285 ATP-dependent RNA helicase-like protein
5 3 8 4 RAFL07-18-K14 BP561514 Experimental RAFL07-18-K14 AV793241;BP561514;AY049272 unknown protein
5 3 8 5 RAFL07-18-D14 AV825978 Experimental RAFL07-18-D14 AV793131;AV825978;AF462851 unknown protein
5 3 8 6 RAFL07-18-O13 AY049256 Experimental RAFL07-18-O13 AV793307;AV826022;AY049256 unknown protein
5 3 8 7 RAFL07-18-K13 AY049250 Experimental RAFL07-18-K13 AV793240;AV826004;AY049250 unknown protein
5 3 8 8 RAFL07-18-F13 BP561510 Experimental RAFL07-18-F13 AV793164;BP561510
5 3 8 9 RAFL07-18-L08 AY125524 Experimental RAFL07-18-L08 AV793255;AV826008;AY125524 ankyrin-like protein
5 3 8 10 RAFL07-18-D08 AY065016 Experimental RAFL07-18-D08 AV793125;AV825976;AY065016 putative protein
5 3 8 11 RAFL07-18-J07 AY065013 Experimental RAFL07-18-J07 AV793222;AY065013 unknown protein
5 3 8 12 RAFL07-18-C07 AY065009 Experimental RAFL07-18-C07 AV793106;AV825969;AY065009 receptor-like protein kinase
5 3 8 13 RAFL07-18-I06 AV793207 Experimental RAFL07-18-I06 AV793207;AF462848 putative protein
5 3 8 14 RAFL07-18-H05 AY049245 Experimental RAFL07-18-H05 AV793193;AV825992;AY049245 putative pyrophosphate-dependent phosphofructo-1-kinase
5 3 9 1 RAFL08-12-C06 AY056315 Experimental RAFL08-12-C06 AV794262;AY056315 SCARECROW1
5 3 9 2 RAFL08-12-O05 AY050842 Experimental RAFL08-12-O05 AV794440;AV826334;AY050842 putative uridylyl transferase
5 3 9 3 RAFL08-12-L05 AY050925 Experimental RAFL08-12-L05 AV794402;AV826323;AY050925 membrane import protein, putative
5 3 9 4 RAFL08-12-I05 AY050912 Experimental RAFL08-12-I05 AV794356;AV826310;AY050912 putative SF2/ASF splicing modulator, Srp30
5 3 9 5 RAFL08-12-N01 AY056181 Experimental RAFL08-12-N01 AV794424;AV826330;AY056181 unknown protein
5 3 9 6 RAFL08-12-E01 BP561566 Experimental RAFL08-12-E01 AV794288;BP561566;AY063906 Unknown protein (F22L4.9)
5 3 9 7 RAFL08-11-G23 AY056271 Experimental RAFL08-11-G23 AV794080;AV826225;AY056271 circadian clock coupling factor ZGT like protein
5 3 9 8 RAFL08-11-K22 AY050840 Experimental RAFL08-11-K22 AV794149;AV826246;AY050840 unknown
5 3 9 9 RAFL08-11-I22 AY056232 Experimental RAFL08-11-I22 AV794113;AV826235;AY056232 putative Glucose-6-phosphate dehydrogenase (F14J9.8)
5 3 9 10 RAFL08-11-D22 BP561550 Experimental RAFL08-11-D22 AV794026;BP561550;AY050911 unknown protein
5 3 9 11 RAFL07-18-P19 AY049287 Experimental RAFL07-18-P19 AV793329;AV826028;AY049287 GAMM1 protein-like
5 3 9 12 RAFL07-18-M19 BP561516 Experimental RAFL07-18-M19 AV793274;BP561516;AY049279
5 3 9 13 RAFL07-18-E19 AV793151 Experimental RAFL07-18-E19 AV793151
5 3 9 14 RAFL07-18-A19 AY049255 Experimental RAFL07-18-A19 AV793085;AV825961;AY049255 Unknown protein (F3I6.17)
5 3 10 1 RAFL08-12-K23 BT000776 Experimental RAFL08-12-K23 AV794397;AV826321;BT000776 putative protein
5 3 10 2 RAFL08-12-D23 AY050916 Experimental RAFL08-12-D23 AV794287;AY050916 Unknown protein (F22K20.6)
5 3 10 3 RAFL08-12-C22 BP561564 Experimental RAFL08-12-C22 AV794271;BP561564;AY056316 unknown protein
5 3 10 4 RAFL08-12-G20 AY080805 Experimental RAFL08-12-G20 AV794333;AV826306;AY080805 unknown protein
5 3 10 5 RAFL08-12-E20 AY050824 Experimental RAFL08-12-E20 AV794301;AY050824 4-coumarate-CoA ligase -like protein
5 3 10 6 RAFL08-12-J19 BT000661 Experimental RAFL08-12-J19 AV794378;AV826317;BT000661 elongation factor, putative
5 3 10 7 RAFL08-12-M14 BP561572 Experimental RAFL08-12-M14 AV794418;BP561572 unknown protein
5 3 10 8 RAFL08-12-H14 AY056173 Experimental RAFL08-12-H14 AV794345;AV826309;AY056173 exopolygalacturonase
5 3 10 9 RAFL08-12-B13 BT000773 Experimental RAFL08-12-B13 AV794255;AV826278;BT000773 putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase
5 3 10 10 RAFL08-12-O11 AY056284 Experimental RAFL08-12-O11 AV794444;AV826336;AY056284 CYTOCHROME P450-like protein
5 3 10 11 RAFL08-12-H11 AY056145 Experimental RAFL08-12-H11 AV794342;AV826308;AY056145
5 3 10 12 RAFL08-12-E11 BP561567 Experimental RAFL08-12-E11 AV794294;BP561567 germin-like protein
5 3 10 13 RAFL08-12-C08 AY059797 Experimental RAFL08-12-C08 AV794264;AV826280;AY059797 unknown protein
5 3 10 14 RAFL08-12-A07 AY059792 Experimental RAFL08-12-A07 AV794235;AV826273;AY059792 transcription factor like protein
5 3 11 1 RAFL08-18-C20 AY062728 Experimental RAFL08-18-C20 AV795566;AV826572;AY062728 ARP protein (At1g49670; F14J22.10)
5 3 11 2 RAFL08-18-O19 AY062588 Experimental RAFL08-18-O19 AV795741;AV826609;AY062588 Unknown protein
5 3 11 3 RAFL08-18-E14 AY059893 Experimental RAFL08-18-E14 AV795590;AV826579;AY059893 putative histone deacetylase (HD2B)
5 3 11 4 RAFL08-18-A14 AV826564 Experimental RAFL08-18-A14 AV795530;AV826564
5 3 11 5 RAFL08-18-G13 AY062585 Experimental RAFL08-18-G13 AV795621;AV826585;AY062585 putative casein kinase II beta subunit
5 3 11 6 RAFL08-18-G12 AV795620 Experimental RAFL08-18-G12 AV795620 putative translation initiation factor EIF-2B beta subunit
5 3 11 7 RAFL08-18-O11 AV795734 Experimental RAFL08-18-O11 AV795734 unknown protein
5 3 11 8 RAFL08-18-M11 AY128393 Experimental RAFL08-18-M11 AV795702;AV826604;AY128393 cytochrome P450, putative
5 3 11 9 RAFL08-18-J08 AY062713 Experimental RAFL08-18-J08 AV795657;AV826592;AY062713
5 3 11 10 RAFL08-18-E07 AY062742 Experimental RAFL08-18-E07 AV795587;AV826577;AY062742
5 3 11 11 RAFL08-18-G05 AY062594 Experimental RAFL08-18-G05 AV795615;AV826583;AY062594 Unknown protein (At1g25350)
5 3 11 12 RAFL08-18-H04 BP561631 Experimental RAFL08-18-H04 AV795631;BP561631;AY062597
5 3 11 13 RAFL08-18-E03 AY062720 Experimental RAFL08-18-E03 AV795584;AY062720 putative WRKY-type DNA binding protein
5 3 11 14 RAFL08-18-I02 AV826588 Experimental RAFL08-18-I02 AV795639;AV826588 putative protein
5 3 12 5 RAFL08-19-D10 AY120771 Experimental RAFL08-19-D10 AV795802;AV826617;AY120771 unknown protein
5 3 12 6 RAFL08-19-M09 AY062739 Experimental RAFL08-19-M09 AV795920;AV826636;AY062739 ferredoxin--NADP reductase precursor, putative
5 3 12 7 RAFL08-19-A09 AY062599 Experimental RAFL08-19-A09 AV795762;AY062599 putative protein
5 3 12 8 RAFL08-19-G08 AY062737 Experimental RAFL08-19-G08 AV795840;AV826622;AY062737 putative calmodulin-binding heat shock protein
5 3 12 9 RAFL08-19-C07 AY062600 Experimental RAFL08-19-C07 AV795791;AV826615;AY062600 cytochrome P450 (CYP76C2)
5 3 12 10 RAFL08-19-J06 AV795876 Experimental RAFL08-19-J06 AV795876 hypothetical protein
5 3 12 11 RAFL08-18-J23 AY062731 Experimental RAFL08-18-J23 AV795664;AV826595;AY062731 unknown protein
5 3 12 12 RAFL08-18-E23 BP561630 Experimental RAFL08-18-E23 AV795593;BP561630 auxin transporter splice variant b (PIN4)
5 3 12 13 RAFL08-18-L22 AY062730 Experimental RAFL08-18-L22 AV795694;AY062730 Unknown protein
5 3 12 14 RAFL08-18-M20 AY128394 Experimental RAFL08-18-M20 AV795711;AY128394 putative protein
5 3 13 1 RAFL09-09-N01 AV796852 Experimental RAFL09-09-N01 AV796852 alanine--tRNA ligase, putative
5 3 13 2 RAFL09-09-I01 AV826907 Experimental RAFL09-09-I01 AV796757;AV826907;AF462823 adenosine-5'-phosphosulfate-kinase
5 3 13 3 RAFL09-09-E01 AV826883 Experimental RAFL09-09-E01 AV796686;AV826883 sodium-dicarboxylate cotransporter-like
5 3 13 4 RAFL09-09-C01 AV826872 Experimental RAFL09-09-C01 AV796650;AV826872 60S ribosomal protein L10A
5 3 14 1 RAFL09-12-K03 AV797562 Experimental RAFL09-12-K03 AV797562;AF361620 unknown protein
5 3 14 2 RAFL09-12-H03 AV827208 Experimental RAFL09-12-H03 AV797521;AV827208;AF367298 putative protein transport protein SEC61 alpha subunit
5 3 14 3 RAFL09-11-F24 AV827105 Experimental RAFL09-11-F24 AV797250;AV827105;AF367322 unknown protein
5 3 14 4 RAFL09-11-H23 AV827113 Experimental RAFL09-11-H23 AV797278;AV827113;AF367317 putative protein
5 3 14 5 RAFL09-11-J22 AY037183 Experimental RAFL09-11-J22 AV797312;AV827129;AY037183 nitrate reductase (At1g37130)
5 3 14 6 RAFL09-11-O21 AV827155 Experimental RAFL09-11-O21 AV797391;AV827155;AF361635 SF16 -like protein
5 3 14 7 RAFL09-11-J21 AV827128 Experimental RAFL09-11-J21 AV797311;AV827128;AF361625 unknown protein
5 3 14 8 RAFL09-11-C21 AV827089 Experimental RAFL09-11-C21 AV797203;AV827089;AF367297 putative AAA-type ATPase
5 3 14 9 RAFL09-09-L05 AY128284 Experimental RAFL09-09-L05 AV796818;AY128284 putative protein
5 3 14 10 RAFL09-09-I05 AV826910 Experimental RAFL09-09-I05 AV796761;AV826910 soluble starch synthase
5 3 14 11 RAFL09-09-E05 AV796690 Experimental RAFL09-09-E05 AV796690 probable photosystem I chain XI precursor
5 3 14 12 RAFL09-09-M04 AV826940 Experimental RAFL09-09-M04 AV796834;AV826940 putative protein
5 3 14 13 RAFL09-09-J04 AV826921 Experimental RAFL09-09-J04 AV796777;AV826921;AF462821 proliferating cellular nuclear antigen
5 3 14 14 RAFL09-09-O03 AY090347 Experimental RAFL09-09-O03 AV796869;AV826958;AY090347 unknown protein
5 4 1 1 RAFL06-07-A02 AV823640 Experimental RAFL06-07-A02 AV784644;AV823640 cytochrome c, putative
5 4 1 2 RAFL05-20-L09 AY045863 Experimental RAFL05-20-L09 AV784509;AV823523;AY045863
5 4 1 3 RAFL05-21-D20 AV823569 Experimental RAFL05-21-D20 AV823569 betaine aldehyde dehydrogenase like protein
5 4 1 4 RAFL05-21-H14 AY074337 Experimental RAFL05-21-H14 AV784589;AV823590;AY074337 unknown protein
5 4 1 5 RAFL05-21-N07 AY045976 Experimental RAFL05-21-N07 AV784622;AV823618;AY045976 unknown protein
5 4 1 6 RAFL05-20-N15 AY045947 Experimental RAFL05-20-N15 AV784524;AV823535;AY045947 GTP-binding protein
5 4 1 7 RAFL05-21-K04 AV823597 Experimental RAFL05-21-K04 AV784599;AV823597
5 4 1 8 RAFL05-21-B01 AY045859 Experimental RAFL05-21-B01 AV784549;AV823555;AY045859 DNA damage repair protein, putative
5 4 1 9 RAFL05-21-K22 BP561052 Experimental RAFL05-21-K22 AV784605;BP561052;AY045830 unknown protein
5 4 1 10 RAFL05-21-A18 AY080765 Experimental RAFL05-21-A18 AV784545;AV823552;AY080765 unknown protein (At1g15280)
5 4 1 11 RAFL05-21-I07 AY096644 Experimental RAFL05-21-I07 AV823591;AY096644 hypothetical protein
5 4 1 12 RAFL05-21-H04 AY050999 Experimental RAFL05-21-H04 AV784585;AV823588;AY050999 signal recognition particle 54CP protein precursor
5 4 1 13 RAFL05-21-A21 AV823553 Experimental RAFL05-21-A21 AV784547;AV823553 unknown protein
5 4 1 14 RAFL05-21-J15 BP561049 Experimental RAFL05-21-J15 AV784596;BP561049;AY056224 unknown protein
5 4 2 1 RAFL06-07-K03 AY062851 Experimental RAFL06-07-K03 AV784716;AV823696;AY062851 nucleic acid binding protein-like
5 4 2 2 RAFL06-08-P05 BT002427 Experimental RAFL06-08-P05 AV784860;AV823805;BT002427 ribosomal protein, putative
5 4 2 3 RAFL06-09-F19 AY120785 Experimental RAFL06-09-F19 AV784901;AV823836;AY120785 transmembrane protein
5 4 2 4 RAFL06-09-E13 AV823828 Experimental RAFL06-09-E13 AV784890;AV823828
5 4 2 5 RAFL06-07-K01 AY059949 Experimental RAFL06-07-K01 AV784715;AV823695;AY059949 probable photosystem I chain XI precursor
5 4 2 6 RAFL06-08-N14 AY065170 Experimental RAFL06-08-N14 AV784848;AV823795;AY065170 putative protein
5 4 2 7 RAFL06-08-K14 AY062852 Experimental RAFL06-08-K14 AV784826;AV823776;AY062852 Unknown protein
5 4 2 8 RAFL06-09-L20 AY065160 Experimental RAFL06-09-L20 AV784940;AV823869;AY065160 unknown protein
5 4 2 9 RAFL06-07-F07 AY080879 Experimental RAFL06-07-F07 AV784681;AY080879 unknown protein
5 4 2 10 RAFL06-07-C06 AY050773 Experimental RAFL06-07-C06 AV784658;AV823653;AY050773 unknown protein
5 4 2 11 RAFL06-07-F06 AY074338 Experimental RAFL06-07-F06 AV784680;AV823670;AY074338 unknown protein
5 4 2 12 RAFL06-07-F04 AY091142 Experimental RAFL06-07-F04 AV784679;AV823669;AY091142 unknown protein
5 4 2 13 RAFL06-07-B21 AY045978 Experimental RAFL06-07-B21 AV784657;AV823652;AY045978 putative protein
5 4 2 14 RAFL06-07-F03 AY045950 Experimental RAFL06-07-F03 AV784678;AV823668;AY045950 geranylgeranylated protein, putative
5 4 3 1 RAFL06-09-N14 AY062864 Experimental RAFL06-09-N14 AV784952;AV823878;AY062864 unknown protein
5 4 3 2 RAFL06-08-I04 BT002442 Experimental RAFL06-08-I04 AV784809;AV823765;BT002442 elongation factor 1-alpha
5 4 3 3 RAFL06-08-D09 AY065178 Experimental RAFL06-08-D09 AV784780;AV823744;AY065178 unknown protein
5 4 3 4 RAFL06-08-C03 AY059950 Experimental RAFL06-08-C03 AV784770;AV823737;AY059950 Unknown protein
5 4 3 5 RAFL06-08-I01 AY065174 Experimental RAFL06-08-I01 AV784808;AV823764;AY065174 26S proteasome AAA-ATPase subunit RPT6a
5 4 3 6 RAFL06-09-K13 BT000459 Experimental RAFL06-09-K13 AV784934;AV823863;BT000459
5 4 3 7 RAFL06-08-A13 AY065172 Experimental RAFL06-08-A13 AV784761;AV823728;AY065172
5 4 3 8 RAFL06-09-F24 AY059946 Experimental RAFL06-09-F24 AV784903;AV823838;AY059946 Unknown protein
5 4 3 9 RAFL06-09-E18 AY065171 Experimental RAFL06-09-E18 AV784892;AV823830;AY065171 unknown protein
5 4 3 10 RAFL06-09-D08 AY081325 Experimental RAFL06-09-D08 AV784881;AV823821;AY081325 unknown protein
5 4 3 11 RAFL06-09-J02 AY093008 Experimental RAFL06-09-J02 AV784924;AV823856;AY093008 unknown protein
5 4 3 12 RAFL06-09-H06 AY065165 Experimental RAFL06-09-H06 AV784913;AV823847;AY065165 chlorophyll a/b-binding protein
5 4 3 13 RAFL06-07-N16 AV784739 Experimental RAFL06-07-N16 AV784739 ATP-dependent clp protease proteolytic subunit (nClpP1)
5 4 3 14 RAFL06-07-M10 BP561067 Experimental RAFL06-07-M10 AV784728;BP561067 hypothetical protein
5 4 4 1 RAFL06-14-L16 AV824155 Experimental RAFL06-14-L16 AV785321;AV824155 ribulose bisphosphate carboxylase small chain 1b precursor (RuBisCO small subunit 1b) (sp|P10796)
5 4 4 2 RAFL06-16-G02 AV824234 Experimental RAFL06-16-G02 AV785438;AV824234 cucumisin precursor - like
5 4 4 3 RAFL06-16-E14 AY090369 Experimental RAFL06-16-E14 AV785430;AV824228;AY090369 putative cinnamyl alcohol dehydrogenase
5 4 4 4 RAFL06-16-D02 AV824223 Experimental RAFL06-16-D02 AV785421;AV824223 myosin
5 4 4 5 RAFL06-16-A22 BP561198 Experimental RAFL06-16-A22 AV785411;BP561198 Oxygen-evolving enhancer protein 3 precursor - like protein
5 4 4 6 RAFL06-15-P14 AY075598 Experimental RAFL06-15-P14 AV785403;AV824210;AY075598
5 4 4 7 RAFL06-15-A20 BP561180 Experimental RAFL06-15-A20 AV785326;BP561180;AY075604 unknown protein
5 4 4 8 RAFL06-14-K21 AY094446 Experimental RAFL06-14-K21 AV785320;AV824154;AY094446 N-glyceraldehyde-2-phosphotransferase-like
5 4 4 9 RAFL06-14-E22 AV824145 Experimental RAFL06-14-E22 AV785308;AV824145 vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2)
5 4 4 10 RAFL06-16-F21 BP561204 Experimental RAFL06-16-F21 AV785437;BP561204;AY094445 putative glutaredoxin
5 4 4 11 RAFL06-16-E12 AY090363 Experimental RAFL06-16-E12 AV785429;AV824227;AY090363 putative mitogen activated protein kinase kinase
5 4 4 12 RAFL06-16-C23 AV824222 Experimental RAFL06-16-C23 AV785420;AV824222 unknown protein
5 4 4 13 RAFL06-09-M03 AY065182 Experimental RAFL06-09-M03 AV784943;AV823872;AY065182 2S storage protein-like
5 4 4 14 RAFL06-09-M02 AY065180 Experimental RAFL06-09-M02 AV784942;AV823871;AY065180 putative protein
5 4 5 1 RAFL07-10-A11 AY059774 Experimental RAFL07-10-A11 AV791321;AV825453;AY059774 unknown protein
5 4 5 2 RAFL07-10-M10 AV825544 Experimental RAFL07-10-M10 AV791499;AV825544
5 4 5 9 RAFL06-16-O09 AY075605 Experimental RAFL06-16-O09 AV785497;AV824276;AY075605 ids4-like protein
5 4 5 10 RAFL06-16-P16 AY090370 Experimental RAFL06-16-P16 AV785506;AV824279;AY090370 unknown protein
5 4 5 11 RAFL06-16-P14 AY139762 Experimental RAFL06-16-P14 AV785505;AY139762 putative protein
5 4 5 12 RAFL06-16-M15 AY127013 Experimental RAFL06-16-M15 AV785486;AV824266;AY127013 unknown protein
5 4 5 13 RAFL06-16-M11 AV824265 Experimental RAFL06-16-M11 AV785485;AV824265 actin 2
5 4 5 14 RAFL06-16-M03 BP561209 Experimental RAFL06-16-M03 AV785484;BP561209;AY090356 unknown protein
5 4 6 1 RAFL07-10-I24 AY050874 Experimental RAFL07-10-I24 AV791448;AV825518;AY050874 NifS-like aminotranfserase
5 4 6 2 RAFL07-10-F24 AY064009 Experimental RAFL07-10-F24 AV791401;AV825492;AY064009 methionyl-tRNA synthetase - like protein
5 4 6 3 RAFL07-10-G23 AY059776 Experimental RAFL07-10-G23 AV791419;AV825503;AY059776 disease resistance Cf-2 like protein
5 4 6 4 RAFL07-10-P22 BP561446 Experimental RAFL07-10-P22 AV791554;BP561446;AY064005 unknown protein
5 4 6 5 RAFL07-10-P19 AY050796 Experimental RAFL07-10-P19 AV791552;AV825563;AY050796 RNA-binding protein-like
5 4 6 6 RAFL07-10-M19 AY050784 Experimental RAFL07-10-M19 AV791505;AV825547;AY050784 Col-0 casein kinase I like protein
5 4 6 7 RAFL07-10-O18 AY050872 Experimental RAFL07-10-O18 AV791539;AV825559;AY050872 unknown protein
5 4 6 8 RAFL07-10-D18 AY045869 Experimental RAFL07-10-D18 AV791364;AY045869 aluminum-induced protein-like
5 4 6 9 RAFL07-10-C17 AY056210 Experimental RAFL07-10-C17 AV791348;AV825465;AY056210 putative replication factor C subunit
5 4 6 10 RAFL07-10-J16 BP561444 Experimental RAFL07-10-J16 AV791457;BP561444;AY056203 unknown protein
5 4 6 11 RAFL07-10-C13 AY056143 Experimental RAFL07-10-C13 AV791346;AV825463;AY056143 putative protein
5 4 6 12 RAFL07-10-F12 AY080798 Experimental RAFL07-10-F12 AV791390;AV825489;AY080798 putative protein
5 4 6 13 RAFL07-10-P11 AY050869 Experimental RAFL07-10-P11 AV791548;AV825561;AY050869 ATP sulfurylase, putative
5 4 6 14 RAFL07-10-E11 AY080842 Experimental RAFL07-10-E11 AV791373;AV825481;AY080842 unknown protein
5 4 7 1 RAFL07-15-A09 BP561480 Experimental RAFL07-15-A09 AV792437;BP561480;AY062650 fatty acid multifunctional protein (AtMFP2)
5 4 7 2 RAFL07-15-H08 AY059860 Experimental RAFL07-15-H08 AV792532;AV825826;AY059860 geranylgeranyl reductase
5 4 7 3 RAFL07-15-B07 AY059856 Experimental RAFL07-15-B07 AV792447;AV825801;AY059856 cell division protein - like
5 4 7 4 RAFL07-15-I06 AY059854 Experimental RAFL07-15-I06 AV792545;AV825830;AY059854 serine carboxypeptidase II (At1g28110)
5 4 7 5 RAFL07-15-D06 AV825807 Experimental RAFL07-15-D06 AV792471;AV825807
5 4 7 6 RAFL07-15-O05 AV825850 Experimental RAFL07-15-O05 AV792622;AV825850 Mei2-like protein
5 4 7 7 RAFL07-11-C14 AY045885 Experimental RAFL07-11-C14 AV791589;AY045885
5 4 7 8 RAFL07-11-C13 BP561449 Experimental RAFL07-11-C13 AV791588;BP561449;AY046048 calmodulin-3
5 4 7 9 RAFL07-11-D11 AY056128 Experimental RAFL07-11-D11 AV791601;AV825574;AY056128 receptor-kinase isolog, 5' partial
5 4 7 10 RAFL07-11-H09 AY050775 Experimental RAFL07-11-H09 AV791655;AV825587;AY050775
5 4 7 11 RAFL07-11-B09 AV791571 Experimental RAFL07-11-B09 AV791571 RING-H2 finger protein RHF2a
5 4 7 12 RAFL07-11-F08 AY057579 Experimental RAFL07-11-F08 AV791625;AV825580;AY057579 putative mitochondrial processing peptidase
5 4 7 13 RAFL07-11-C01 AV791581 Experimental RAFL07-11-C01 AV791581 hypothetical protein
5 4 7 14 RAFL07-10-K24 BT000801 Experimental RAFL07-10-K24 AV791476;AV825534;BT000801 unknown protein (At1g71810)
5 4 8 1 RAFL07-16-C09 AY062525 Experimental RAFL07-16-C09 AV792678;AV825858;AY062525 Unknown protein (At1g80270; F5I6.2)
5 4 8 2 RAFL07-16-E08 AY062519 Experimental RAFL07-16-E08 AV792707;AV825864;AY062519 Unknown protein
5 4 8 3 RAFL07-15-F22 AY059855 Experimental RAFL07-15-F22 AV792508;AV825818;AY059855 putative pyrophosphate-dependent phosphofructokinase alpha subunit
5 4 8 4 RAFL07-15-M21 AY054507 Experimental RAFL07-15-M21 AV792605;AY054507 unknown protein
5 4 8 5 RAFL07-15-C21 AV792465 Experimental RAFL07-15-C21 AV792465 lipase/hydrolase like protein
5 4 8 6 RAFL07-15-H20 AY062514 Experimental RAFL07-15-H20 AV792538;AY062514 disease resistance protein RPP8
5 4 8 7 RAFL07-15-H19 AY062513 Experimental RAFL07-15-H19 AV792537;AV825828;AY062513 hypothetical protein
5 4 8 8 RAFL07-15-M18 AY062518 Experimental RAFL07-15-M18 AV792602;AV825845;AY062518 CLC-b chloride channel protein
5 4 8 9 RAFL07-15-K15 AY065188 Experimental RAFL07-15-K15 AV792576;AY065188 unknown protein (At1g49360; F13F21.21)
5 4 8 10 RAFL07-15-F15 BP561483 Experimental RAFL07-15-F15 AV792506;BP561483;AY059853 Unknown protein (At3g17430; MTO12.2)
5 4 8 11 RAFL07-15-H14 AY062504 Experimental RAFL07-15-H14 AV792535;AY062504 Unknown protein (At1g28240)
5 4 8 12 RAFL07-15-B14 AV825803 Experimental RAFL07-15-B14 AV792450;AV825803 similar to disease resistance protein
5 4 8 13 RAFL07-15-L13 AV792588 Experimental RAFL07-15-L13 AV792588 unknown protein
5 4 8 14 RAFL07-15-F13 AY081315 Experimental RAFL07-15-F13 AV792505;AY081315 4-alpha-glucanotransferase
5 4 9 1 RAFL08-09-B21 BP561526 Experimental RAFL08-09-B21 AV793538;BP561526;AY048277 dTDP-D-glucose 4,6-dehydratase, putative
5 4 9 2 RAFL08-09-G20 AY049232 Experimental RAFL08-09-G20 AV793608;AY049232 unknown protein
5 4 9 3 RAFL08-09-E20 AY048250 Experimental RAFL08-09-E20 AV793577;AV826100;AY048250 40S ribosomal protein S2
5 4 9 4 RAFL08-09-H19 AY056779 Experimental RAFL08-09-H19 AV793624;AV826114;AY056779 pyrophosphate-fructose-6-phosphate 1-phosphotransferase-like protein
5 4 9 5 RAFL08-09-M14 AY048301 Experimental RAFL08-09-M14 AV793691;AV826134;AY048301 unknown protein
5 4 9 6 RAFL08-09-F14 AY048283 Experimental RAFL08-09-F14 AV793586;AV826102;AY048283 endo-1,4-beta-glucanase
5 4 9 7 RAFL08-09-P12 AY048278 Experimental RAFL08-09-P12 AV793728;AV826142;AY048278 unknown protein
5 4 9 8 RAFL08-09-K12 AY049231 Experimental RAFL08-09-K12 AV793664;AV826127;AY049231 unknown protein
5 4 9 9 RAFL08-09-P11 BP561535 Experimental RAFL08-09-P11 AV793727;BP561535;AY048257 phytochelatin synthase 1 (AtPCS1)
5 4 9 10 RAFL08-09-I11 AV793633 Experimental RAFL08-09-I11 AV793633 serine protease-like protein
5 4 9 11 RAFL07-16-B14 BP561488 Experimental RAFL07-16-B14 AV792665;BP561488 hypothetical protein
5 4 9 12 RAFL07-16-F12 BT002041 Experimental RAFL07-16-F12 AV792727;AV825868;BT002041 putative transportin
5 4 9 13 RAFL07-16-F11 AY062522 Experimental RAFL07-16-F11 AV792726;AY062522 unknown protein
5 4 9 14 RAFL07-16-C10 AY062521 Experimental RAFL07-16-C10 AV792679;AV825859;AY062521 putative GDP-mannose pyrophosphorylase
5 4 10 1 RAFL08-10-D20 AY048298 Experimental RAFL08-10-D20 AV793789;AV826150;AY048298 unknown protein
5 4 10 2 RAFL08-10-I18 AY049236 Experimental RAFL08-10-I18 AV793861;AV826168;AY049236 putative protein
5 4 10 3 RAFL08-10-L17 AY048272 Experimental RAFL08-10-L17 AV793902;AY048272 unknown protein
5 4 10 4 RAFL08-10-G17 AY048261 Experimental RAFL08-10-G17 AV793828;AV826161;AY048261 putative ubiquitin carboxyl terminal hydrolase
5 4 10 5 RAFL08-10-B15 AY048256 Experimental RAFL08-10-B15 AV793757;AV826148;AY048256 putative sucrose transport protein, SUC2
5 4 10 6 RAFL08-10-A14 AY049228 Experimental RAFL08-10-A14 AV793745;AV826146;AY049228 unknown protein
5 4 10 7 RAFL08-10-K08 AY048297 Experimental RAFL08-10-K08 AV793884;AV826175;AY048297 glucosyltransferase-like protein
5 4 10 8 RAFL08-10-H08 AY048285 Experimental RAFL08-10-H08 AV793837;AV826165;AY048285 unknown protein
5 4 10 9 RAFL08-10-D08 BP561538 Experimental RAFL08-10-D08 AV793781;BP561538;AY075649 digalactosyldiacylglycerol synthase
5 4 10 10 RAFL08-10-B08 BP561537 Experimental RAFL08-10-B08 AV793752;BP561537;AY102106 putative bHLH transcription factor (bHLH104)
5 4 10 11 RAFL08-10-K07 AY048258 Experimental RAFL08-10-K07 AV793883;AV826174;AY048258 unknown protein
5 4 10 12 RAFL08-10-H06 AY048240 Experimental RAFL08-10-H06 AV793836;AV826164;AY048240 nitrilase 2
5 4 10 13 RAFL08-09-G22 AY048295 Experimental RAFL08-09-G22 AV793610;AV826109;AY048295 polygalacturonase inhibiting protein 1; PGIP1 (gb|AAF69827.1)
5 4 10 14 RAFL08-09-J21 AY048284 Experimental RAFL08-09-J21 AV793653;AV826124;AY048284
5 4 11 1 RAFL08-15-N16 AY045878 Experimental RAFL08-15-N16 AV795068;AV826470;AY045878 unknown protein
5 4 11 2 RAFL08-15-M15 AY050810 Experimental RAFL08-15-M15 AV795051;AV826466;AY050810 putative ABC transporter
5 4 11 3 RAFL08-15-L09 AV826461 Experimental RAFL08-15-L09 AV795037;AV826461 putative protein
5 4 11 4 RAFL08-15-C09 AY056172 Experimental RAFL08-15-C09 AV794902;AV826439;AY056172 transcription factor WRKY6
5 4 11 5 RAFL08-15-E08 AY056273 Experimental RAFL08-15-E08 AV794934;AV826444;AY056273 putative protein
5 4 11 6 RAFL08-15-L07 BP561604 Experimental RAFL08-15-L07 AV795035;BP561604 putative tetracycline resistance efflux protein
5 4 11 7 RAFL08-15-D07 AY056235 Experimental RAFL08-15-D07 AV794917;AV826442;AY056235 putative CAAX prenyl protease
5 4 11 8 RAFL08-15-C06 AY090964 Experimental RAFL08-15-C06 AV794901;AV826438;AY090964 unknown protein
5 4 11 9 RAFL08-14-K24 BT000772 Experimental RAFL08-14-K24 AV794817;AV826417;BT000772 dynamin-like protein CF1
5 4 11 10 RAFL08-14-G20 AY059791 Experimental RAFL08-14-G20 AV794774;AV826409;AY059791 anion channel protein (gb|AAC05742.1)
5 4 11 11 RAFL08-14-B20 AY080794 Experimental RAFL08-14-B20 AV794710;AV826396;AY080794 putative protein
5 4 11 12 RAFL08-14-H19 AY056283 Experimental RAFL08-14-H19 AV794784;AV826411;AY056283 unknown protein
5 4 11 13 RAFL08-14-A19 AY057578 Experimental RAFL08-14-A19 AV794701;AV826394;AY057578 unknown protein
5 4 11 14 RAFL08-14-I18 AY064013 Experimental RAFL08-14-I18 AV794792;AV826412;AY064013 receptor kinase-like protein
5 4 12 1 RAFL09-06-G17 AY062763 Experimental RAFL09-06-G17 AV796067;AV826694;AY062763 Similar to beta-glucosidases (At1g02850)
5 4 12 2 RAFL09-06-D17 AY059908 Experimental RAFL09-06-D17 AV796020;AV826672;AY059908 unknown protein
5 4 12 3 RAFL09-06-O16 AY062756 Experimental RAFL09-06-O16 AV796188;AV826752;AY062756 Unknown protein (T9L6.1)
5 4 12 4 RAFL09-06-M16 AY062746 Experimental RAFL09-06-M16 AV796152;AV826734;AY062746 Na+/H+ antiporter like protein
5 4 12 5 RAFL08-16-C14 AY059735 Experimental RAFL08-16-C14 AV795135;AV826481;AY059735 putative phosphatidylglycerotransferase
5 4 12 6 RAFL08-16-B13 BP561607 Experimental RAFL08-16-B13 AV795121;BP561607;AY142547 putative glucanase
5 4 12 7 RAFL08-16-C12 AY056317 Experimental RAFL08-16-C12 AV795133;AY056317 receptor like protein kinase
5 4 12 8 RAFL08-16-F08 AY050934 Experimental RAFL08-16-F08 AV795173;AV826489;AY050934 ES43 like protein
5 4 12 9 RAFL08-16-D06 BP561608 Experimental RAFL08-16-D06 AV795144;BP561608;AY050825 putative protein
5 4 12 10 RAFL08-16-E05 BT000691 Experimental RAFL08-16-E05 AV795158;AV826487;BT000691 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
5 4 12 11 RAFL08-15-M21 AY063913 Experimental RAFL08-15-M21 AV795056;AV826468;AY063913 unknown protein
5 4 12 12 RAFL08-15-K19 AY056174 Experimental RAFL08-15-K19 AV795027;AV826459;AY056174 putative C2H2-type zinc finger protein
5 4 12 13 RAFL08-15-G18 AY050944 Experimental RAFL08-15-G18 AV794973;AV826447;AY050944 His-Asp Phosphotransfer Signal Transducer AHP3
5 4 12 14 RAFL08-15-K17 AY050933 Experimental RAFL08-15-K17 AV795025;AV826458;AY050933 ribosomal protein S4
5 4 13 1 RAFL09-07-D06 AY059910 Experimental RAFL09-07-D06 AV796252;AV826785;AY059910 putative xyloglucan-specific glucanase
5 4 13 2 RAFL09-07-B06 AY062618 Experimental RAFL09-07-B06 AV796222;AV826771;AY062618 similar to ATP-dependent RNA helicase
5 4 13 3 RAFL09-07-D04 AY062617 Experimental RAFL09-07-D04 AV796250;AV826784;AY062617 ribosomal protein L27, putative
5 4 13 4 RAFL09-07-E03 AY062615 Experimental RAFL09-07-E03 AV796270;AV826795;AY062615 Unknown protein
5 4 13 5 RAFL09-07-D02 AY062613 Experimental RAFL09-07-D02 AV796249;AV826783;AY062613 putative RNA-binding protein MEI2 (At1g29400)
5 4 13 6 RAFL09-07-A02 AY059907 Experimental RAFL09-07-A02 AV796206;AV826761;AY059907 sigma-like factor (SIG4)
5 4 13 7 RAFL09-06-C22 AY062759 Experimental RAFL09-06-C22 AV796009;AV826665;AY062759 4-coumarate-CoA ligase -like protein
5 4 13 8 RAFL09-06-P21 AV826760 Experimental RAFL09-06-P21 AV796204;AV826760
5 4 13 9 RAFL09-06-M21 AY062757 Experimental RAFL09-06-M21 AV796156;AV826736;AY062757 unknown protein
5 4 13 10 RAFL09-06-H21 AY120773 Experimental RAFL09-06-H21 AV796086;AV826702;AY120773 unknown protein
5 4 13 11 RAFL09-06-L20 BT002400 Experimental RAFL09-06-L20 AV796141;AV826728;BT002400 unknown protein
5 4 13 12 RAFL09-06-J20 AY062753 Experimental RAFL09-06-J20 AV796111;AY062753 glucosyltransferase -like protein
5 4 13 13 RAFL09-06-M17 BP561649 Experimental RAFL09-06-M17 AV796153;BP561649;AY120772 hypothetical protein
5 4 13 14 RAFL09-06-J17 BT002404 Experimental RAFL09-06-J17 AV796108;BT002404
5 4 14 1 RAFL09-10-H06 AV827007 Experimental RAFL09-10-H06 AV797018;AV827007;AF462827 putative protein
5 4 14 2 RAFL09-10-C06 AY058152 Experimental RAFL09-10-C06 AV796930;AV826980;AY058152 sugar transporter like protein
5 4 14 3 RAFL09-10-C03 AY058201 Experimental RAFL09-10-C03 AV796928;AV826979;AY058201 predicted GPI-anchored protein
5 4 14 4 RAFL09-10-K02 AV827027 Experimental RAFL09-10-K02 AV797064;AV827027 hypothetical protein
5 4 14 5 RAFL09-10-G02 AY128289 Experimental RAFL09-10-G02 AV796998;AV827000;AY128289 putative RNA methyltransferase
5 4 14 6 RAFL09-10-D02 AY069880 Experimental RAFL09-10-D02 AV796942;AV826986;AY069880 poly(A) polymerase like protein
5 4 14 7 RAFL09-10-M01 AY069878 Experimental RAFL09-10-M01 AV797094;AV827042;AY069878 trehalose-6-phosphate phosphatase - like protein
5 4 14 8 RAFL09-10-K01 AY058158 Experimental RAFL09-10-K01 AV797063;AV827026;AY058158
5 4 14 9 RAFL09-07-B18 BP561654 Experimental RAFL09-07-B18 AV796231;BP561654
5 4 14 10 RAFL09-07-B17 AV826775 Experimental RAFL09-07-B17 AV796230;AV826775 unknown protein
5 4 14 11 RAFL09-07-C15 AY120777 Experimental RAFL09-07-C15 AV796243;AV826780;AY120777 neutral invertase, putative
5 4 14 12 RAFL09-07-A14 AY059917 Experimental RAFL09-07-A14 AV796214;AV826765;AY059917 AP2 domain containing protein RAP2.3
5 4 14 13 RAFL09-07-A13 AY059916 Experimental RAFL09-07-A13 AV796213;AY059916 proline iminopeptidase
5 4 14 14 RAFL09-07-C12 BT002386 Experimental RAFL09-07-C12 AV796241;BP561656;BT002386 putative protein
6 1 1 1 RAFL06-09-F15 AY062808 Experimental RAFL06-09-F15 AV784899;AV823834;AY062808 unknown protein
6 1 1 2 RAFL06-09-E11 AY062806 Experimental RAFL06-09-E11 AV784889;AV823827;AY062806 unknown protein
6 1 1 3 RAFL06-09-C07 AY062805 Experimental RAFL06-09-C07 AV784877;AV823818;AY062805
6 1 1 4 RAFL06-09-A05 AY072345 Experimental RAFL06-09-A05 AV784868;AV823811;AY072345 unknown protein
6 1 1 5 RAFL06-08-N09 AY059929 Experimental RAFL06-08-N09 AV784846;AV823793;AY059929 chloroplast ribosomal L1 - like protein
6 1 1 6 RAFL06-08-H08 AY062804 Experimental RAFL06-08-H08 AV784803;AV823761;AY062804 A6 anther-specific protein (Z97335.16)
6 1 1 7 RAFL06-07-I09 BT002433 Experimental RAFL06-07-I09 AV784701;AV823686;BT002433 putative bHLH transcription factor (bHLH115)
6 1 1 8 RAFL06-08-N08 AY062798 Experimental RAFL06-08-N08 AV784845;AV823792;AY062798 disease resistance protein PRM1
6 1 1 9 RAFL06-08-K09 AY059926 Experimental RAFL06-08-K09 AV784824;AV823774;AY059926 putative phosphoglucomutase
6 1 1 10 RAFL06-08-H02 AY062796 Experimental RAFL06-08-H02 AV784802;AV823760;AY062796 putative 40S ribosomal protein S3A (S phase specific)
6 1 1 11 RAFL06-08-E07 AV823749 Experimental RAFL06-08-E07 AV784784;AV823749 putative 2-cys peroxiredoxin
6 1 1 12 RAFL06-09-J23 AY072343 Experimental RAFL06-09-J23 AV784929;AV823858;AY072343 putative protein
6 1 1 13 RAFL06-08-D21 AY062791 Experimental RAFL06-08-D21 AV784783;AV823748;AY062791 60S RIBOSOMAL PROTEIN L36 homolog
6 1 1 14 RAFL06-09-H23 AV823850 Experimental RAFL06-09-H23 AV784918;AV823850 unknown protein
6 1 2 1 RAFL06-13-C15 AY070730 Experimental RAFL06-13-C15 AV785214;AV824071;AY070730 legumin-like protein
6 1 2 2 RAFL06-15-G17 AV785353 Experimental RAFL06-15-G17 AV785353 chlorophyll a/b-binding protein CP29
6 1 2 3 RAFL06-13-I20 AY070755 Experimental RAFL06-13-I20 AV824104;AY070755 glycine-rich RNA binding protein, putative
6 1 2 4 RAFL06-13-H16 AY125509 Experimental RAFL06-13-H16 AV785243;AV824095;AY125509 aminomethyltransferase-like precursor protein
6 1 2 5 RAFL06-15-M17 AV824192 Experimental RAFL06-15-M17 AV785381;AV824192 putative protein
6 1 2 6 RAFL06-15-K18 BP561191 Experimental RAFL06-15-K18 AV785371;BP561191;AY070750 unknown protein
6 1 2 7 RAFL06-15-G14 AV824174 Experimental RAFL06-15-G14 AV785352;AV824174 putative protein
6 1 2 8 RAFL06-15-D19 AY070729 Experimental RAFL06-15-D19 AV785341;AV824166;AY070729 hypothetical protein
6 1 2 9 RAFL06-09-K08 AY093000 Experimental RAFL06-09-K08 AV784931;AV823860;AY093000 hypothetical protein
6 1 2 10 RAFL06-09-I21 AY065142 Experimental RAFL06-09-I21 AV784922;AV823854;AY065142 unknown protein
6 1 2 11 RAFL06-09-G19 AY128408 Experimental RAFL06-09-G19 AV784911;AY128408 calcium dependent protein kinase CP4
6 1 2 12 RAFL06-09-F16 AY065140 Experimental RAFL06-09-F16 AV784900;AV823835;AY065140 putative chlorophyll a/b-binding protein
6 1 2 13 RAFL06-07-L23 AY062813 Experimental RAFL06-07-L23 AV784726;AV823706;AY062813 unknown protein
6 1 2 14 RAFL06-07-J22 AY065138 Experimental RAFL06-07-J22 AV784714;AV823694;AY065138
6 1 3 1 RAFL06-15-N06 BP561194 Experimental RAFL06-15-N06 AV785384;BP561194;AY125515 putative NAK-like ser/thr protein kinase
6 1 3 2 RAFL06-15-L14 AV785373 Experimental RAFL06-15-L14 AV785373 unknown protein
6 1 3 3 RAFL06-15-I24 AY070743 Experimental RAFL06-15-I24 AV785364;AY070743 predicted GPI-anchored protein
6 1 3 4 RAFL06-15-G19 AV824176 Experimental RAFL06-15-G19 AV785355;AV824176 phosphatidylserine decarboxylase like protein
6 1 3 5 RAFL06-16-E06 BP561201 Experimental RAFL06-16-E06 AV785428;BP561201 Avr9 elicitor response like protein
6 1 3 6 RAFL06-16-C19 AY125518 Experimental RAFL06-16-C19 AV785419;AV824221;AY125518 unknown protein
6 1 3 7 RAFL06-15-P10 AY070736 Experimental RAFL06-15-P10 AV785401;AV824208;AY070736 putative protein
6 1 3 8 RAFL06-15-O06 AY125514 Experimental RAFL06-15-O06 AV785390;AV824199;AY125514 hypothetical protein
6 1 3 9 RAFL06-13-E21 AY125520 Experimental RAFL06-13-E21 AV785225;AV824080;AY125520 putative protein
6 1 3 10 RAFL06-15-I19 AY070742 Experimental RAFL06-15-I19 AV785363;AV824180;AY070742 unknown protein
6 1 3 11 RAFL06-13-K19 AY125510 Experimental RAFL06-13-K19 AV785263;AV824114;AY125510 putative protein
6 1 3 12 RAFL06-13-I21 AY070738 Experimental RAFL06-13-I21 AV785252;AV824105;AY070738 putative DNA-binding protein
6 1 3 13 RAFL06-13-H19 BP561163 Experimental RAFL06-13-H19 AV785244;BP561163;AY070737 unknown protein
6 1 3 14 RAFL06-13-E18 AY072540 Experimental RAFL06-13-E18 AV785224;AV824079;AY072540 putative 60S ribosomal protein L18A
6 1 4 1 RAFL07-10-G01 AY056135 Experimental RAFL07-10-G01 AV791402;AV825493;AY056135 hypothetical protein
6 1 4 2 RAFL07-10-D01 AY050893 Experimental RAFL07-10-D01 AV791351;AV825467;AY050893 geranylgeranyl reductase
6 1 4 3 RAFL07-09-I24 AY050865 Experimental RAFL07-09-I24 AV791237;AV825416;AY050865
6 1 4 4 RAFL07-09-M23 AY045897 Experimental RAFL07-09-M23 AV791280;AV825437;AY045897 unknown protein
6 1 4 5 RAFL07-09-O22 BT000662 Experimental RAFL07-09-O22 AV791303;AV825450;BT000662 putative mitochondrial processing peptidase
6 1 4 6 RAFL07-09-L22 AY056200 Experimental RAFL07-09-L22 AV791268;AV825430;AY056200 UDP-glucose dehydrogenase-like protein
6 1 4 7 RAFL07-09-O18 BT000654 Experimental RAFL07-09-O18 AV791301;AV825449;BT000654 2-oxoglutarate/malate translocator
6 1 4 8 RAFL07-09-C18 AY051007 Experimental RAFL07-09-C18 AV791164;AV825391;AY051007 putative protein
6 1 4 9 RAFL07-09-J17 AY050863 Experimental RAFL07-09-J17 AV791244;AV825421;AY050863 unknown protein (F25L23_160/AT3g59300)
6 1 4 10 RAFL07-09-M16 BT000669 Experimental RAFL07-09-M16 AV791276;AV825435;BT000669 ketol-acid reductoisomerase
6 1 4 11 RAFL07-09-G16 BT000791 Experimental RAFL07-09-G16 AV791211;AV825407;BT000791 unknown protein (At1g52160)
6 1 4 12 RAFL07-09-A16 AY056199 Experimental RAFL07-09-A16 AV791140;AV825382;AY056199 unknown protein
6 1 4 13 RAFL06-16-A20 AY125517 Experimental RAFL06-16-A20 AV824215;AY125517 unknown protein, 3' partial
6 1 4 14 RAFL06-13-I03 AY070740 Experimental RAFL06-13-I03 AV785246;AV824097;AY070740 lysophospholipase homolog, putative (At1g18360)
6 1 5 1 RAFL07-14-H02 BP561474 Experimental RAFL07-14-H02 AV792316;BP561474;AY072331 aspartate--tRNA ligase - like protein
6 1 5 2 RAFL07-14-E01 AY065187 Experimental RAFL07-14-E01 AV792270;AV825754;AY065187 putative diphenol oxidase
6 1 5 3 RAFL07-10-J10 AY050957 Experimental RAFL07-10-J10 AV791455;AV825521;AY050957 eukaryotic protein synthesis initiation factor 4A
6 1 5 4 RAFL07-10-G10 AY050895 Experimental RAFL07-10-G10 AV791410;AV825498;AY050895 glycyl-tRNA synthetase
6 1 5 5 RAFL07-10-C10 AY046040 Experimental RAFL07-10-C10 AV791344;AV825462;AY046040 unknown protein
6 1 5 6 RAFL07-10-P09 AY045901 Experimental RAFL07-10-P09 AV791546;AV825560;AY045901 putative Dihydroorotase
6 1 5 7 RAFL07-10-L09 AY074527 Experimental RAFL07-10-L09 AV791482;AV825536;AY074527 RING-H2 finger protein RHF2a
6 1 5 8 RAFL07-10-G09 AY056201 Experimental RAFL07-10-G09 AV791409;AV825497;AY056201 putative endoxyloglucan glycosyltransferase
6 1 5 9 RAFL07-10-M06 AY056137 Experimental RAFL07-10-M06 AV791496;AV825542;AY056137 putative RNA helicase (MMI9.2)
6 1 5 10 RAFL07-10-H06 AY080797 Experimental RAFL07-10-H06 AV791423;AV825505;AY080797
6 1 5 11 RAFL07-10-D06 AY050867 Experimental RAFL07-10-D06 AV791355;AV825471;AY050867 putative tetrahydrofolylpolyglutamate synthase precursor
6 1 5 12 RAFL07-10-N05 AY056259 Experimental RAFL07-10-N05 AV791512;AV825551;AY056259 putative protein kinase
6 1 5 13 RAFL07-10-H05 BP561441 Experimental RAFL07-10-H05 AV791422;BP561441 putative protein
6 1 5 14 RAFL07-10-C05 AV825460 Experimental RAFL07-10-C05 AV791342;AV825460 UDP rhamnose-anthocyanidin-3-glucoside rhamnosyltransferase - like protein
6 1 6 1 RAFL07-14-E20 BT002044 Experimental RAFL07-14-E20 AV792281;AV825759;BT002044 100 kDa coactivator - like protein
6 1 6 2 RAFL07-14-P19 AY062459 Experimental RAFL07-14-P19 AV792430;AV825795;AY062459 MEKK1/MAP kinase kinase kinase
6 1 6 3 RAFL07-14-O18 AV825790 Experimental RAFL07-14-O18 AV792417;AV825790 putative ripening-related protein - like
6 1 6 4 RAFL07-14-J18 AV825772 Experimental RAFL07-14-J18 AV792349;AV825772 unknown protein
6 1 6 5 RAFL07-14-K13 AY120751 Experimental RAFL07-14-K13 AV792363;AV825775;AY120751 unknown protein
6 1 6 6 RAFL07-14-A13 AY062450 Experimental RAFL07-14-A13 AV792224;AV825747;AY062450 putative protein
6 1 6 7 RAFL07-14-D12 AY059840 Experimental RAFL07-14-D12 AV792260;AV825753;AY059840 putative trehalose-6-phosphate phosphatase (AtTPPA)
6 1 6 8 RAFL07-14-H10 AY054479 Experimental RAFL07-14-H10 AV792320;AV825766;AY054479 60S ribosomal protein - like
6 1 6 9 RAFL07-14-N09 AY062448 Experimental RAFL07-14-N09 AV792400;AV825786;AY062448 ABA-responsive element binding bZip transcription factor AREB3 / AtbZip66
6 1 6 10 RAFL07-14-E09 AV825757 Experimental RAFL07-14-E09 AV792274;AV825757 casein kinase II beta chain
6 1 6 11 RAFL07-14-O05 AY062443 Experimental RAFL07-14-O05 AV792410;AV825787;AY062443 putative AAA-type ATPase
6 1 6 12 RAFL07-14-E05 AY062642 Experimental RAFL07-14-E05 AV792272;AV825755;AY062642 glutathione S-transferase
6 1 6 13 RAFL07-14-N04 AY081299 Experimental RAFL07-14-N04 AV792397;AV825784;AY081299 putative trytophanyl-tRNA synthetase
6 1 6 14 RAFL07-14-N02 BP561478 Experimental RAFL07-14-N02 AV792396;BP561478;AY054472 unknown protein
6 1 7 1 RAFL08-08-K07 AY050424 Experimental RAFL08-08-K07 AV793445;AV826064;AY050424 unknown protein
6 1 7 2 RAFL08-08-J06 AY045661 Experimental RAFL08-08-J06 AV793434;AV826059;AY045661 unknown protein
6 1 7 3 RAFL08-08-G05 AY056098 Experimental RAFL08-08-G05 AV793401;AY056098 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
6 1 7 4 RAFL08-08-C05 AY050411 Experimental RAFL08-08-C05 AV793349;AV826032;AY050411 putative protein
6 1 7 5 RAFL08-08-E04 AY050403 Experimental RAFL08-08-E04 AV793371;AV826038;AY050403 unknown protein
6 1 7 6 RAFL08-08-F03 AY050397 Experimental RAFL08-08-F03 AV793386;AV826045;AY050397 oligosaccharyl transferase STT3-like protein
6 1 7 7 RAFL07-15-I05 AV825829 Experimental RAFL07-15-I05 AV792544;AV825829 unknown protein
6 1 7 8 RAFL07-15-N04 AY062468 Experimental RAFL07-15-N04 AV792608;AV825846;AY062468 temperature-sensitive omega-3 fatty acid desaturase, chloroplast precursor (sp|P48622)
6 1 7 9 RAFL07-15-E04 AY062469 Experimental RAFL07-15-E04 AV792483;AV825811;AY062469 unknown protein
6 1 7 10 RAFL07-15-A04 AY059845 Experimental RAFL07-15-A04 AV792434;AV825797;AY059845 unknown protein
6 1 7 11 RAFL07-15-M03 AY062643 Experimental RAFL07-15-M03 AV792594;AY062643 putative anthocyanidin synthase
6 1 7 12 RAFL07-15-C03 AY062466 Experimental RAFL07-15-C03 AV792457;AY062466 Unknown protein (At1g01610; F22L4.15)
6 1 7 13 RAFL07-14-H21 AY059842 Experimental RAFL07-14-H21 AV792326;AV825767;AY059842 mutator-like transposase-like protein (MQK4.25)
6 1 7 14 RAFL07-14-B21 AV825752 Experimental RAFL07-14-B21 AV792241;AV825752 putative protein
6 1 8 1 RAFL08-09-C08 AY050401 Experimental RAFL08-09-C08 AV793544;AY050401 unknown protein
6 1 8 2 RAFL08-09-E07 AY045637 Experimental RAFL08-09-E07 AV793570;AY045637 unknown protein
6 1 8 3 RAFL08-09-P03 AY045673 Experimental RAFL08-09-P03 AV793721;AV826140;AY045673
6 1 8 4 RAFL08-09-N02 AY045658 Experimental RAFL08-09-N02 AV793697;AV826136;AY045658
6 1 8 5 RAFL08-09-E02 AY050419 Experimental RAFL08-09-E02 AV793568;AV826098;AY050419 hypothetical protein
6 1 8 6 RAFL08-09-B01 AY050414 Experimental RAFL08-09-B01 AV793528;AV826086;AY050414 putative SEC1 family transport protein
6 1 8 7 RAFL08-08-C24 BP561519 Experimental RAFL08-08-C24 AV793358;BP561519;AY050400 hypothetical protein
6 1 8 8 RAFL08-08-E23 AY045636 Experimental RAFL08-08-E23 AV793383;AV826043;AY045636 E2F transcription factor like protein
6 1 8 9 RAFL08-08-O16 AY045668 Experimental RAFL08-08-O16 AV793499;AV826077;AY045668 putative oligopeptide transporter
6 1 8 10 RAFL08-08-J16 AY052361 Experimental RAFL08-08-J16 AV793438;AV826060;AY052361 unknown protein
6 1 8 11 RAFL08-08-E16 BP561521 Experimental RAFL08-08-E16 AV793379;BP561521;AY050418 unknown
6 1 8 12 RAFL08-08-P14 AY050412 Experimental RAFL08-08-P14 AV793508;AV826078;AY050412 putative protein
6 1 8 13 RAFL08-08-K14 AY050405 Experimental RAFL08-08-K14 AV793448;AV826065;AY050405 GTP cyclohydrolase II / 3,4-dihydroxy-2-butanone-4-phoshate synthase - like protein
6 1 8 14 RAFL08-08-E14 AY045640 Experimental RAFL08-08-E14 AV793378;AV826041;AY045640 putative hydroxyproline-rich glycoprotein
6 1 9 1 RAFL08-13-B17 AY056268 Experimental RAFL08-13-B17 AV794491;AV826346;AY056268 hypothetical protein; similar to ESTs dbj|AV442006.1, dbj|AV439549.1, gb|AI996097.1
6 1 9 2 RAFL08-13-H16 BT000686 Experimental RAFL08-13-H16 AV794579;AV826360;BT000686 ferredoxin--nitrite reductase
6 1 9 3 RAFL08-13-O15 BP561588 Experimental RAFL08-13-O15 AV794681;BP561588;AY056139 putative galactinol synthase
6 1 9 4 RAFL08-13-D15 AY050906 Experimental RAFL08-13-D15 AV794518;AV826354;AY050906 unknown protein
6 1 9 5 RAFL08-13-O09 AY056160 Experimental RAFL08-13-O09 AV794676;AV826389;AY056160 unknown protein
6 1 9 6 RAFL08-13-K09 AY080806 Experimental RAFL08-13-K09 AV794617;AV826375;AY080806
6 1 9 7 RAFL08-13-L08 AY059770 Experimental RAFL08-13-L08 AV794634;AV826378;AY059770 unknown protein
6 1 9 8 RAFL08-13-N07 AY050930 Experimental RAFL08-13-N07 AV794664;AV826386;AY050930 extensin - like protein
6 1 9 9 RAFL08-13-J07 AY056254 Experimental RAFL08-13-J07 AV794601;AV826369;AY056254
6 1 9 10 RAFL08-13-A07 AY050806 Experimental RAFL08-13-A07 AV794469;AV826344;AY050806 putative phosphomannomutase
6 1 9 11 RAFL08-09-F10 AY045669 Experimental RAFL08-09-F10 AV793585;AV826101;AY045669
6 1 9 12 RAFL08-09-A10 AY050421 Experimental RAFL08-09-A10 AV793520;AV826084;AY050421 transcription initiation factor IIB (TFIIB)
6 1 9 13 RAFL08-09-H09 AY045654 Experimental RAFL08-09-H09 AV793618;AV826111;AY045654 unknown protein
6 1 9 14 RAFL08-09-A09 AY052353 Experimental RAFL08-09-A09 AV793519;AV826083;AY052353 unknown protein
6 1 10 1 RAFL08-14-B18 AY050959 Experimental RAFL08-14-B18 AV794709;AV826395;AY050959 unknown protein
6 1 10 2 RAFL08-14-M16 AY050977 Experimental RAFL08-14-M16 AV794838;AV826422;AY050977 unknown protein
6 1 10 3 RAFL08-14-N15 BP561597 Experimental RAFL08-14-N15 AV794849;BP561597;AY142551 hypothetical protein
6 1 10 4 RAFL08-14-H14 AY050839 Experimental RAFL08-14-H14 AV794783;AY050839 putative protein
6 1 10 5 RAFL08-14-C13 AY056231 Experimental RAFL08-14-C13 AV794719;AV826398;AY056231 unknown protein
6 1 10 6 RAFL08-14-F11 AY056248 Experimental RAFL08-14-F11 AV794758;AV826405;AY056248 putative protein
6 1 10 7 RAFL08-14-H03 BT000771 Experimental RAFL08-14-H03 AV794778;AV826410;BT000771 long-chain acyl-CoA like synthetase
6 1 10 8 RAFL08-14-D03 BP561591 Experimental RAFL08-14-D03 AV794726;BP561591;AY059789
6 1 10 9 RAFL08-14-A03 BP561590 Experimental RAFL08-14-A03 AV794695;BP561590;AY050941 unknown protein
6 1 10 10 RAFL08-14-G02 AY064018 Experimental RAFL08-14-G02 AV794766;AV826406;AY064018 putative cystathionine beta-lyase (CBL) precursor protein
6 1 10 11 RAFL08-14-M01 AY056229 Experimental RAFL08-14-M01 AV794830;AV826420;AY056229 unknown protein (At1g03280)
6 1 10 12 RAFL08-14-C01 AY050908 Experimental RAFL08-14-C01 AV794712;AV826397;AY050908 unknown protein
6 1 10 13 RAFL08-13-M18 AY056178 Experimental RAFL08-13-M18 AV794656;AV826384;AY056178 putative AP2/EREBP transcription factor protein
6 1 10 14 RAFL08-13-I18 BP561581 Experimental RAFL08-13-I18 AV794593;BP561581;AY080642
6 1 11 1 RAFL09-06-B11 AY062700 Experimental RAFL09-06-B11 AV795992;AV826656;AY062700 fatty acid elongase 3-ketoacyl-CoA synthase, putative
6 1 11 2 RAFL09-06-J10 AY062699 Experimental RAFL09-06-J10 AV796104;AV826711;AY062699 putative AT-hook DNA-binding protein
6 1 11 3 RAFL09-06-H08 AY062565 Experimental RAFL09-06-H08 AV796077;AV826699;AY062565 unknown protein
6 1 11 4 RAFL09-06-F07 AV826684 Experimental RAFL09-06-F07 AV796045;AV826684 hypothetical protein
6 1 11 5 RAFL09-06-N06 AY059884 Experimental RAFL09-06-N06 AV796165;AV826741;AY059884 subtilisin proteinase like protein
6 1 11 6 RAFL09-06-J06 BP561647 Experimental RAFL09-06-J06 AV796101;BP561647;AY062562 unknown protein
6 1 11 7 RAFL09-06-H06 AY092988 Experimental RAFL09-06-H06 AV796076;AV826698;AY092988 root hair defective 3
6 1 11 8 RAFL09-06-P05 AY062692 Experimental RAFL09-06-P05 AV796195;AV826755;AY062692 putative chloroplast prephenate dehydratase
6 1 11 9 RAFL09-06-G02 AY062558 Experimental RAFL09-06-G02 AV796056;AV826688;AY062558 putative protein
6 1 11 10 RAFL09-06-E02 AY059880 Experimental RAFL09-06-E02 AV796025;AV826675;AY059880 calnexin - like protein
6 1 11 11 RAFL09-06-B02 AY062556 Experimental RAFL09-06-B02 AV795985;AV826651;AY062556 26S proteasome regulatory subunit
6 1 11 12 RAFL09-06-L01 AY062685 Experimental RAFL09-06-L01 AV796132;AV826723;AY062685 Unknown protein (F24O1.10)
6 1 11 13 RAFL09-06-H01 AY120769 Experimental RAFL09-06-H01 AV796072;AV826696;AY120769 hypothetical protein
6 1 11 14 RAFL08-19-E24 AY059876 Experimental RAFL08-19-E24 AV795821;AV826620;AY059876 Unknown protein (At1g34780; F21H2.1)
6 1 12 1 RAFL09-09-J10 AY070134 Experimental RAFL09-09-J10 AV796783;AV826924;AY070134
6 1 12 2 RAFL09-09-G10 AY058854 Experimental RAFL09-09-G10 AV796728;AV826896;AY058854 glycine decarboxylase complex H-protein
6 1 12 3 RAFL09-09-M09 AY058848 Experimental RAFL09-09-M09 AV796839;AV826945;AY058848 mitochondrial phosphate translocator
6 1 12 4 RAFL09-09-G09 AY057493 Experimental RAFL09-09-G09 AV796727;AV826895;AY057493 unknown protein
6 1 12 5 RAFL09-06-G16 AY062712 Experimental RAFL09-06-G16 AV796066;AV826693;AY062712 photosystem I subunit III precursor, putative
6 1 12 6 RAFL09-06-P15 AY062711 Experimental RAFL09-06-P15 AV796201;AV826757;AY062711 putative protein
6 1 12 7 RAFL09-06-L15 AY062710 Experimental RAFL09-06-L15 AV796140;AV826727;AY062710 unknown protein
6 1 12 8 RAFL09-06-E15 BP561642 Experimental RAFL09-06-E15 AV796035;BP561642;AY062577 unknown protein
6 1 12 9 RAFL09-06-A15 AY062708 Experimental RAFL09-06-A15 AV795979;AV826647;AY062708 Strong similarity to glycoprotein EP1
6 1 12 10 RAFL09-06-O14 BT002384 Experimental RAFL09-06-O14 AV796186;AV826751;BT002384 unknown protein
6 1 12 11 RAFL09-06-G12 BP561646 Experimental RAFL09-06-G12 AV796063;BP561646;AY092979 transporter-like protein
6 1 12 12 RAFL09-06-A12 AY062570 Experimental RAFL09-06-A12 AV795976;AV826646;AY062570 putative RNA-binding protein
6 1 12 13 RAFL09-06-N11 AY059886 Experimental RAFL09-06-N11 AV796169;AV826743;AY059886 60S ribosomal protein - like
6 1 12 14 RAFL09-06-L11 BT002395 Experimental RAFL09-06-L11 AV796138;AV826726;BT002395 unknown protein
6 1 13 1 RAFL09-09-E20 AY058887 Experimental RAFL09-09-E20 AV796699;AV826887;AY058887 MYB -like protein
6 1 13 2 RAFL09-09-J19 AY058882 Experimental RAFL09-09-J19 AV796789;AV826926;AY058882 unknown protein
6 1 13 3 RAFL09-09-G19 AV826899 Experimental RAFL09-09-G19 AV796735;AV826899 putative protein kinase
6 1 13 4 RAFL09-09-B19 AY057498 Experimental RAFL09-09-B19 AV796646;AV826869;AY057498 unknown protein
6 1 13 5 RAFL09-09-N18 AY058842 Experimental RAFL09-09-N18 AV796862;AV826956;AY058842 protein kinase like protein
6 1 13 6 RAFL09-09-K18 AY057494 Experimental RAFL09-09-K18 AV796809;AV826933;AY057494 nuclear RNA binding protein A-like protein
6 1 13 7 RAFL09-09-M16 AY057507 Experimental RAFL09-09-M16 AV796845;AV826948;AY057507 putative phosphoenolpyrovate carboxylase gb|AAC24594.1; similar to ESTs gb|R30301.1, gb|AI992716.1, emb|Z29154.1, gb|W43080.1, emb|Z30862.1
6 1 13 8 RAFL09-09-J16 AV826925 Experimental RAFL09-09-J16 AV796786;AV826925 putative villin 2 protein
6 1 13 9 RAFL09-09-H16 AY058864 Experimental RAFL09-09-H16 AV796750;AV826903;AY058864 predicted GPI-anchored protein
6 1 13 10 RAFL09-09-O15 AY057500 Experimental RAFL09-09-O15 AV796878;AV826962;AY057500 polyubiquitin (ubq10)
6 1 13 11 RAFL09-09-E15 AY058846 Experimental RAFL09-09-E15 AV796696;AV826885;AY058846 unknown protein
6 1 13 12 RAFL09-09-B15 AY058836 Experimental RAFL09-09-B15 AV796643;AV826867;AY058836 unknown protein (At1g62200)
6 1 13 13 RAFL09-09-L11 AY058892 Experimental RAFL09-09-L11 AV796821;AV826937;AY058892 pectin methylesterase like protein
6 1 13 14 RAFL09-09-C11 AY058874 Experimental RAFL09-09-C11 AV796658;AV826875;AY058874 putative protein
6 1 14 1 RAFL09-13-A04 AV827254 Experimental RAFL09-13-A04 AV797667;AV827254;AF367260 putative sugar transport protein
6 1 14 2 RAFL09-13-G03 BP561706 Experimental RAFL09-13-G03 AV797737;BP561706;AF361806 ubiquitin-conjugating like enzyme
6 1 14 3 RAFL09-12-E24 AV827191 Experimental RAFL09-12-E24 AV797488;AV827191;AF361837 temperature-sensitive omega-3 fatty acid desaturase, chloroplast precursor (sp|P48622)
6 1 14 4 RAFL09-12-J22 AV827218 Experimental RAFL09-12-J22 AV797559;AV827218;AF367284 putative importin beta binding domain
6 1 14 5 RAFL09-12-G22 AV827207 Experimental RAFL09-12-G22 AV797517;AV827207;AF361816
6 1 14 6 RAFL09-12-O21 BP561700 Experimental RAFL09-12-O21 AV797649;BP561700;AF367283 membrane channel like protein
6 1 14 7 RAFL09-12-A21 AV827164 Experimental RAFL09-12-A21 AV797418;AV827164;AF367269 berberine bridge enzyme - like protein
6 1 14 8 RAFL09-12-N20 AV797630 Experimental RAFL09-12-N20 AV797630;AF361802 glutaredoxin-like protein
6 1 14 9 RAFL09-09-F24 AY127019 Experimental RAFL09-09-F24 AV796719;AV826892;AY127019 unknown protein
6 1 14 10 RAFL09-09-N23 AY058880 Experimental RAFL09-09-N23 AV796867;AV826957;AY058880 presenilin like protein
6 1 14 11 RAFL09-09-G23 AY058873 Experimental RAFL09-09-G23 AV796739;AV826900;AY058873 unknown protein
6 1 14 12 RAFL09-09-K22 AY058853 Experimental RAFL09-09-K22 AV796812;AV826935;AY058853 putative protein
6 1 14 13 RAFL09-09-H22 AY058850 Experimental RAFL09-09-H22 AV796756;AV826906;AY058850 unknown protein
6 1 14 14 RAFL09-09-C22 AY058833 Experimental RAFL09-09-C22 AV796665;AY058833 putative nucleic acid binding protein
6 2 1 1 RAFL06-10-G23 AY072338 Experimental RAFL06-10-G23 AV785014;AV823927;AY072338 peptide transporter - like protein
6 2 1 2 RAFL06-10-D10 AY065116 Experimental RAFL06-10-D10 AV784989;AV823907;AY065116 putative protein
6 2 1 3 RAFL06-10-C10 AY072337 Experimental RAFL06-10-C10 AV784980;AV823900;AY072337 translationally controlled tumor protein-like protein
6 2 1 4 RAFL06-10-B01 AV823892 Experimental RAFL06-10-B01 AV784971;AV823892 hypothetical protein
6 2 1 5 RAFL06-10-A01 AY062780 Experimental RAFL06-10-A01 AV784963;AV823886;AY062780 putative MADS-box protein
6 2 1 6 RAFL06-11-G13 AY062779 Experimental RAFL06-11-G13 AV785081;AV823980;AY062779 putative protein; similar to unknown protein (gb|AAF26969.1)
6 2 1 7 RAFL06-11-C05 AY062778 Experimental RAFL06-11-C05 AV785059;AV823960;AY062778 unknown protein
6 2 1 8 RAFL06-10-F11 AY062777 Experimental RAFL06-10-F11 AV785007;AV823922;AY062777 unknown protein
6 2 1 9 RAFL06-11-P24 AY072333 Experimental RAFL06-11-P24 AV785126;AV824013;AY072333 succinyl-CoA-ligase alpha subunit
6 2 1 10 RAFL06-11-N20 AY062776 Experimental RAFL06-11-N20 AV785118;AV824005;AY062776 immunophilin (FKBP15-1)
6 2 1 11 RAFL06-11-K09 AY128400 Experimental RAFL06-11-K09 AV785098;AV823992;AY128400 RIBOSOMAL PROTEIN S28- like
6 2 1 12 RAFL06-11-E15 AY065112 Experimental RAFL06-11-E15 AV785068;AV823969;AY065112 putative RNA-binding protein
6 2 1 13 RAFL06-11-E12 AV823968 Experimental RAFL06-11-E12 AV785067;AV823968 unknown protein
6 2 1 14 RAFL06-10-N03 AY062770 Experimental RAFL06-10-N03 AV785037;AV823943;AY062770 ClpP protease complex subunit ClpR2
6 2 2 1 RAFL06-12-M01 AY070761 Experimental RAFL06-12-M01 AV785180;AV824045;AY070761 DNA binding like protein
6 2 2 2 RAFL06-12-J05 AY058110 Experimental RAFL06-12-J05 AV785171;AV824039;AY058110 unknown protein
6 2 2 3 RAFL06-12-A17 AY075595 Experimental RAFL06-12-A17 AV785130;AY075595 unknown protein
6 2 2 4 RAFL06-12-F13 AY058142 Experimental RAFL06-12-F13 AV785153;AV824029;AY058142 unknown protein
6 2 2 5 RAFL06-12-I16 AY090345 Experimental RAFL06-12-I16 AV785168;AV824036;AY090345 tubulin beta-7 chain
6 2 2 6 RAFL06-12-D24 AY070765 Experimental RAFL06-12-D24 AV785146;AV824024;AY070765 putative sterol desaturase
6 2 2 7 RAFL06-12-I15 AY070760 Experimental RAFL06-12-I15 AV785167;AY070760 histone H2B
6 2 2 8 RAFL06-12-D17 AY058114 Experimental RAFL06-12-D17 AV785145;AV824023;AY058114 unknown protein
6 2 2 9 RAFL06-10-H05 AV823928 Experimental RAFL06-10-H05 AV785016;AV823928 putative protein
6 2 2 10 RAFL06-10-E21 AY065119 Experimental RAFL06-10-E21 AV785001;AV823916;AY065119 vacuolar-type H+-ATPase subunit E1 (VHA-E1)
6 2 2 11 RAFL06-11-O17 AY128406 Experimental RAFL06-11-O17 AV785120;AV824008;AY128406 unknown protein
6 2 2 12 RAFL06-11-M20 AV824002 Experimental RAFL06-11-M20 AV785113;AV824002 putative protein
6 2 2 13 RAFL06-11-J07 AY065118 Experimental RAFL06-11-J07 AV785092;AV823988;AY065118 unknown protein
6 2 2 14 RAFL06-11-F14 AY128405 Experimental RAFL06-11-F14 AV785071;AY128405
6 2 3 1 RAFL06-15-D03 AV785337 Experimental RAFL06-15-D03 AV785337 sulfite oxidase (SOX)
6 2 3 2 RAFL06-16-K07 AV824255 Experimental RAFL06-16-K07 AV785470;AV824255;AF462796 unknown protein (At1g73720)
6 2 3 3 RAFL06-16-I17 AY070763 Experimental RAFL06-16-I17 AV785459;AY070763 unknown protein
6 2 3 4 RAFL06-16-H16 AY058116 Experimental RAFL06-16-H16 AV785447;AV824241;AY058116 unknown protein
6 2 3 5 RAFL06-13-E06 AY070773 Experimental RAFL06-13-E06 AV785218;AV824074;AY070773 putative protein kinase
6 2 3 6 RAFL06-13-B08 AY058137 Experimental RAFL06-13-B08 AV785211;AV824070;AY058137 ubiquitin-conjugating enzyme-like protein
6 2 3 7 RAFL06-15-F04 AV824171 Experimental RAFL06-15-F04 AV785346;AV824171 unknown protein
6 2 3 8 RAFL06-12-J07 AY058129 Experimental RAFL06-12-J07 AV785172;AV824040;AY058129 60S ribosomal protein - like
6 2 3 9 RAFL06-14-M02 AY058120 Experimental RAFL06-14-M02 AV785322;AV824156;AY058120 unknown protein
6 2 3 10 RAFL06-14-F04 AY058112 Experimental RAFL06-14-F04 AV785310;AV824146;AY058112 ferredoxin
6 2 3 11 RAFL06-15-N10 AY075596 Experimental RAFL06-15-N10 AV785386;AV824195;AY075596 transcriptional co-activator - like protein
6 2 3 12 RAFL06-15-J04 AY058138 Experimental RAFL06-15-J04 AV785365;AV824181;AY058138 putative GTP-binding protein
6 2 3 13 RAFL06-12-P23 AY058134 Experimental RAFL06-12-P23 AV824061;AY058134 unknown protein
6 2 3 14 RAFL06-12-N20 AY058125 Experimental RAFL06-12-N20 AV785189;AV824051;AY058125 hydrolase like protein
6 2 4 1 RAFL07-07-G18 BP561403 Experimental RAFL07-07-G18 AV790808;BP561403 unknown protein
6 2 4 2 RAFL07-07-P17 AY050892 Experimental RAFL07-07-P17 AV790902;AV825300;AY050892 unknown protein
6 2 4 3 RAFL07-07-F17 AY050864 Experimental RAFL07-07-F17 AV790799;AV825264;AY050864 unknown protein
6 2 4 4 RAFL07-07-O16 AY045896 Experimental RAFL07-07-O16 AV790894;AV825295;AY045896 nodulin-like protein
6 2 4 5 RAFL07-07-F16 AY064002 Experimental RAFL07-07-F16 AV790798;AY064002 unknown protein
6 2 4 6 RAFL07-07-J15 AY059745 Experimental RAFL07-07-J15 AV790836;AV825275;AY059745 unknown protein
6 2 4 7 RAFL07-07-L10 AY056142 Experimental RAFL07-07-L10 AV790861;AY056142 unknown protein
6 2 4 8 RAFL07-07-M09 AY050890 Experimental RAFL07-07-M09 AV790869;AV825287;AY050890
6 2 4 9 RAFL07-07-O08 AY046037 Experimental RAFL07-07-O08 AV790889;AV825294;AY046037 ribosomal protein S11 - like
6 2 4 10 RAFL07-07-F08 BP561402 Experimental RAFL07-07-F08 AV790791;BP561402;AY045895 formamidase like protein
6 2 4 11 RAFL07-07-K07 AY080835 Experimental RAFL07-07-K07 AV790847;AY080835 putative protein
6 2 4 12 RAFL07-07-E07 AY056198 Experimental RAFL07-07-E07 AV790776;AV825260;AY056198 pectin acetylesterase
6 2 4 13 RAFL06-15-J10 AV824183 Experimental RAFL06-15-J10 AV785367;AV824183 kanadaptin - like protein
6 2 4 14 RAFL06-13-A07 AY058145 Experimental RAFL06-13-A07 AV785201;AV824063;AY058145 unknown protein
6 2 5 1 RAFL07-11-J11 AY062436 Experimental RAFL07-11-J11 AV791680;AV825595;AY062436 WD40-repeat protein
6 2 5 2 RAFL07-11-O07 AY062641 Experimental RAFL07-11-O07 AV791753;AV825623;AY062641 unknown protein
6 2 5 3 RAFL07-08-P08 AY050956 Experimental RAFL07-08-P08 AV791125;AV825377;AY050956 hypothetical protein
6 2 5 4 RAFL07-08-N08 AY050894 Experimental RAFL07-08-N08 AV791097;AV825367;AY050894 unknown protein
6 2 5 5 RAFL07-08-E08 AY046039 Experimental RAFL07-08-E08 AV790970;AV825319;AY046039 50S ribosomal protein L27
6 2 5 6 RAFL07-08-A08 AY045900 Experimental RAFL07-08-A08 AV790907;AV825303;AY045900 unknown protein (At1g06780)
6 2 5 7 RAFL07-08-I07 AY056217 Experimental RAFL07-08-I07 AV791032;AV825342;AY056217 cell division cycle protein 23 homolog
6 2 5 8 RAFL07-08-F07 AY059748 Experimental RAFL07-08-F07 AV790986;AY059748 AtB'gamma - like protein
6 2 5 9 RAFL07-08-I04 AY050955 Experimental RAFL07-08-I04 AV791030;AV825341;AY050955 putative growth regulator protein (At1g35510)
6 2 5 10 RAFL07-08-J03 AY046044 Experimental RAFL07-08-J03 AV791045;AV825348;AY046044 calcium binding protein (CaBP-22)
6 2 5 11 RAFL07-08-A03 AY074375 Experimental RAFL07-08-A03 AV790904;AV825302;AY074375 subtilisin proteinase - like
6 2 5 12 RAFL07-08-L02 AY045898 Experimental RAFL07-08-L02 AV791072;AV825356;AY045898 argininosuccinate lyase (AtArgH)
6 2 5 13 RAFL07-08-H02 AY080836 Experimental RAFL07-08-H02 AV791012;AV825336;AY080836 putative protein
6 2 5 14 RAFL07-08-F02 AY059747 Experimental RAFL07-08-F02 AV790983;AV825328;AY059747 ankyrin like protein
6 2 6 1 RAFL07-12-K05 BT002050 Experimental RAFL07-12-K05 AV791928;AV825674;BT002050 transcription factor monopteros (MP)
6 2 6 2 RAFL07-12-D05 AV825643 Experimental RAFL07-12-D05 AV791828;AV825643 Unknown protein (F24O1.10)
6 2 6 3 RAFL07-12-G04 AY062441 Experimental RAFL07-12-G04 AV791871;AV825659;AY062441 3-isopropylmalate dehydrogenase like protein
6 2 6 4 RAFL07-12-C04 BT002411 Experimental RAFL07-12-C04 AV791814;AV825638;BT002411 pullulanase-like protein (starch debranching enzyme)
6 2 6 5 RAFL07-11-J24 AY081297 Experimental RAFL07-11-J24 AV791687;AV825600;AY081297 putative ribophorin I (dolichyl-diphosphooligosaccharide-protein glycosyltransferase)
6 2 6 6 RAFL07-11-J23 AY054517 Experimental RAFL07-11-J23 AV791686;AV825599;AY054517 Highly Similar to branched-chain amino acid aminotransferase
6 2 6 7 RAFL07-11-M22 AY054466 Experimental RAFL07-11-M22 AV791730;AV825615;AY054466 carbonic anhydrase (CAH1)
6 2 6 8 RAFL07-11-M21 AY054465 Experimental RAFL07-11-M21 AV791729;AV825614;AY054465 low-temperature-induced protein 78 (sp|Q06738)
6 2 6 9 RAFL07-11-P20 AY054516 Experimental RAFL07-11-P20 AV791780;AV825631;AY054516 PRLI-interacting factor F
6 2 6 10 RAFL07-11-J20 AY054515 Experimental RAFL07-11-J20 AV791684;AV825598;AY054515 putative protein
6 2 6 11 RAFL07-11-O12 AY054461 Experimental RAFL07-11-O12 AV791758;AV825624;AY054461 elongation factor, putative
6 2 6 12 RAFL07-11-M12 BT002059 Experimental RAFL07-11-M12 AV791724;BP561455;BT002059 RNA 3'-terminal phosphate cyclase-like protein
6 2 6 13 RAFL07-11-K12 AY054460 Experimental RAFL07-11-K12 AV791696;AV825602;AY054460 cytokinin oxidase - like protein
6 2 6 14 RAFL07-11-N11 AV825619 Experimental RAFL07-11-N11 AV791740;AV825619 monosaccharide transport protein, STP4
6 2 7 1 RAFL07-16-M15 AY045622 Experimental RAFL07-16-M15 AV792817;AV825887;AY045622 unknown protein
6 2 7 2 RAFL07-16-P12 AY050460 Experimental RAFL07-16-P12 AV792852;AV825901;AY050460 actin depolymerizing factor 4 - like protein
6 2 7 3 RAFL07-16-J11 BP561497 Experimental RAFL07-16-J11 AV792785;BP561497;AY050459 BEL1-like homeobox 2 protein (BLH2)
6 2 7 4 RAFL07-16-N10 AY050430 Experimental RAFL07-16-N10 AV792829;AV825893;AY050430 putative protein
6 2 7 5 RAFL07-16-H10 BP561495 Experimental RAFL07-16-H10 AV792751;BP561495;AY075642 putative protein kinase, ADK1
6 2 7 6 RAFL07-16-P07 AY102105 Experimental RAFL07-16-P07 AV792848;AV825899;AY102105 hypothetical protein
6 2 7 7 RAFL07-12-P11 AV792007 Experimental RAFL07-12-P11 AV792007 HD-Zip protein
6 2 7 8 RAFL07-12-K11 BT002406 Experimental RAFL07-12-K11 AV791932;BT002406
6 2 7 9 RAFL07-12-G11 AV791875 Experimental RAFL07-12-G11 AV791875 ubiquinol-cytochrome C reductase complex ubiquinone-binding protein (QP-C)-like protein (gb|AAF19563.1)
6 2 7 10 RAFL07-12-E11 BT002409 Experimental RAFL07-12-E11 AV791848;BP561461;BT002409 reversibly glycosylated polypeptide-1
6 2 7 11 RAFL07-12-I10 AV791903 Experimental RAFL07-12-I10 AV791903 putative protein
6 2 7 12 RAFL07-12-O09 BT002040 Experimental RAFL07-12-O09 AV791991;BT002040 cell cycle control crn (crooked neck) protein-like
6 2 7 13 RAFL07-12-D07 BT002045 Experimental RAFL07-12-D07 AV791830;AV825645;BT002045
6 2 7 14 RAFL07-12-A07 AY059836 Experimental RAFL07-12-A07 AV791788;AY059836 H+-transporting ATPase 16K chain P2, vacuolar
6 2 8 1 RAFL07-17-D16 AY065020 Experimental RAFL07-17-D16 AV792902;AY065020 oligopeptide like transporter
6 2 8 2 RAFL07-17-O15 AY050426 Experimental RAFL07-17-O15 AV793059;AY050426 putative ubiquitin activating enzyme E1 (ECR1)
6 2 8 3 RAFL07-17-D11 AY139766 Experimental RAFL07-17-D11 AV792899;AV825914;AY139766 cytochrome P450, putative
6 2 8 4 RAFL07-17-N10 AY050431 Experimental RAFL07-17-N10 AV793041;AV825950;AY050431 aconitase like protein
6 2 8 5 RAFL07-17-A10 AY045618 Experimental RAFL07-17-A10 AV792865;AY045618 C3HC4 zinc finger like protein
6 2 8 6 RAFL07-17-H08 AY045609 Experimental RAFL07-17-H08 AV792951;AV825925;AY045609 vacuolar-type H+-ATPase subunit B2 (VHA-B2)
6 2 8 7 RAFL07-17-N07 AV825949 Experimental RAFL07-17-N07 AV793039;AV825949 unknown protein
6 2 8 8 RAFL07-17-E06 AV825918 Experimental RAFL07-17-E06 AV792912;AV825918 serine/threonine kinase - like protein
6 2 8 9 RAFL07-17-F02 AY045624 Experimental RAFL07-17-F02 AV792923;AV825919;AY045624 SOF1 protein like protein
6 2 8 10 RAFL07-17-A02 AY075644 Experimental RAFL07-17-A02 AV792860;AV825905;AY075644 DNA-directed RNA polymerase subunit, putative
6 2 8 11 RAFL07-16-N24 AY045615 Experimental RAFL07-16-N24 AV792836;AV825895;AY045615 unknown protein
6 2 8 12 RAFL07-16-H23 BP561496 Experimental RAFL07-16-H23 AV792760;BP561496;AY045610 putative ribosomal protein
6 2 8 13 RAFL07-16-N22 AY045603 Experimental RAFL07-16-N22 AV792835;AV825894;AY045603
6 2 8 14 RAFL07-16-O21 AY045600 Experimental RAFL07-16-O21 AV792844;AV825897;AY045600
6 2 9 1 RAFL08-11-I08 AY050848 Experimental RAFL08-11-I08 AV794104;AV826234;AY050848 CCR4-associated factor 1-like protein
6 2 9 2 RAFL08-11-P07 AY050834 Experimental RAFL08-11-P07 AV794221;AV826265;AY050834 unknown protein
6 2 9 3 RAFL08-11-C07 AY050924 Experimental RAFL08-11-C07 AV793999;AV826206;AY050924 33 kDa secretory protein-like
6 2 9 4 RAFL08-11-E06 AY056247 Experimental RAFL08-11-E06 AV794034;AV826213;AY056247 unknown protein
6 2 9 5 RAFL08-11-J02 AY056159 Experimental RAFL08-11-J02 AV794116;AY056159 unknown protein
6 2 9 6 RAFL08-11-B02 AY056167 Experimental RAFL08-11-B02 AV793979;AV826204;AY056167 unknown protein
6 2 9 7 RAFL08-11-M01 BT000694 Experimental RAFL08-11-M01 AV794170;AV826252;BT000694 putative protein kinase
6 2 9 8 RAFL08-11-E01 BT000698 Experimental RAFL08-11-E01 AV794029;AV826212;BT000698 putative 1-aminocyclopropane-1-carboxylate oxidase
6 2 9 9 RAFL08-10-N24 AY056138 Experimental RAFL08-10-N24 AV793936;AV826191;AY056138 unknown protein
6 2 9 10 RAFL08-10-N22 AY056245 Experimental RAFL08-10-N22 AV793935;AV826190;AY056245 putative protein kinase
6 2 9 11 RAFL07-17-N18 AY050383 Experimental RAFL07-17-N18 AV793046;AV825952;AY050383 polygalacturonase -like protein
6 2 9 12 RAFL07-17-J18 AY075645 Experimental RAFL07-17-J18 AV792984;AV825936;AY075645 putative protein
6 2 9 13 RAFL07-17-D18 AY139763 Experimental RAFL07-17-D18 AV792904;AV825915;AY139763 regulatory protein NPR1-like; transcription factor inhibitor I kappa B-like
6 2 9 14 RAFL07-17-P17 AY045608 Experimental RAFL07-17-P17 AV793071;AV825956;AY045608 ferredoxin--nitrite reductase
6 2 10 1 RAFL08-11-L21 AY056180 Experimental RAFL08-11-L21 AV794167;AV826251;AY056180 unknown protein
6 2 10 2 RAFL08-11-J20 AY059790 Experimental RAFL08-11-J20 AV794129;AV826239;AY059790 LIM domain protein, putative
6 2 10 3 RAFL08-11-G20 AY056270 Experimental RAFL08-11-G20 AV794077;AV826223;AY056270 cytochrome P450 like protein
6 2 10 4 RAFL08-11-A20 AY050838 Experimental RAFL08-11-A20 AV793976;AV826203;AY050838 putative delta 9 desaturase
6 2 10 5 RAFL08-11-K19 AY056230 Experimental RAFL08-11-K19 AV794146;AV826243;AY056230 unknown protein
6 2 10 6 RAFL08-11-G19 AY050910 Experimental RAFL08-11-G19 AV794076;AV826222;AY050910 unknown protein
6 2 10 7 RAFL08-11-P15 AY056179 Experimental RAFL08-11-P15 AV794227;AV826268;AY056179 putative phosphate/phosphoenolpyruvate translocator protein
6 2 10 8 RAFL08-11-M15 AY059788 Experimental RAFL08-11-M15 AV794180;AV826256;AY059788 unknown protein (At1g69360)
6 2 10 9 RAFL08-11-J15 AV826238 Experimental RAFL08-11-J15 AV794124;AV826238
6 2 10 10 RAFL08-11-E15 BP561551 Experimental RAFL08-11-E15 AV794038;BP561551
6 2 10 11 RAFL08-11-M14 AY091145 Experimental RAFL08-11-M14 AV794179;AV826255;AY091145 unknown protein
6 2 10 12 RAFL08-11-A14 BP561548 Experimental RAFL08-11-A14 AV793971;BP561548;AY050808
6 2 10 13 RAFL08-11-H10 BP561555 Experimental RAFL08-11-H10 AV794087;BP561555;AY050914 unknown protein
6 2 10 14 RAFL08-11-G09 BP561554 Experimental RAFL08-11-G09 AV794069;BP561554
6 2 11 1 RAFL08-17-M09 AV826554 Experimental RAFL08-17-M09 AV795482;AV826554 unknown protein
6 2 11 2 RAFL08-17-O08 AY092973 Experimental RAFL08-17-O08 AV795506;AV826560;AY092973 putative translation initiation factor eIF-2, gamma subunit
6 2 11 3 RAFL08-17-F04 BP561622 Experimental RAFL08-17-F04 AV795372;BP561622 pre-mRNA splicing factor ATP-dependent RNA helicase -like protein
6 2 11 4 RAFL08-17-C04 AY062672 Experimental RAFL08-17-C04 AV795335;AV826524;AY062672 cytochrome P450 monooxygenase (CYP71B3)
6 2 11 5 RAFL08-17-G01 AY062671 Experimental RAFL08-17-G01 AV795387;AV826534;AY062671 putative ribosomal protein s19 or s24
6 2 11 6 RAFL08-16-M23 AY062669 Experimental RAFL08-16-M23 AV795275;AV826512;AY062669 unknown protein
6 2 11 7 RAFL08-16-K22 AY062536 Experimental RAFL08-16-K22 AV795248;AY062536 Mei2-like protein
6 2 11 8 RAFL08-16-H21 AY062666 Experimental RAFL08-16-H21 AV795205;AV826497;AY062666 Unknown protein (At5g24460; T31K7.4)
6 2 11 9 RAFL08-16-I15 BT002401 Experimental RAFL08-16-I15 AV795214;BT002401
6 2 11 10 RAFL08-16-P13 AY059867 Experimental RAFL08-16-P13 AV795307;AV826521;AY059867 unknown protein
6 2 11 11 RAFL08-16-O11 BP561618 Experimental RAFL08-16-O11 AV795296;BP561618;AY059865 unknown protein
6 2 11 12 RAFL08-16-P09 AY062659 Experimental RAFL08-16-P09 AV795304;AV826520;AY062659 unknown protein
6 2 11 13 RAFL08-16-K09 BP561616 Experimental RAFL08-16-K09 AV795241;BP561616;AY062529 MAP kinase -like protein
6 2 11 14 RAFL08-16-I08 AY059864 Experimental RAFL08-16-I08 AV795213;AV826499;AY059864 para-hydroxy bezoate polyprenyl diphosphate transferase (AtPPT1)
6 2 12 1 RAFL09-07-J07 AY128278 Experimental RAFL09-07-J07 AV796354;AV826825;AY128278
6 2 12 2 RAFL09-07-O06 AV826852 Experimental RAFL09-07-O06 AV796423;AV826852;AF419573 unknown protein
6 2 12 3 RAFL09-07-M05 AV796393 Experimental RAFL09-07-M05 AV796393;AF419567 putative progesterone-binding protein homolog Atmp2
6 2 12 4 RAFL09-07-G05 AV826808 Experimental RAFL09-07-G05 AV796306;AV826808;AF424620 beta-ketoacyl-CoA synthase
6 2 12 5 RAFL08-18-F01 AY062553 Experimental RAFL08-18-F01 AV795595;AV826581;AY062553 elongation factor 1-alpha
6 2 12 6 RAFL08-17-F24 BT002007 Experimental RAFL08-17-F24 AV795386;AV826533;BT002007 chloroplast thylakoidal processing peptidase, putative
6 2 12 7 RAFL08-17-O22 AY081318 Experimental RAFL08-17-O22 AV795514;AV826561;AY081318 unknown protein
6 2 12 8 RAFL08-17-G21 AY062561 Experimental RAFL08-17-G21 AV795396;AV826538;AY062561 Unknown protein (At5g64340; MSJ1.18)
6 2 12 9 RAFL08-17-L20 AY062682 Experimental RAFL08-17-L20 AV795473;AV826551;AY062682 unknown protein
6 2 12 10 RAFL08-17-H20 BP561623 Experimental RAFL08-17-H20 AV795411;BP561623;AY120759 serine palmitoyltransferase (AtLCB1)
6 2 12 11 RAFL08-17-K12 AY062545 Experimental RAFL08-17-K12 AV795451;AV826548;AY062545 homeodomain protein BELL1, putative
6 2 12 12 RAFL08-17-H12 BT000434 Experimental RAFL08-17-H12 AV795407;AV826539;BT000434 putative protein
6 2 12 13 RAFL08-17-C11 AY062542 Experimental RAFL08-17-C11 AV795339;AV826527;AY062542 high affinity potassium transporter AtHAK6 (At1g70300)
6 2 12 14 RAFL08-17-C10 AY062677 Experimental RAFL08-17-C10 AV795338;AV826526;AY062677 putative protein kinase
6 2 13 3 RAFL09-07-N23 AV826850 Experimental RAFL09-07-N23 AV796420;AV826850;AF419592 epoxide hydrolase (ATsEH)
6 2 13 4 RAFL09-07-K23 AV826831 Experimental RAFL09-07-K23 AV796375;AV826831;AF419576 gamma-glutamylcysteine synthetase
6 2 13 5 RAFL09-07-N22 AV826849 Experimental RAFL09-07-N22 AV796419;AV826849;AF419561 putative protein phosphatase 2C
6 2 13 6 RAFL09-07-K22 AV826830 Experimental RAFL09-07-K22 AV796374;AV826830;AF419556 PUR alpha-1
6 2 13 7 RAFL09-07-G17 AV826814 Experimental RAFL09-07-G17 AV796316;AV826814;AF419607 putative reticuline oxidase-like protein
6 2 13 8 RAFL09-07-I16 AV826823 Experimental RAFL09-07-I16 AV796346;AV826823;AF424630 unknown protein
6 2 13 9 RAFL09-07-G16 AV826813 Experimental RAFL09-07-G16 AV796315;AV826813;AF419584 unknown protein
6 2 13 10 RAFL09-07-M15 AV826842 Experimental RAFL09-07-M15 AV796400;AV826842;AF424624 nitrate reductase 1 (NR1)
6 2 13 11 RAFL09-07-O14 AV826854 Experimental RAFL09-07-O14 AV796430;AV826854;AF419563 unknown protein
6 2 13 12 RAFL09-07-M13 AV826841 Experimental RAFL09-07-M13 AV796399;AV826841;AF419549 xyloglucan endo-1,4-beta-D-glucanase-like protein
6 2 13 13 RAFL09-07-N08 AV826847 Experimental RAFL09-07-N08 AV796411;AV826847;AF419612 unknown protein
6 2 13 14 RAFL09-07-P07 AV826858 Experimental RAFL09-07-P07 AV796437;AV826858;AF419596 unknown protein
6 2 14 1 RAFL09-11-K06 AV827131 Experimental RAFL09-11-K06 AV797318;AV827131;AF361589 hydroxymethyltransferase
6 2 14 2 RAFL09-11-P05 AY094390 Experimental RAFL09-11-P05 AV797393;AV827156;AY094390 importin alpha
6 2 14 3 RAFL09-11-E02 AV827095 Experimental RAFL09-11-E02 AV797221;AV827095;AF361607 unknown protein
6 2 14 4 RAFL09-11-L01 AV827136 Experimental RAFL09-11-L01 AV797332;AV827136;AF367352 monosaccharide transport protein, STP4
6 2 14 5 RAFL09-11-F01 AV797238 Experimental RAFL09-11-F01 AV797238;AF361593 TOM7 - like protein
6 2 14 6 RAFL09-11-A01 AY065033 Experimental RAFL09-11-A01 AV797157;AV827075;AY065033 dnaJ-like protein
6 2 14 7 RAFL09-10-N22 AV827063 Experimental RAFL09-10-N22 AV797126;AV827063;AF361578 putative protein
6 2 14 8 RAFL09-10-N21 AY094388 Experimental RAFL09-10-N21 AV797125;AV827062;AY094388 putative protein
6 3 1 1 RAFL06-08-E09 AV823750 Experimental RAFL06-08-E09 AV784785;AV823750 tryptophan synthase alpha chain
6 3 1 2 RAFL06-09-K04 AV823859 Experimental RAFL06-09-K04 AV784930;AV823859 hypothetical protein
6 3 1 3 RAFL06-09-I08 AY062802 Experimental RAFL06-09-I08 AV784920;AV823852;AY062802
6 3 1 4 RAFL06-07-O16 BT002435 Experimental RAFL06-07-O16 AV784745;BT002435 putative protein
6 3 1 5 RAFL06-07-N11 AV823711 Experimental RAFL06-07-N11 AV784735;AV823711
6 3 1 6 RAFL06-09-C03 AY062800 Experimental RAFL06-09-C03 AV784876;AV823817;AY062800 rac-like GTP binding protein (ARAC5)
6 3 1 7 RAFL06-09-I05 AY081324 Experimental RAFL06-09-I05 AV784919;AV823851;AY081324 predicted GPI-anchored protein
6 3 1 8 RAFL06-09-G09 BT002430 Experimental RAFL06-09-G09 AV784909;AV823844;BT002430 unknown protein
6 3 1 9 RAFL06-07-L08 AV823703 Experimental RAFL06-07-L08 AV784723;AV823703 putative unknown protein, leucine-rich repeat
6 3 1 10 RAFL06-07-I05 AY065126 Experimental RAFL06-07-I05 AV784700;AV823685;AY065126 unknown protein
6 3 1 11 RAFL06-07-G09 AY092998 Experimental RAFL06-07-G09 AV784689;AV823677;AY092998 unknown protein
6 3 1 12 RAFL06-08-I18 AY065125 Experimental RAFL06-08-I18 AV784814;AV823769;AY065125 photosystem II type I chlorophyll a/b binding protein
6 3 1 13 RAFL06-07-G05 AY062786 Experimental RAFL06-07-G05 AV784688;AV823676;AY062786 putative protein
6 3 1 14 RAFL06-08-L13 AY065141 Experimental RAFL06-08-L13 AV784832;AV823781;AY065141
6 3 2 1 RAFL06-16-H05 AY070748 Experimental RAFL06-16-H05 AV785443;AV824237;AY070748 arabinogalactan-protein AGP24
6 3 2 2 RAFL06-16-C01 AV824219 Experimental RAFL06-16-C01 AV785417;AV824219 oleosin, 18.5K
6 3 2 3 RAFL06-15-C03 AY125512 Experimental RAFL06-15-C03 AV785332;AV824162;AY125512 heat shock transcription factor 21 (AtHSF21)
6 3 2 4 RAFL06-14-H20 AV824151 Experimental RAFL06-14-H20 AV785316;AV824151 unknown protein
6 3 2 5 RAFL06-16-H04 AV824236 Experimental RAFL06-16-H04 AV785442;AV824236 unknown protein
6 3 2 6 RAFL06-16-F14 AV824232 Experimental RAFL06-16-F14 AV824232 chlorophyll a/b-binding protein
6 3 2 7 RAFL06-16-D20 AY093768 Experimental RAFL06-16-D20 AV824226;AY093768 unknown
6 3 2 8 RAFL06-16-B22 AY093767 Experimental RAFL06-16-B22 AV785416;AV824218;AY093767 similar to cold acclimation protein WCOR413 [Triticum aestivum]
6 3 2 9 RAFL06-08-N13 AY065137 Experimental RAFL06-08-N13 AV784847;AV823794;AY065137 60S ribosomal protein L13, BBC1 protein
6 3 2 10 RAFL06-08-J02 BP561089 Experimental RAFL06-08-J02 AV784817;BP561089;AY059933 putative peroxidase ATP2a
6 3 2 11 RAFL06-08-F13 AY065136 Experimental RAFL06-08-F13 AV784795;AV823756;AY065136 synaptic glycoprotein SC2-like protein
6 3 2 12 RAFL06-09-L14 AY062811 Experimental RAFL06-09-L14 AV784939;AV823868;AY062811 cell division protein FtsH-like protein
6 3 2 13 RAFL06-09-I16 AY059932 Experimental RAFL06-09-I16 AV784921;AV823853;AY059932 glutamine synthetase
6 3 2 14 RAFL06-09-G16 AY062809 Experimental RAFL06-09-G16 AV784910;AV823845;AY062809 Unknown protein (At3g15780; MSJ11.18)
6 3 3 1 RAFL06-15-A18 AY072541 Experimental RAFL06-15-A18 AV785325;AV824158;AY072541 oxidase like protein
6 3 3 2 RAFL06-16-I04 AY127003 Experimental RAFL06-16-I04 AV785455;AV824245;AY127003 spermine synthase (ACL5)
6 3 3 3 RAFL06-16-H07 AY070745 Experimental RAFL06-16-H07 AV785445;AV824239;AY070745 unknown protein
6 3 3 4 RAFL06-16-F20 AV824233 Experimental RAFL06-16-F20 AV785436;AV824233 copine-like protein
6 3 3 5 RAFL06-15-G18 AY093775 Experimental RAFL06-15-G18 AV785354;AV824175;AY093775 unknown protein
6 3 3 6 RAFL06-12-N06 AY126996 Experimental RAFL06-12-N06 AV785187;AV824050;AY126996 diaminopimelate epimerase - like protein
6 3 3 7 RAFL06-12-L12 AY070752 Experimental RAFL06-12-L12 AV785177;AV824043;AY070752 putative cytochrome c oxidase Vc subunit
6 3 3 8 RAFL06-16-J22 AV785465 Experimental RAFL06-16-J22 AV785465 probable photosystem I chain XI precursor
6 3 3 9 RAFL06-16-I03 AY070732 Experimental RAFL06-16-I03 AV785454;AV824244;AY070732 putative protein
6 3 3 10 RAFL06-13-O04 BP561170 Experimental RAFL06-13-O04 AV785285;BP561170;AY125513 protein kinase - like protein
6 3 3 11 RAFL06-15-D20 AY126999 Experimental RAFL06-15-D20 AV785342;AV824167;AY126999 putative protein
6 3 3 12 RAFL06-12-L07 BP561150 Experimental RAFL06-12-L07 AV785176;BP561150 unknown protein
6 3 3 13 RAFL06-15-A09 BP561178 Experimental RAFL06-15-A09 AV785324;BP561178 ribosomal protein S2, putative
6 3 3 14 RAFL06-16-I01 AY093771 Experimental RAFL06-16-I01 AV785453;AV824243;AY093771 putative protein
6 3 4 1 RAFL07-09-I22 BT000664 Experimental RAFL07-09-I22 AV791235;AV825415;BT000664 unknown protein
6 3 4 2 RAFL07-09-C22 AY056296 Experimental RAFL07-09-C22 AV791167;AY056296 transaldolase - like protein
6 3 4 3 RAFL07-09-K20 AY080796 Experimental RAFL07-09-K20 AV791255;AV825426;AY080796 unknown protein
6 3 4 4 RAFL07-09-C20 AV825392 Experimental RAFL07-09-C20 AV791166;AV825392 unknown protein
6 3 4 5 RAFL07-09-N19 BT000810 Experimental RAFL07-09-N19 AV791292;AV825442;BT000810 putative heat-shock protein (At1g79920)
6 3 4 6 RAFL07-09-B19 AV791152 Experimental RAFL07-09-B19 AV791152 translation elongation factor eEF-1 alpha chain (gene A4)
6 3 4 7 RAFL07-09-B15 AY059783 Experimental RAFL07-09-B15 AV791151;AV825388;AY059783 unknown protein
6 3 4 8 RAFL07-09-H13 AY050889 Experimental RAFL07-09-H13 AV791223;AV825412;AY050889 unknown protein
6 3 4 9 RAFL07-09-F13 BT000656 Experimental RAFL07-09-F13 AV791197;AV825402;BT000656 geranylgeranyl reductase
6 3 4 10 RAFL07-09-D12 AY056226 Experimental RAFL07-09-D12 AV791174;AV825395;AY056226 disease resistance protein-like
6 3 4 11 RAFL07-09-O11 AY059757 Experimental RAFL07-09-O11 AV791300;AV825448;AY059757 putative S-linalool synthase (At1g61120)
6 3 4 12 RAFL07-09-F11 AY056197 Experimental RAFL07-09-F11 AV791196;AV825401;AY056197 predicted GPI-anchored protein (by homology)
6 3 4 13 RAFL06-15-E06 AV824168 Experimental RAFL06-15-E06 AV785343;AV824168 unknown protein
6 3 4 14 RAFL06-12-L15 AY127008 Experimental RAFL06-12-L15 AV785178;AV824044;AY127008
6 3 5 1 RAFL07-13-L21 AY120755 Experimental RAFL07-13-L21 AV792170;AV825735;AY120755
6 3 5 2 RAFL07-13-E21 AY081309 Experimental RAFL07-13-E21 AV792076;AV825713;AY081309 putative protein
6 3 5 3 RAFL07-10-K08 AY059785 Experimental RAFL07-10-K08 AV791467;AV825529;AY059785 kinase - like protein
6 3 5 4 RAFL07-10-G08 AY046046 Experimental RAFL07-10-G08 AV791408;AV825496;AY046046 unknown protein
6 3 5 5 RAFL07-10-C08 AY046038 Experimental RAFL07-10-C08 AV791343;AV825461;AY046038 unknown protein
6 3 5 6 RAFL07-10-M07 BT000782 Experimental RAFL07-10-M07 AV791497;AV825543;BT000782 tyrosine aminotransferase
6 3 5 7 RAFL07-10-I07 AY056209 Experimental RAFL07-10-I07 AV791438;AV825513;AY056209 cytochrome P450 like protein
6 3 5 8 RAFL07-10-D07 BT000722 Experimental RAFL07-10-D07 AV791356;AV825472;BT000722 elongation factor, putative
6 3 5 9 RAFL07-10-J04 AY056136 Experimental RAFL07-10-J04 AV791450;AV825519;AY056136 unknown protein
6 3 5 10 RAFL07-10-G04 AY046043 Experimental RAFL07-10-G04 AV791405;AV825494;AY046043 zinc finger protein, putative
6 3 5 11 RAFL07-10-D04 AY050866 Experimental RAFL07-10-D04 AV791353;AV825469;AY050866 homeobox protein
6 3 5 12 RAFL07-10-F03 AY080841 Experimental RAFL07-10-F03 AV791384;AV825486;AY080841 putative protein
6 3 5 13 RAFL07-10-L02 BT000673 Experimental RAFL07-10-L02 AV791478;AV825535;BT000673 AALP protein
6 3 5 14 RAFL07-10-D02 BT000679 Experimental RAFL07-10-D02 AV791352;AV825468;BT000679 putative 60S Ribosomal Protein L10
6 3 6 1 RAFL07-14-L16 AY059841 Experimental RAFL07-14-L16 AV792374;AV825777;AY059841 phosphoglycerate kinase like protein
6 3 6 2 RAFL07-14-E15 AY062454 Experimental RAFL07-14-E15 AV792278;AV825758;AY062454 putative protein phosphatase-2c
6 3 6 3 RAFL07-14-O14 BP561479 Experimental RAFL07-14-O14 AV792416;BP561479;AY054480 diacylglycerol O-acyltransferase (DAGAT)
6 3 6 4 RAFL07-14-K14 AY081300 Experimental RAFL07-14-K14 AV792364;AV825776;AY081300 unknown protein
6 3 6 5 RAFL07-14-A09 AY062447 Experimental RAFL07-14-A09 AV792221;AV825745;AY062447 putative polygalacturonase
6 3 6 6 RAFL07-14-G08 BP561472 Experimental RAFL07-14-G08 AV792305;BP561472;AY062446 ATP-dependent RNA helicase-like protein
6 3 6 7 RAFL07-14-I07 AV825768 Experimental RAFL07-14-I07 AV792333;AV825768 two-pore calcium channel (AtTPC1)
6 3 6 8 RAFL07-14-A07 AV825743 Experimental RAFL07-14-A07 AV792219;AV825743 beta-xylosidase
6 3 6 9 RAFL07-14-K06 BP561476 Experimental RAFL07-14-K06 AV792358;BP561476;AY054475 ATP-dependent RNA helicase
6 3 6 10 RAFL07-14-A06 AY062445 Experimental RAFL07-14-A06 AV792218;AV825742;AY062445 Unknown protein (At4g02820; T5J8.14)
6 3 6 11 RAFL07-13-G24 AY054469 Experimental RAFL07-13-G24 AV792100;AV825719;AY054469 putative transcription factor (BHLH7)
6 3 6 12 RAFL07-13-D23 AY065072 Experimental RAFL07-13-D23 AV792063;AV825710;AY065072 delta-1-pyrroline-5-carboxylate dehydrogenase precursor (P5CDH)
6 3 6 13 RAFL07-13-M22 AV825736 Experimental RAFL07-13-M22 AV792179;AV825736 unknown protein
6 3 6 14 RAFL07-13-H22 AY062453 Experimental RAFL07-13-H22 AV792112;AV825721;AY062453 nitrate transporter (NTL1)
6 3 7 1 RAFL08-08-M02 AY045672 Experimental RAFL08-08-M02 AV793465;AV826071;AY045672 putative protein
6 3 7 2 RAFL08-08-G02 AY045664 Experimental RAFL08-08-G02 AV793399;AV826048;AY045664
6 3 7 3 RAFL08-08-E02 AY052356 Experimental RAFL08-08-E02 AV793369;AV826037;AY052356 auxin transport protein (PIN7)
6 3 7 4 RAFL08-08-D01 AY050413 Experimental RAFL08-08-D01 AV793359;AV826034;AY050413 lipase/hydrolase like protein
6 3 7 5 RAFL07-18-M24 AY052350 Experimental RAFL07-18-M24 AV793278;AV826014;AY052350
6 3 7 6 RAFL07-18-J24 AY045633 Experimental RAFL07-18-J24 AV793231;AV826002;AY045633 unknown protein
6 3 7 7 RAFL07-15-G02 AY062465 Experimental RAFL07-15-G02 AV792511;AV825819;AY062465
6 3 7 8 RAFL07-15-A02 AY054487 Experimental RAFL07-15-A02 AV792432;AV825796;AY054487 putative DNA binding protein
6 3 7 9 RAFL07-15-D01 AY054486 Experimental RAFL07-15-D01 AV792467;AV825806;AY054486 putative phi-1-like phosphate-induced protein
6 3 7 10 RAFL07-14-C24 BP561470 Experimental RAFL07-14-C24 AV792253;BP561470;AY062462 putative protein
6 3 7 11 RAFL07-14-G23 AY059843 Experimental RAFL07-14-G23 AV792314;AV825765;AY059843 peptidylprolyl isomerase ROC4
6 3 7 12 RAFL07-14-M21 AV825783 Experimental RAFL07-14-M21 AV792394;AV825783 24 kDa vacuolar protein - like
6 3 7 13 RAFL07-14-B18 AY062460 Experimental RAFL07-14-B18 AV792238;AV825751;AY062460 putative fumarase
6 3 7 14 RAFL07-14-L17 AY062458 Experimental RAFL07-14-L17 AV792375;AV825778;AY062458 ribulose bisphosphate carboxylase small chain 2b precursor (RuBisCO small subunit 2b) (sp|P10797)
6 3 8 1 RAFL08-09-N04 AY045646 Experimental RAFL08-09-N04 AV793699;AV826137;AY045646
6 3 8 2 RAFL08-09-H04 AY045638 Experimental RAFL08-09-H04 AV793614;AV826110;AY045638 unknown protein
6 3 8 3 RAFL08-08-F22 AY052365 Experimental RAFL08-08-F22 AV793397;AV826047;AY052365 unknown protein
6 3 8 4 RAFL08-08-G21 AY045666 Experimental RAFL08-08-G21 AV793409;AV826051;AY045666 monodehydroascorbate reductase (NADH) - like protein
6 3 8 5 RAFL08-08-A21 AY052357 Experimental RAFL08-08-A21 AV793338;AV826030;AY052357 unknown protein
6 3 8 6 RAFL08-08-J20 AY052355 Experimental RAFL08-08-J20 AV793440;AV826061;AY052355 carbohydrate kinase like protein
6 3 8 7 RAFL08-08-I18 AY050402 Experimental RAFL08-08-I18 AV793430;AV826058;AY050402 unknown protein
6 3 8 8 RAFL08-08-L17 AY045634 Experimental RAFL08-08-L17 AV793460;AV826068;AY045634 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR)
6 3 8 9 RAFL08-08-B13 AY045671 Experimental RAFL08-08-B13 AV793343;AV826031;AY045671 unknown protein
6 3 8 10 RAFL08-08-G12 AY045662 Experimental RAFL08-08-G12 AV793404;AV826050;AY045662 unknown protein
6 3 8 11 RAFL08-08-P10 BP561525 Experimental RAFL08-08-P10 AV793506;BP561525;AY091779 acyl-CoA oxidase (gb|AAC13497.1)
6 3 8 12 RAFL08-08-C09 AY045649 Experimental RAFL08-08-C09 AV793350;AV826033;AY045649 predicted GPI-anchored protein
6 3 8 13 RAFL08-08-I08 AY045644 Experimental RAFL08-08-I08 AV793426;AV826055;AY045644 nonspecific lipid-transfer protein precursor - like
6 3 8 14 RAFL08-08-F08 AY050398 Experimental RAFL08-08-F08 AV793389;AY050398 putative alpha-amylase
6 3 9 1 RAFL08-13-O12 AY050847 Experimental RAFL08-13-O12 AV794679;AV826390;AY050847 putative pectinacetylesterase
6 3 9 2 RAFL08-13-I12 AV794591 Experimental RAFL08-13-I12 AV794591 putative protein
6 3 9 3 RAFL08-13-H11 AY064016 Experimental RAFL08-13-H11 AV794576;AV826359;AY064016
6 3 9 4 RAFL08-13-D11 BT000692 Experimental RAFL08-13-D11 AV794514;AV826353;BT000692 putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase
6 3 9 5 RAFL08-13-N06 BP561585 Experimental RAFL08-13-N06 AV794663;BP561585;AY059795 unknown protein
6 3 9 6 RAFL08-13-L06 BT000736 Experimental RAFL08-13-L06 AV794632;BP561584;BT000736
6 3 9 7 RAFL08-13-J06 AY059769 Experimental RAFL08-13-J06 AV794600;AV826368;AY059769 putative protein kinase (At1g67890)
6 3 9 8 RAFL08-13-A06 AY057577 Experimental RAFL08-13-A06 AV794468;AV826343;AY057577
6 3 9 9 RAFL08-13-O05 BP561587 Experimental RAFL08-13-O05 AV794674;BP561587 unknown protein
6 3 9 10 RAFL08-13-N04 AY056244 Experimental RAFL08-13-N04 AV794662;AY056244 glucosyltransferase like protein
6 3 9 11 RAFL08-09-A07 AY045674 Experimental RAFL08-09-A07 AV793518;AV826082;AY045674 succinate dehydrogenase flavoprotein alpha subunit (emb|CAA05025.1)
6 3 9 12 RAFL08-09-B06 AY045665 Experimental RAFL08-09-B06 AV793532;AV826087;AY045665 type 2A protein serine/threonine phosphatase 55kDa B regulatory subunit (F11A6.6)
6 3 9 13 RAFL08-09-P05 BP561533 Experimental RAFL08-09-P05 AV793723;BP561533;AY045657 electron transfer flavoprotein beta-subunit-like
6 3 9 14 RAFL08-09-M05 AY045650 Experimental RAFL08-09-M05 AV793685;AV826133;AY045650 predicted GPI-anchored protein
6 3 10 1 RAFL08-14-P10 AY050952 Experimental RAFL08-14-P10 AV794862;AV826427;AY050952 TCP1-chaperonin cofactor A like protein
6 3 10 2 RAFL08-14-L09 AY056171 Experimental RAFL08-14-L09 AV794822;AV826419;AY056171 unknown protein
6 3 10 3 RAFL08-14-F09 AV794757 Experimental RAFL08-14-F09 AV794757 pseudogene
6 3 10 4 RAFL08-14-J07 AY050837 Experimental RAFL08-14-J07 AV794798;AV826413;AY050837 putative glycosylation enzyme
6 3 10 5 RAFL08-14-E06 BP561592 Experimental RAFL08-14-E06 AV794742;BP561592;AY056256 putative protein
6 3 10 6 RAFL08-14-F05 AY064012 Experimental RAFL08-14-F05 AV794755;AV826404;AY064012 putative protein
6 3 10 7 RAFL08-13-N23 AY059796 Experimental RAFL08-13-N23 AV794671;AV826388;AY059796 ATP8
6 3 10 8 RAFL08-13-K22 AY056169 Experimental RAFL08-13-K22 AV794624;AV826377;AY056169 putative protein
6 3 10 9 RAFL08-13-J21 AY056269 Experimental RAFL08-13-J21 AV794608;AV826372;AY056269 unknown protein
6 3 10 10 RAFL08-13-G20 AY050835 Experimental RAFL08-13-G20 AV794566;AV826358;AY050835 C3HC4 type Zinc RING finger like protein
6 3 10 11 RAFL08-13-A20 BP561574 Experimental RAFL08-13-A20 AV794477;BP561574;AY056228 unknown protein
6 3 10 12 RAFL08-13-H19 AY050907 Experimental RAFL08-13-H19 AV794581;AV826361;AY050907 syntaxin-like protein synt4
6 3 10 13 RAFL08-13-B15 AY056177 Experimental RAFL08-13-B15 AV794489;AV826345;AY056177 unknown protein
6 3 10 14 RAFL08-13-M13 AY059787 Experimental RAFL08-13-M13 AV794652;AV826383;AY059787 ABC transporter like protein
6 3 11 1 RAFL09-06-F09 BT002397 Experimental RAFL09-06-F09 AV796046;AV826685;BT002397 nonspecific lipid-transfer protein precursor - like
6 3 11 2 RAFL09-06-B09 AY062697 Experimental RAFL09-06-B09 AV795990;AV826655;AY062697 putative polygalacturonase
6 3 11 3 RAFL09-06-D05 AY059883 Experimental RAFL09-06-D05 AV796014;AV826667;AY059883
6 3 11 4 RAFL09-06-P04 AY081320 Experimental RAFL09-06-P04 AV796194;AV826754;AY081320 avirulence induced gene (AIG) - like protein
6 3 11 5 RAFL09-06-I04 AY062560 Experimental RAFL09-06-I04 AV796090;AV826704;AY062560 glutamate-tRNA ligase
6 3 11 6 RAFL09-06-K03 AY062689 Experimental RAFL09-06-K03 AV796114;AV826715;AY062689 unknown protein
6 3 11 7 RAFL09-06-A03 BP561641 Experimental RAFL09-06-A03 AV795969;BP561641;AY062688 Unknown protein
6 3 11 8 RAFL09-06-J02 AY062687 Experimental RAFL09-06-J02 AV796099;AV826708;AY062687 Unknown protein (YUP8H12.25)
6 3 11 9 RAFL08-19-B21 AY062555 Experimental RAFL08-19-B21 AV795785;AV826614;AY062555
6 3 11 10 RAFL08-19-B20 BT002405 Experimental RAFL08-19-B20 AV795784;BP561637;BT002405 putative protein
6 3 11 11 RAFL08-19-J19 AY062572 Experimental RAFL08-19-J19 AV795883;AV826631;AY062572 Unknown protein (At5g56100; MDA7.16)
6 3 11 12 RAFL08-19-F19 BP561639 Experimental RAFL08-19-F19 AV795830;BP561639;AY062566 fructose-bisphosphate aldolase -like protein
6 3 11 13 RAFL08-19-J18 AY059882 Experimental RAFL08-19-J18 AV795882;AV826630;AY059882 serine palmitoyltransferase-like protein
6 3 11 14 RAFL08-19-H17 AY081319 Experimental RAFL08-19-H17 AV795855;AV826625;AY081319 putative senescence-related protein
6 3 12 1 RAFL09-09-F08 AY070135 Experimental RAFL09-09-F08 AV796709;AV826888;AY070135
6 3 12 2 RAFL09-09-P07 AY058859 Experimental RAFL09-09-P07 AV796887;AV826965;AY058859 putative protein
6 3 12 3 RAFL09-09-N07 AY057495 Experimental RAFL09-09-N07 AV796855;AY057495 unknown protein
6 3 12 4 RAFL09-09-L07 AY058831 Experimental RAFL09-09-L07 AV796819;AV826936;AY058831 putative protein
6 3 12 5 RAFL09-06-G14 AY062576 Experimental RAFL09-06-G14 AV796064;AV826691;AY062576 Unknown protein (At1g68140; T23K23.1)
6 3 12 6 RAFL09-06-C14 AY062707 Experimental RAFL09-06-C14 AV796004;AV826662;AY062707 putative phenylalanyl-tRNA synthetase beta-subunit; PheHB
6 3 12 7 RAFL09-06-P13 BT000436 Experimental RAFL09-06-P13 AV796199;BT000436 neoxanthin cleavage enzyme nc1
6 3 12 8 RAFL09-06-N13 AV826745 Experimental RAFL09-06-N13 AV796171;AV826745 tubulin alpha-6 chain (TUA6)
6 3 12 9 RAFL09-06-E13 AY062703 Experimental RAFL09-06-E13 AV796033;AV826679;AY062703 putative oxysterol-binding protein
6 3 12 10 RAFL09-06-J12 AY062702 Experimental RAFL09-06-J12 AV796106;AV826712;AY062702 ACTIN 2/7 (sp|P53492)
6 3 12 11 RAFL09-06-D10 AY062698 Experimental RAFL09-06-D10 AV796018;AV826671;AY062698 endoxyloglucan transferase
6 3 12 12 RAFL09-06-N09 AV826742 Experimental RAFL09-06-N09 AV796167;AV826742 cellulose synthase catalytic subunit, putative
6 3 12 13 RAFL09-06-K09 BP561648 Experimental RAFL09-06-K09 AV796120;BP561648 nodulin-like protein
6 3 12 14 RAFL09-06-I09 AV826706 Experimental RAFL09-06-I09 AV796093;AV826706 cytochrome P450 like protein
6 3 13 1 RAFL09-09-E18 AY058893 Experimental RAFL09-09-E18 AV796698;AV826886;AY058893 unknown protein
6 3 13 2 RAFL09-09-P17 AY058885 Experimental RAFL09-09-P17 AV796896;AV826968;AY058885 putative 40S ribosomal protein SA (laminin receptor-like protein)
6 3 13 3 RAFL09-09-G17 AY058866 Experimental RAFL09-09-G17 AV796733;AV826898;AY058866 putative protein
6 3 13 4 RAFL09-09-D17 AY058858 Experimental RAFL09-09-D17 AV796679;AY058858 tubulin alpha-6 chain (TUA6)
6 3 13 5 RAFL09-09-B17 AY057497 Experimental RAFL09-09-B17 AV796645;AV826868;AY057497 putative protein
6 3 13 6 RAFL09-09-O16 AY058837 Experimental RAFL09-09-O16 AV796879;AV826963;AY058837 cytochrome P450 -like protein
6 3 13 7 RAFL09-09-M14 AY058888 Experimental RAFL09-09-M14 AV796843;AY058888 unknown protein
6 3 13 8 RAFL09-09-H14 AV796749 Experimental RAFL09-09-H14 AV796749 tubulin beta-6 chain (sp|P29514)
6 3 13 9 RAFL09-09-M13 AY058872 Experimental RAFL09-09-M13 AV796842;AV826947;AY058872 putative protein
6 3 13 10 RAFL09-09-C13 AY058856 Experimental RAFL09-09-C13 AV796660;AV826876;AY058856 P-Protein - like protein
6 3 13 11 RAFL09-09-L12 AY058847 Experimental RAFL09-09-L12 AV796822;AV826938;AY058847 anter-specific proline-rich protein APG precursor
6 3 13 12 RAFL09-09-D12 AY058835 Experimental RAFL09-09-D12 AV796674;AV826880;AY058835 putative protein
6 3 13 13 RAFL09-09-O08 AY057505 Experimental RAFL09-09-O08 AV796874;AV826960;AY057505 putative protein
6 3 13 14 RAFL09-09-K08 AY057504 Experimental RAFL09-09-K08 AV796801;AV826931;AY057504 unknown protein
6 3 14 1 RAFL09-12-N24 AV827242 Experimental RAFL09-12-N24 AV797633;AV827242;AF367264
6 3 14 2 RAFL09-12-K24 AV827225 Experimental RAFL09-12-K24 AV797576;AV827225;AF361799 unknown protein
6 3 14 3 RAFL09-12-H19 AV827211 Experimental RAFL09-12-H19 AV797531;AV827211;AF361828 deoxyhypusine synthase
6 3 14 4 RAFL09-12-K18 AV827224 Experimental RAFL09-12-K18 AV797572;AV827224;AF361807 30S ribosomal protein S20
6 3 14 5 RAFL09-12-F18 AV827199 Experimental RAFL09-12-F18 AV797500;AV827199;AF361818 putative protein
6 3 14 6 RAFL09-12-H17 AV827210 Experimental RAFL09-12-H17 AV797530;AV827210;AF367277 unknown protein
6 3 14 7 RAFL09-12-F17 AY065064 Experimental RAFL09-12-F17 AV797499;AV827198;AY065064 14-3-3-like protein
6 3 14 8 RAFL09-12-P16 AV797660 Experimental RAFL09-12-P16 AV797660;AF361798 2-dehydro-3-deoxyphosphoheptonate aldolase
6 3 14 9 RAFL09-09-M21 AY058891 Experimental RAFL09-09-M21 AV796850;AV826950;AY058891 unknown protein
6 3 14 10 RAFL09-09-F21 AY058878 Experimental RAFL09-09-F21 AV796716;AV826890;AY058878 putative protein
6 3 14 11 RAFL09-09-B21 AY058869 Experimental RAFL09-09-B21 AV796648;AV826870;AY058869 putative endosomal protein
6 3 14 12 RAFL09-09-P20 AY128288 Experimental RAFL09-09-P20 AV796899;AV826969;AY128288 putative synaptobrevin
6 3 14 13 RAFL09-09-L20 BP561677 Experimental RAFL09-09-L20 AV796828;BP561677;AY058844 HUELLENLOS PARALOG (HLP)
6 3 14 14 RAFL09-09-I20 AY058830 Experimental RAFL09-09-I20 AV796772;AV826917;AY058830 bzip transcription factor HBP-1b/Atbzip26
6 4 1 1 RAFL06-10-P13 AV823950 Experimental RAFL06-10-P13 AV785046;AV823950 DEAD BOX RNA helicase RH15 - like protein
6 4 1 2 RAFL06-12-A07 AY065114 Experimental RAFL06-12-A07 AV785127;AV824014;AY065114 putative protein
6 4 1 3 RAFL06-11-O03 AY072335 Experimental RAFL06-11-O03 AV785119;AV824006;AY072335 unknown protein
6 4 1 4 RAFL06-11-M10 BP561136 Experimental RAFL06-11-M10 AV785111;BP561136;AY092995
6 4 1 5 RAFL06-11-K10 AV823993 Experimental RAFL06-11-K10 AV785099;AV823993 bZip transcription factor AtbZip39
6 4 1 6 RAFL06-11-G12 AY092994 Experimental RAFL06-11-G12 AV785080;AV823979;AY092994 succinyl-CoA synthetase, alpha subunit
6 4 1 7 RAFL06-10-O23 AY062774 Experimental RAFL06-10-O23 AV785044;AV823948;AY062774 senescence-associated protein -like
6 4 1 8 RAFL06-10-K24 AY128399 Experimental RAFL06-10-K24 AV823938;AY128399 unknown protein
6 4 1 9 RAFL06-10-F10 BT002425 Experimental RAFL06-10-F10 AV785006;AV823921;BT002425 unknown protein
6 4 1 10 RAFL06-11-P18 AY128397 Experimental RAFL06-11-P18 AV785125;AV824012;AY128397 nodulin-like protein
6 4 1 11 RAFL06-11-M08 AY062773 Experimental RAFL06-11-M08 AV785109;AV824000;AY062773 unknown protein
6 4 1 12 RAFL06-11-K08 AY062772 Experimental RAFL06-11-K08 AV785097;AV823991;AY062772 cytoplasmatic aconitate hydratase (citrate hydro-lyase)(aconitase)(EC 4.2.1.3)
6 4 1 13 RAFL06-10-K12 AY092989 Experimental RAFL06-10-K12 AV785027;AV823937;AY092989
6 4 1 14 RAFL06-10-G14 BP561119 Experimental RAFL06-10-G14 AV785012;BP561119;AY072340 putative serine/threonine-protein kinase
6 4 2 1 RAFL06-12-A18 BP561142 Experimental RAFL06-12-A18 AV785131;BP561142;AF462794 putative UDP-N-acetylglucosamine pyrophosphorylase
6 4 2 2 RAFL06-12-E09 AY058113 Experimental RAFL06-12-E09 AV785147;AV824025;AY058113 plasma membrane intrinsic protein 1a
6 4 2 3 RAFL06-12-G21 AY070772 Experimental RAFL06-12-G21 AV785159;AY070772 unknown protein
6 4 2 4 RAFL06-12-D15 AY058136 Experimental RAFL06-12-D15 AV785144;AY058136
6 4 2 5 RAFL06-12-G20 AY058133 Experimental RAFL06-12-G20 AV785158;AV824031;AY058133 putative protein
6 4 2 6 RAFL06-12-D08 AY058132 Experimental RAFL06-12-D08 AV785143;AV824022;AY058132 putative protein
6 4 2 7 RAFL06-12-H15 AV824035 Experimental RAFL06-12-H15 AV785165;AV824035 putative protein
6 4 2 8 RAFL06-12-D06 AY058111 Experimental RAFL06-12-D06 AV785141;AV824021;AY058111 non-specific lipid transfer protein
6 4 2 9 RAFL06-10-L20 AY128404 Experimental RAFL06-10-L20 AV785031;AV823940;AY128404 unknown protein
6 4 2 10 RAFL06-10-F16 AY062784 Experimental RAFL06-10-F16 AV823923;AY062784
6 4 2 11 RAFL06-10-D15 AV823908 Experimental RAFL06-10-D15 AV784990;AV823908 putative dicarboxylate diiron protein (Crd1)
6 4 2 12 RAFL06-11-K16 AY072339 Experimental RAFL06-11-K16 AV785101;AV823994;AY072339
6 4 2 13 RAFL06-11-F13 AY062782 Experimental RAFL06-11-F13 AV785070;AV823971;AY062782 Unknown protein (At1g44750; T12C22.2)
6 4 2 14 RAFL06-10-P15 AY062781 Experimental RAFL06-10-P15 AV785047;AV823951;AY062781 raffinose synthase -like protein
6 4 3 1 RAFL06-13-L16 AY070769 Experimental RAFL06-13-L16 AV785268;AV824118;AY070769 ribosomal protein S4
6 4 3 2 RAFL06-15-P18 AY070766 Experimental RAFL06-15-P18 AV785405;AV824212;AY070766 major latex protein type1
6 4 3 3 RAFL06-13-H08 BP561161 Experimental RAFL06-13-H08 BP561161;AY058121 putative pyruvate kinase, plastid isozyme (At1g32440)
6 4 3 4 RAFL06-13-F23 AY070758 Experimental RAFL06-13-F23 AV785229;AV824084;AY070758 UDP-glucose dehydrogenase like protein
6 4 3 5 RAFL06-14-B12 BP561172 Experimental RAFL06-14-B12 AV785300;BP561172 unknown protein
6 4 3 6 RAFL06-13-O18 AY058144 Experimental RAFL06-13-O18 AV785289;AV824131;AY058144 hypothetical protein
6 4 3 7 RAFL06-13-N01 AV824122 Experimental RAFL06-13-N01 AV785279;AV824122 putative protein
6 4 3 8 RAFL06-16-B03 AY058130 Experimental RAFL06-16-B03 AV785412;AY058130 CONSTANS-like B-box zinc finger protein
6 4 3 9 RAFL06-15-P15 AY070762 Experimental RAFL06-15-P15 AV785404;AV824211;AY070762 unknown protein
6 4 3 10 RAFL06-15-O12 AY090340 Experimental RAFL06-15-O12 AV785393;AV824202;AY090340 hypothetical protein
6 4 3 11 RAFL06-12-E12 AY090346 Experimental RAFL06-12-E12 AV785149;AV824026;AY090346 leucyl aminopeptidase like protein
6 4 3 12 RAFL06-12-A22 AY075594 Experimental RAFL06-12-A22 AV785133;AY075594
6 4 3 13 RAFL06-12-F22 AV824030 Experimental RAFL06-12-F22 AV785155;AV824030
6 4 3 14 RAFL06-12-F18 AY058127 Experimental RAFL06-12-F18 AV785154;AY058127 unknown protein
6 4 4 1 RAFL07-07-D15 AY059784 Experimental RAFL07-07-D15 AV790770;AY059784 putative WD-repeat membrane protein
6 4 4 2 RAFL07-07-P14 AY050891 Experimental RAFL07-07-P14 AV790901;AV825299;AY050891 putative calcium dependent protein kinase
6 4 4 3 RAFL07-07-D14 BT000655 Experimental RAFL07-07-D14 AV790769;AV825258;BT000655 eukaryotic protein synthesis initiation factor 4A
6 4 4 4 RAFL07-07-F13 AY064006 Experimental RAFL07-07-F13 AV790796;AV825263;AY064006 PROBABLE EUKARYOTIC TRANSLATION INITIATION FACTOR 3 SUBUNIT 8
6 4 4 5 RAFL07-07-A12 AY059772 Experimental RAFL07-07-A12 AV790746;AV825248;AY059772 hypothetical protein, 5' partial
6 4 4 6 RAFL07-07-D11 BT000779 Experimental RAFL07-07-D11 AV790767;AV825257;BT000779 putative homeodomain protein
6 4 4 7 RAFL07-07-L06 AY056134 Experimental RAFL07-07-L06 AV790858;AY056134
6 4 4 8 RAFL07-07-I05 BP561405 Experimental RAFL07-07-I05 AV790821;BP561405;AY050888 putative importin beta binding domain
6 4 4 9 RAFL07-07-A05 AY050862 Experimental RAFL07-07-A05 AV790741;AV825244;AY050862
6 4 4 10 RAFL07-07-H04 AY050986 Experimental RAFL07-07-H04 AV790811;AY050986 putative sucrose transport protein, SUC2
6 4 4 11 RAFL07-07-A03 AY056208 Experimental RAFL07-07-A03 AV790740;AV825243;AY056208
6 4 4 12 RAFL07-07-E01 BT000778 Experimental RAFL07-07-E01 AV790774;BP561400;BT000778 putative protein
6 4 4 13 RAFL06-16-G14 AV785439 Experimental RAFL06-16-G14 AV785439 putative protein phosphatase type 2C (At1g22280)
6 4 4 14 RAFL06-13-N02 AY075592 Experimental RAFL06-13-N02 AV785280;AV824123;AY075592 unknown protein
6 4 5 1 RAFL07-11-M03 BP561454 Experimental RAFL07-11-M03 AV791721;BP561454 sucrose export defective 1 precursor (SXD1)
6 4 5 2 RAFL07-11-L01 BP561452 Experimental RAFL07-11-L01 AV791706;BP561452;AY072330 poly(ADP-ribose) like glycohydrolase
6 4 5 3 RAFL07-08-H06 BP561418 Experimental RAFL07-08-H06 AV791014;BP561418;AY050904 unknown protein
6 4 5 4 RAFL07-08-E06 AY046045 Experimental RAFL07-08-E06 AV790968;AV825318;AY046045 hypothetical protein
6 4 5 5 RAFL07-08-L05 AY050868 Experimental RAFL07-08-L05 AV791075;AV825357;AY050868 unknown protein
6 4 5 6 RAFL07-08-H05 AY045899 Experimental RAFL07-08-H05 AV791013;AV825337;AY045899 unknown protein
6 4 5 7 RAFL07-08-D05 AY059773 Experimental RAFL07-08-D05 AV790950;AV825312;AY059773 putative transcription factor (MYB4R1)
6 4 5 8 RAFL07-08-O04 AY080829 Experimental RAFL07-08-O04 AV791109;AV825373;AY080829 unknown protein
6 4 5 9 RAFL07-07-M24 AY050954 Experimental RAFL07-07-M24 AV790877;AV825289;AY050954 unknown protein
6 4 5 10 RAFL07-07-D24 AY056297 Experimental RAFL07-07-D24 AV790773;AY056297 putative receptor protein kinase (At1g74360)
6 4 5 11 RAFL07-07-I23 AY056291 Experimental RAFL07-07-I23 AV790828;AV825273;AY056291 phosphoglycerate kinase, putative
6 4 5 12 RAFL07-07-I22 AY045867 Experimental RAFL07-07-I22 AV790827;AV825272;AY045867 unknown protein
6 4 5 13 RAFL07-07-J21 AY074371 Experimental RAFL07-07-J21 AV790839;AV825277;AY074371 unknown protein
6 4 5 14 RAFL07-07-G21 BP561404 Experimental RAFL07-07-G21 AV790809;BP561404;AY059746 auxin response factor-like protein
6 4 6 1 RAFL07-12-D03 BT002412 Experimental RAFL07-12-D03 AV791826;AV825642;BT002412 unknown protein
6 4 6 2 RAFL07-12-F02 AV791855 Experimental RAFL07-12-F02 AV791855 homeodomain protein BELL1, putative
6 4 6 3 RAFL07-12-L01 AY054468 Experimental RAFL07-12-L01 AV791943;AV825678;AY054468 peptidylprolyl isomerase (cyclophilin)
6 4 6 4 RAFL07-12-G01 AV791868 Experimental RAFL07-12-G01 AV791868 putative protein
6 4 6 5 RAFL07-11-N19 AY062438 Experimental RAFL07-11-N19 AV791748;AY062438 putative protein
6 4 6 6 RAFL07-11-O17 AY054463 Experimental RAFL07-11-O17 AV791762;AV825627;AY054463 unknown protein
6 4 6 7 RAFL07-11-J17 AY054513 Experimental RAFL07-11-J17 AV791682;AV825597;AY054513 homeotic protein BEL1 homolog
6 4 6 8 RAFL07-11-K16 AV825604 Experimental RAFL07-11-K16 AV791700;AV825604 unknown
6 4 6 9 RAFL07-11-I16 AV791669 Experimental RAFL07-11-I16 AV791669
6 4 6 10 RAFL07-11-I15 AY054512 Experimental RAFL07-11-I15 AV791668;AV825590;AY054512 Unknown protein
6 4 6 11 RAFL07-11-N06 AY062639 Experimental RAFL07-11-N06 AV791735;AV825618;AY062639 selenium-binding protein-like
6 4 6 12 RAFL07-11-K06 AY054518 Experimental RAFL07-11-K06 AV791690;AV825601;AY054518 unknown
6 4 6 13 RAFL07-11-M05 BT000454 Experimental RAFL07-11-M05 AV791723;AV825612;BT000454 putative 3-hydroxybutyryl-CoA dehydrogenase
6 4 6 14 RAFL07-11-J04 BT002061 Experimental RAFL07-11-J04 AV791676;AV825592;BT002061 putative phosphate/phosphoenolpyruvate translocator
6 4 7 1 RAFL07-16-P05 AY045623 Experimental RAFL07-16-P05 AV792847;AV825898;AY045623 phosphoglycerate kinase like protein
6 4 7 2 RAFL07-16-N04 AY065029 Experimental RAFL07-16-N04 AV792825;AV825892;AY065029 putative protein kinase
6 4 7 3 RAFL07-16-J03 AY050373 Experimental RAFL07-16-J03 AV792778;AV825879;AY050373 xyloglucan endo-1,4-beta-D-glucanase-like protein
6 4 7 4 RAFL07-16-N02 AY050457 Experimental RAFL07-16-N02 AV792824;AV825891;AY050457 unknown protein
6 4 7 5 RAFL07-16-H02 AY065021 Experimental RAFL07-16-H02 AV792747;AV825874;AY065021 unknown protein
6 4 7 6 RAFL07-16-L01 BP561499 Experimental RAFL07-16-L01 AV792798;BP561499;AY050456 dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase like protein
6 4 7 7 RAFL07-12-M09 AY128380 Experimental RAFL07-12-M09 AV791961;AV825684;AY128380 fructose bisphosphate aldolase like protein
6 4 7 8 RAFL07-12-I09 AV825664 Experimental RAFL07-12-I09 AV791902;AV825664 unknown protein
6 4 7 9 RAFL07-12-E09 BT000449 Experimental RAFL07-12-E09 AV791846;AV825651;BT000449 putative protein
6 4 7 10 RAFL07-12-J08 AY059837 Experimental RAFL07-12-J08 AV791914;AV825668;AY059837 unknown protein
6 4 7 11 RAFL07-12-F08 BT000450 Experimental RAFL07-12-F08 AV791857;AV825656;BT000450 phytoene synthase (gb|AAB65697.1)
6 4 7 12 RAFL07-12-F07 BP561462 Experimental RAFL07-12-F07 AV791856;BP561462 protein phosphatase 2C-like
6 4 7 13 RAFL07-12-N03 AV825692 Experimental RAFL07-12-N03 AV791975;AV825692 oligouridylate binding protein, putative
6 4 7 14 RAFL07-12-J03 AV825667 Experimental RAFL07-12-J03 AV791911;AV825667 putative mRNA capping enzyme, RNA guanylyltransferase
6 4 8 1 RAFL07-17-J11 AY065019 Experimental RAFL07-17-J11 AV792980;AV825934;AY065019 putative protein
6 4 8 2 RAFL07-17-H11 AY091777 Experimental RAFL07-17-H11 AV792953;AV825926;AY091777 hypothetical protein
6 4 8 3 RAFL07-17-F05 AY045621 Experimental RAFL07-17-F05 AV792925;AV825921;AY045621 chloroplast omega-6 fatty acid desaturase (fad6)
6 4 8 4 RAFL07-17-O04 AY050379 Experimental RAFL07-17-O04 AV793051;AV825954;AY050379 auxin-resistance protein AXR1
6 4 8 5 RAFL07-17-I04 AY045614 Experimental RAFL07-17-I04 AV792962;AY045614 unknown protein
6 4 8 6 RAFL07-17-E04 AY045611 Experimental RAFL07-17-E04 AV792911;AV825917;AY045611 putative phosphotyrosyl phosphatase activator protein
6 4 8 7 RAFL07-17-F03 AY065022 Experimental RAFL07-17-F03 AV792924;AV825920;AY065022 unknown protein
6 4 8 8 RAFL07-17-K02 AY050370 Experimental RAFL07-17-K02 AV792991;AV825938;AY050370 unknown protein
6 4 8 9 RAFL07-16-M20 BP561501 Experimental RAFL07-16-M20 AV792820;BP561501;AY079164 putative vesicle-associated membrane protein, synaptobrevin 7B, 5' partial
6 4 8 10 RAFL07-16-F20 AY079161 Experimental RAFL07-16-F20 AV792731;AV825871;AY079161
6 4 8 11 RAFL07-16-I19 AY050375 Experimental RAFL07-16-I19 AV792772;AV825877;AY050375 AT3g01540/F4P13_9
6 4 8 12 RAFL07-16-P17 AY065025 Experimental RAFL07-16-P17 AV792856;AV825903;AY065025 unknown protein
6 4 8 13 RAFL07-16-M16 AY050427 Experimental RAFL07-16-M16 AV792818;AV825888;AY050427 carboxypeptidase precursor-like protein
6 4 8 14 RAFL07-16-I16 AY050425 Experimental RAFL07-16-I16 AV792770;AV825876;AY050425 unknown protein
6 4 9 1 RAFL08-11-K04 AY050846 Experimental RAFL08-11-K04 AV794134;AV826241;AY050846 unknown protein
6 4 9 2 RAFL08-11-E04 AY091146 Experimental RAFL08-11-E04 AV794032;AY091146
6 4 9 3 RAFL08-11-M03 BT000688 Experimental RAFL08-11-M03 AV794171;AV826253;BT000688 translation elongation factor eEF-1 alpha chain (gene A4)
6 4 9 4 RAFL08-11-F03 BP561552 Experimental RAFL08-11-F03 AV794047;BP561552;AY056246 DnaJ-like protein
6 4 9 5 RAFL08-10-N19 AY056158 Experimental RAFL08-10-N19 AV793933;AV826189;AY056158 unknown protein
6 4 9 6 RAFL08-10-O15 AY056166 Experimental RAFL08-10-O15 AV793944;AV826195;AY056166 putative lipoxygenase
6 4 9 7 RAFL08-10-N14 BT000762 Experimental RAFL08-10-N14 AV793929;AV826186;BT000762 vegetative storage protein Vsp2
6 4 9 8 RAFL08-10-O13 BP561545 Experimental RAFL08-10-O13 AV793942;BP561545;AY056282 unknown protein
6 4 9 9 RAFL08-10-P05 AY056253 Experimental RAFL08-10-P05 AV793950;AV826198;AY056253
6 4 9 10 RAFL08-10-O03 AY059764 Experimental RAFL08-10-O03 AV793937;AV826192;AY059764 unknown protein
6 4 9 11 RAFL07-17-I15 AY079163 Experimental RAFL07-17-I15 AV792967;AV825931;AY079163 alcohol dehydrogenase - like protein
6 4 9 12 RAFL07-17-O14 AV793058 Experimental RAFL07-17-O14 AV793058 structural maintenance of chromosomes (SMC) - like protein
6 4 9 13 RAFL07-17-N12 AY065027 Experimental RAFL07-17-N12 AV793043;AV825951;AY065027 putative pseudouridine synthase (NAP57)
6 4 9 14 RAFL07-17-E12 BP561502 Experimental RAFL07-17-E12 AV792916;BP561502;AY075643 putative protein
6 4 10 1 RAFL08-11-G18 BT000733 Experimental RAFL08-11-G18 AV794075;AV826221;BT000733 cysteine proteinase like protein
6 4 10 2 RAFL08-11-A18 AY056170 Experimental RAFL08-11-A18 AV793974;AV826202;AY056170 putative fatty acid elongase
6 4 10 3 RAFL08-11-J17 AY050849 Experimental RAFL08-11-J17 AV794126;AY050849 cytochrome P450, putative
6 4 10 4 RAFL08-11-P16 BT000672 Experimental RAFL08-11-P16 AV794228;AV826269;BT000672
6 4 10 5 RAFL08-11-H16 AY056255 Experimental RAFL08-11-H16 AV794092;AV826228;AY056255 9-cis-epoxycarotenoid dioxygenase, putative
6 4 10 6 RAFL08-11-F16 AY050909 Experimental RAFL08-11-F16 AV794057;AY050909 unknown protein
6 4 10 7 RAFL08-11-M13 AY050915 Experimental RAFL08-11-M13 AV794178;AV826254;AY050915 zinc finger protein Zat12
6 4 10 8 RAFL08-11-L12 AY056168 Experimental RAFL08-11-L12 AV794160;AV826248;AY056168 unknown protein
6 4 10 9 RAFL08-11-B12 AY050940 Experimental RAFL08-11-B12 AV793988;AV826205;AY050940 unknown protein
6 4 10 10 RAFL08-11-O11 BP561562 Experimental RAFL08-11-O11 AV794209;BP561562;AY050931 cinnamyl-alcohol dehydrogenase ELI3-1
6 4 10 11 RAFL08-11-O10 BP561561 Experimental RAFL08-11-O10 AV794208;BP561561;AY056227 protease HhoA like precursor
6 4 10 12 RAFL08-11-K10 BP561559 Experimental RAFL08-11-K10 AV794140;BP561559;AY059765 unknown protein
6 4 10 13 RAFL08-11-K05 AY056176 Experimental RAFL08-11-K05 AV794135;AV826242;AY056176 putative LRR receptor protein kinase
6 4 10 14 RAFL08-11-D05 AY063905 Experimental RAFL08-11-D05 AV794014;AY063905 putative protein
6 4 11 1 RAFL08-17-G05 AY062673 Experimental RAFL08-17-G05 AV795389;AV826535;AY062673 putative 40S ribosomal protein
6 4 11 2 RAFL08-17-O04 AY081317 Experimental RAFL08-17-O04 AV795503;AV826558;AY081317 WD repeat protein-like
6 4 11 3 RAFL08-16-K20 AY062665 Experimental RAFL08-16-K20 AV795246;AV826506;AY062665 PRH26
6 4 11 4 RAFL08-16-I18 AY062535 Experimental RAFL08-16-I18 AV795216;AV826500;AY062535 nodulin, putative
6 4 11 5 RAFL08-16-J17 AY059870 Experimental RAFL08-16-J17 AV795230;AV826503;AY059870 thioredoxin (clone GIF1) (pir||S58118)
6 4 11 6 RAFL08-16-F17 AY059868 Experimental RAFL08-16-F17 AV795175;AV826490;AY059868 Unknown protein (At5g43950; MRH10.5)
6 4 11 7 RAFL08-16-J16 BP561614 Experimental RAFL08-16-J16 AV795229;BP561614 unknown protein
6 4 11 8 RAFL08-16-O15 AY062663 Experimental RAFL08-16-O15 AV795300;AV826519;AY062663
6 4 11 9 RAFL08-16-M06 AY062658 Experimental RAFL08-16-M06 AV795266;AV826508;AY062658 ADP-ribosylation factor-like protein (K12B20.15)
6 4 11 10 RAFL08-16-O04 AY128391 Experimental RAFL08-16-O04 AV795290;AY128391 unknown protein
6 4 11 11 RAFL08-16-K03 BP561615 Experimental RAFL08-16-K03 AV795236;BP561615;AY092974 naringenin 3-dioxygenase like protein
6 4 11 12 RAFL08-16-N02 AY062538 Experimental RAFL08-16-N02 AV795277;AV826513;AY062538 SCARECROW gene regulator
6 4 11 13 RAFL08-16-L01 AY059869 Experimental RAFL08-16-L01 AV795251;AV826507;AY059869 unknown protein
6 4 11 14 RAFL08-16-G01 AY062657 Experimental RAFL08-16-G01 AV795179;AV826492;AY062657 unknown protein
6 4 12 1 RAFL09-07-I03 AV826821 Experimental RAFL09-07-I03 AV796341;AV826821;AF419586 translation elongation factor eEF-1 alpha chain (gene A4)
6 4 12 2 RAFL09-07-I02 AV826820 Experimental RAFL09-07-I02 AV796340;AV826820;AF419581 putative transposon
6 4 12 3 RAFL09-07-M01 AV826837 Experimental RAFL09-07-M01 AV796392;AV826837;AF424621 reticuline oxidase -like protein
6 4 12 4 RAFL09-07-I01 AV826819 Experimental RAFL09-07-I01 AV796339;AV826819;AF419559 MTN3-like protein
6 4 12 5 RAFL08-17-C19 BP561620 Experimental RAFL08-17-C19 AV795341;BP561620;AY062550
6 4 12 6 RAFL08-17-N18 AY062549 Experimental RAFL08-17-N18 AV795498;AV826557;AY062549 unknown protein
6 4 12 7 RAFL08-17-D18 AV795354 Experimental RAFL08-17-D18 AV795354 DNA polymerase epsilon subunit B -like protein
6 4 12 8 RAFL08-17-G17 AY092975 Experimental RAFL08-17-G17 AV795395;AV826537;AY092975 RNA-binding protein-like
6 4 12 9 RAFL08-17-E16 AV826532 Experimental RAFL08-17-E16 AV795365;AV826532 unknown protein
6 4 12 10 RAFL08-17-N14 BP561627 Experimental RAFL08-17-N14 AV795495;BP561627;AY062547
6 4 12 11 RAFL08-17-L08 AY062541 Experimental RAFL08-17-L08 AV795463;AV826550;AY062541 unknown protein
6 4 12 12 RAFL08-17-O07 AY062676 Experimental RAFL08-17-O07 AV795505;AV826559;AY062676 glutathione S-transferase
6 4 12 13 RAFL08-17-M06 AY062540 Experimental RAFL08-17-M06 AV795479;AV826553;AY062540 unknown protein
6 4 12 14 RAFL08-17-D06 AY062539 Experimental RAFL08-17-D06 AV795347;AV826530;AY062539 calcium-dependent like protein kinase
6 4 13 1 RAFL09-07-G22 BP561660 Experimental RAFL09-07-G22 AV796319;BP561660;AF419608 glutamate--ammonia ligase
6 4 13 2 RAFL09-07-H21 BP561661 Experimental RAFL09-07-H21 AV796337;BP561661;AF419594 unknown protein
6 4 13 3 RAFL09-07-K20 AY064997 Experimental RAFL09-07-K20 AV796373;AV826829;AY064997 unknown protein
6 4 13 4 RAFL09-07-O19 AV826857 Experimental RAFL09-07-O19 AV796433;AV826857;AF419580 putative protein
6 4 13 5 RAFL09-07-M18 AV826843 Experimental RAFL09-07-M18 AV796402;AV826843;AF419560 putative protein
6 4 13 6 RAFL09-07-K17 AV796372 Experimental RAFL09-07-K17 AV796372;AF419554 ribonucleoprotein, putative
6 4 13 7 RAFL09-07-H12 AV826816 Experimental RAFL09-07-H12 AV796329;AV826816;AF419606 unknown protein (At1g73750)
6 4 13 8 RAFL09-07-L11 AV826835 Experimental RAFL09-07-L11 AV796384;AV826835;AF424629 MAP kinase
6 4 13 9 RAFL09-07-G11 AV826810 Experimental RAFL09-07-G11 AV796311;AV826810;AF419583 putative ATP-dependent RNA helicase
6 4 13 10 RAFL09-07-M10 AV826839 Experimental RAFL09-07-M10 AV796397;AV826839;AF424625 respiratory burst oxidase protein
6 4 13 11 RAFL09-07-N09 AV826848 Experimental RAFL09-07-N09 AV796412;AV826848;AF419566 putative ubiquitin
6 4 13 12 RAFL09-07-G09 BP561659 Experimental RAFL09-07-G09 AV796310;BP561659;AF419557 glutamine-dependent asparagine synthetase
6 4 13 13 RAFL09-07-K04 AV826828 Experimental RAFL09-07-K04 AV796363;AV826828;AF424634 leucyl aminopeptidase like protein
6 4 13 14 RAFL09-07-G04 AY128280 Experimental RAFL09-07-G04 AV796305;AV826807;AY128280 brassinosteroid receptor kinase, putative
6 4 14 1 RAFL09-11-I03 BP561686 Experimental RAFL09-11-I03 AV797282;BP561686;AF361588 Cryptochrome 1 apoprotein (flavin-type blue-light photoreceptor) (HY4) (CRY1)
6 4 14 2 RAFL09-11-I02 AV827114 Experimental RAFL09-11-I02 AV797281;AV827114;AF367330 unknown protein
6 4 14 3 RAFL09-10-N19 AV827061 Experimental RAFL09-10-N19 AV797124;AV827061;AF361602 unknown protein
6 4 14 4 RAFL09-10-N17 AV827060 Experimental RAFL09-10-N17 AV797123;AV827060;AF367353 myrosinase binding protein-like
6 4 14 5 RAFL09-10-O14 BP561685 Experimental RAFL09-10-O14 AV797135;BP561685;AF361595
6 4 14 6 RAFL09-10-P10 AV827072 Experimental RAFL09-10-P10 AV797147;AV827072;AF367339 putative protein kinase
6 4 14 7 RAFL09-10-P05 AV827070 Experimental RAFL09-10-P05 AV797144;AV827070 CER1 protein
6 4 14 8 RAFL09-10-O04 AY045625 Experimental RAFL09-10-O04 AV797129;AV827064;AY045625 unknown protein
7 1 1 1 RAFL06-08-L09 AY059939 Experimental RAFL06-08-L09 AV784830;AV823779;AY059939 ribulose bisphosphate carboxylase small chain 2b precursor (RuBisCO small subunit 2b) (sp|P10797)
7 1 1 2 RAFL06-09-K19 AV823865 Experimental RAFL06-09-K19 AV784936;AV823865 adenine phosphoribosyltransferase 1, APRT
7 1 1 3 RAFL06-08-A17 BT002437 Experimental RAFL06-08-A17 AV784762;AV823729;BT002437 subtilisin proteinase like protein
7 1 1 4 RAFL06-07-P08 AY059937 Experimental RAFL06-07-P08 AV784752;AV823720;AY059937 putative mitogen-activated protein kinase, MAP Kinase 1
7 1 1 5 RAFL06-07-O03 AY062838 Experimental RAFL06-07-O03 AV784742;AV823716;AY062838 unknown protein
7 1 1 6 RAFL06-07-M15 AY062837 Experimental RAFL06-07-M15 AV784730;AV823709;AY062837 O-methyltransferase
7 1 1 7 RAFL06-11-P06 BT002432 Experimental RAFL06-11-P06 AV785122;AV824009;BT002432 putative phosphatidylinositol synthase
7 1 1 8 RAFL06-11-N09 AY062830 Experimental RAFL06-11-N09 AV785117;AV824004;AY062830 unknown protein
7 1 1 9 RAFL06-11-J19 BP561131 Experimental RAFL06-11-J19 AV785096;BP561131 Na+/H+ exchanger 5 (NHX5)
7 1 1 10 RAFL06-11-F23 AY059935 Experimental RAFL06-11-F23 AV785075;AV823975;AY059935
7 1 1 11 RAFL06-11-B17 AV823959 Experimental RAFL06-11-B17 AV785058;AV823959 hypothetical protein
7 1 1 12 RAFL06-10-H13 AY062828 Experimental RAFL06-10-H13 AV785018;AV823930;AY062828 allene oxide synthase (emb|CAA73184.1)
7 1 1 13 RAFL06-10-M04 AY128409 Experimental RAFL06-10-M04 AV785033;AV823941;AY128409 hydroxymethylglutaryl-CoA lyase like protein
7 1 1 14 RAFL06-10-F02 BT002062 Experimental RAFL06-10-F02 AV785003;AV823918;BT002062
7 1 2 1 RAFL06-15-I08 BP561190 Experimental RAFL06-15-I08 AV785359;BP561190
7 1 2 2 RAFL06-12-O20 AV824053 Experimental RAFL06-12-O20 AV785193;AV824053;AF410263 putative protein
7 1 2 3 RAFL06-15-L24 AV785377 Experimental RAFL06-15-L24 AV785377;AF410333 putative protein
7 1 2 4 RAFL06-15-J24 AV785368 Experimental RAFL06-15-J24 AV785368;AF410327 G10 - like protein
7 1 2 5 RAFL06-13-A08 AV824064 Experimental RAFL06-13-A08 AV785202;AV824064;AF410304 PsbS protein (PsbS)
7 1 2 6 RAFL06-12-M16 AV824047 Experimental RAFL06-12-M16 AV785182;AV824047;AF410295 60S acidic ribosomal protein P2
7 1 2 7 RAFL06-12-K03 AY094437 Experimental RAFL06-12-K03 AV785173;AV824041;AY094437 chlorophyll a/b-binding protein
7 1 2 8 RAFL06-16-I21 AV824249 Experimental RAFL06-16-I21 AV785460;AV824249;AF410277 putative expansin
7 1 2 9 RAFL06-09-F10 BP561106 Experimental RAFL06-09-F10 AV784896;BP561106
7 1 2 10 RAFL06-07-K18 AY065158 Experimental RAFL06-07-K18 AV784721;AV823701;AY065158 H+-transporting ATP synthase-like protein
7 1 2 11 RAFL06-07-J08 AY120780 Experimental RAFL06-07-J08 AV784709;AV823691;AY120780 unknown protein
7 1 2 12 RAFL06-08-O03 BP561097 Experimental RAFL06-08-O03 AV784854;BP561097 xanthine dehydrogenase - like protein
7 1 2 13 RAFL06-08-L12 AY093006 Experimental RAFL06-08-L12 AV784831;AV823780;AY093006 putative trans-prenyltransferase
7 1 2 14 RAFL06-08-I11 AY065156 Experimental RAFL06-08-I11 AV784812;AV823767;AY065156 unknown protein
7 1 3 1 RAFL06-13-G16 AV824087 Experimental RAFL06-13-G16 AV785233;AV824087;AF410307 unknown protein
7 1 3 2 RAFL06-13-E16 AV824077 Experimental RAFL06-13-E16 AV785223;AV824077;AF410292 unknown protein
7 1 3 3 RAFL06-13-A14 BP561154 Experimental RAFL06-13-A14 AV785205;BP561154;AF410282 sugar transporter like protein
7 1 3 4 RAFL06-12-P09 AV824055 Experimental RAFL06-12-P09 AV824055;AF410276 arabinogalactan-protein AGP16
7 1 3 5 RAFL06-16-A10 AV824213 Experimental RAFL06-16-A10 AV785408;AV824213;AF410335 fasciclin-like arabinogalactan protein FLA12
7 1 3 6 RAFL06-15-O21 AV824205 Experimental RAFL06-15-O21 AV785397;AV824205;AF410317 N-hydroxycinnamoyl/benzoyltransferase
7 1 3 7 RAFL06-13-G14 AV785232 Experimental RAFL06-13-G14 AV785232
7 1 3 8 RAFL06-13-E15 AV824076 Experimental RAFL06-13-E15 AV785222;AV824076;AF410300 unknown protein
7 1 3 9 RAFL06-15-I10 AV785360 Experimental RAFL06-15-I10 AV785360;AF410285 unknown protein
7 1 3 10 RAFL06-15-G08 AV785350 Experimental RAFL06-15-G08 AV785350;AF410269 unknown protein
7 1 3 11 RAFL06-15-P23 BP561196 Experimental RAFL06-15-P23 AV785407;BP561196;AF410334 putative protein
7 1 3 12 RAFL06-15-O20 AV785396 Experimental RAFL06-15-O20 AV785396;AF410321 carboxyltransferase alpha subunit (CAC3)
7 1 3 13 RAFL06-15-M02 AV824189 Experimental RAFL06-15-M02 AV785378;AV824189;AF410306
7 1 3 14 RAFL06-15-K04 AV824184 Experimental RAFL06-15-K04 AV785369;AV824184;AF410297 unknown protein
7 1 4 1 RAFL07-08-D21 AY050993 Experimental RAFL07-08-D21 AV790960;AV825314;AY050993 nucleotide sugar epimerase -like protein
7 1 4 2 RAFL07-08-G20 AY050990 Experimental RAFL07-08-G20 AV791009;AV825334;AY050990 unknown
7 1 4 3 RAFL07-08-P19 BT000783 Experimental RAFL07-08-P19 AV791131;AV825380;BT000783 putative Ta11-like non-LTR retroelement protein
7 1 4 4 RAFL07-08-M19 AY056261 Experimental RAFL07-08-M19 AV791093;AV825365;AY056261 putative leucyl-tRNA synthetase (At1g0962)
7 1 4 5 RAFL07-08-I19 AY074507 Experimental RAFL07-08-I19 AV791039;AV825346;AY074507 putative phosphatidylinositol-4-phosphate 5-kinase (At1g60890)
7 1 4 6 RAFL07-08-A19 BP561411 Experimental RAFL07-08-A19 AV790916;BP561411;AY059754 unknown protein
7 1 4 7 RAFL07-08-L15 AY056264 Experimental RAFL07-08-L15 AV791080;AV825359;AY056264 receptor kinase-like protein
7 1 4 8 RAFL07-08-N14 AY050902 Experimental RAFL07-08-N14 AV791102;AV825369;AY050902 glycolate oxidase - like protein
7 1 4 9 RAFL07-08-H14 AY059777 Experimental RAFL07-08-H14 AV791020;AV825338;AY059777 unknown protein
7 1 4 10 RAFL07-08-E14 AV825322 Experimental RAFL07-08-E14 AV790975;AV825322 FtsH like cell division protein
7 1 4 11 RAFL07-08-A14 BP561410 Experimental RAFL07-08-A14 AV790911;BP561410;AY050985 unknown protein
7 1 4 12 RAFL07-08-M13 AY056215 Experimental RAFL07-08-M13 AV791089;AY056215 unknown protein
7 1 4 13 RAFL06-13-K16 AV824112 Experimental RAFL06-13-K16 AV785261;AV824112;AF410336 unknown protein
7 1 4 14 RAFL06-15-O23 AV824206 Experimental RAFL06-15-O23 AV785398;AV824206;AF410319 polygalacturonase PG1, putative
7 1 5 1 RAFL07-12-J16 BT002060 Experimental RAFL07-12-J16 AV791919;BT002060 SAR DNA-binding protein - like
7 1 5 2 RAFL07-12-N15 AY062470 Experimental RAFL07-12-N15 AV791980;AY062470 CDC27/NUC2-like protein
7 1 5 3 RAFL07-09-B11 BP561427 Experimental RAFL07-09-B11 AV791147;BP561427;AY056267 putative protein
7 1 5 4 RAFL07-09-G10 AY056133 Experimental RAFL07-09-G10 AV791208;AY056133 unknown protein
7 1 5 5 RAFL07-09-P08 AY050886 Experimental RAFL07-09-P08 AV791308;AV825451;AY050886 putative auxin-independent growth promoter (At1g76270)
7 1 5 6 RAFL07-09-K08 AY059744 Experimental RAFL07-09-K08 AV791252;AV825424;AY059744 putative protein
7 1 5 7 RAFL07-09-O07 AY059732 Experimental RAFL07-09-O07 AV791297;AV825446;AY059732 putative expansin precursor
7 1 5 8 RAFL07-09-N06 BT000781 Experimental RAFL07-09-N06 AV791286;AV825439;BT000781 H+-transporting ATPase type 2, plasma membrane
7 1 5 9 RAFL07-09-J02 BT000696 Experimental RAFL07-09-J02 AV791238;AV825417;BT000696 endo-beta-1,4-glucanase, putative
7 1 5 10 RAFL07-09-H02 AY050903 Experimental RAFL07-09-H02 AV791217;AV825409;AY050903 unknown protein
7 1 5 11 RAFL07-09-F02 AY050883 Experimental RAFL07-09-F02 AV791192;AV825399;AY050883 unknown protein
7 1 5 12 RAFL07-09-L01 AY050783 Experimental RAFL07-09-L01 AV791259;AV825428;AY050783 S-adenosyl-L-homocysteinas, putative
7 1 5 13 RAFL07-09-I01 AY074374 Experimental RAFL07-09-I01 AV791229;AV825413;AY074374 2-oxoglutarate dehydrogenase, E1 component
7 1 5 14 RAFL07-09-B01 AY050803 Experimental RAFL07-09-B01 AV791144;AY050803 ribosomal protein S6 - like
7 1 6 1 RAFL07-13-G11 AV792096 Experimental RAFL07-13-G11 AV792096 unknown protein
7 1 6 2 RAFL07-13-D10 AY081303 Experimental RAFL07-13-D10 AV792054;AY081303 unknown protein
7 1 6 3 RAFL07-13-L09 AY128383 Experimental RAFL07-13-L09 AV792166;AY128383 putative protein
7 1 6 4 RAFL07-13-O08 AY062490 Experimental RAFL07-13-O08 AV792198;AY062490 unknown protein
7 1 6 5 RAFL07-13-F01 AY062488 Experimental RAFL07-13-F01 AV792079;AV825715;AY062488 purple acid phosphatase-like protein
7 1 6 6 RAFL07-12-G24 AV825660 Experimental RAFL07-12-G24 AV791881;AV825660 brassinosteroid insensitive 1 gene (BRI1)
7 1 6 7 RAFL07-12-K23 AY081312 Experimental RAFL07-12-K23 AV791941;AY081312 unknown protein
7 1 6 8 RAFL07-12-J22 AV791923 Experimental RAFL07-12-J22 AV791923 putative protein
7 1 6 9 RAFL07-12-D22 AV791839 Experimental RAFL07-12-D22 AV791839 putative protein
7 1 6 10 RAFL07-12-B22 AY062479 Experimental RAFL07-12-B22 AV791812;AY062479 putative thioredoxin reductase
7 1 6 11 RAFL07-12-O17 AY059846 Experimental RAFL07-12-O17 AV791999;AV825698;AY059846 unknown protein
7 1 6 12 RAFL07-12-F17 AV825658 Experimental RAFL07-12-F17 AV791864;AV825658
7 1 6 13 RAFL07-12-C17 AV791821 Experimental RAFL07-12-C17 AV791821 cytochrome P450 - like protein
7 1 6 14 RAFL07-12-N16 AY062471 Experimental RAFL07-12-N16 AV791981;AY062471 putative DNA repair protein
7 1 7 1 RAFL07-18-C05 AV825968 Experimental RAFL07-18-C05 AV793105;AV825968
7 1 7 2 RAFL07-18-N04 AY049277 Experimental RAFL07-18-N04 AV793281;AV826015;AY049277 UTP-glucose glucosyltransferase - like protein
7 1 7 3 RAFL07-18-N03 BP561517 Experimental RAFL07-18-N03 AV793280;BP561517;AY065014 putative protein
7 1 7 4 RAFL07-18-J03 AY049260 Experimental RAFL07-18-J03 AV793220;AV825998;AY049260 NAD+ dependent isocitrate dehydrogenase subunit 1
7 1 7 5 RAFL07-18-F03 AY049248 Experimental RAFL07-18-F03 AV793157;AV825986;AY049248 unknown protein
7 1 7 6 RAFL07-18-C02 AY049240 Experimental RAFL07-18-C02 AV793103;AV825967;AY049240 unknown protein
7 1 7 7 RAFL07-13-O20 AY059850 Experimental RAFL07-13-O20 AV792205;AV825739;AY059850 putative casein kinase I
7 1 7 8 RAFL07-13-F20 AY054501 Experimental RAFL07-13-F20 AV792089;AV825717;AY054501 putative protein
7 1 7 9 RAFL07-13-C20 AY062498 Experimental RAFL07-13-C20 AV792046;AY062498 unknown protein
7 1 7 10 RAFL07-13-A19 AV792024 Experimental RAFL07-13-A19 AV792024 putative cryptochrome 2 apoprotein
7 1 7 11 RAFL07-13-I18 AV792124 Experimental RAFL07-13-I18 AV792124 unknown protein
7 1 7 12 RAFL07-13-F17 AV792087 Experimental RAFL07-13-F17 AV792087 putative receptor protein kinase (F13J11.14/At2g13790)
7 1 7 13 RAFL07-13-N13 BP561469 Experimental RAFL07-13-N13 AV792188;BP561469;AY120752 transcription factor MYC7E, putative bHLH transcription factor (AtbHLH013)
7 1 7 14 RAFL07-13-E13 AY062649 Experimental RAFL07-13-E13 AV792072;AV825712;AY062649 Unknown protein (At3g04140; T6K12.24)
7 1 8 1 RAFL07-18-H21 AY065003 Experimental RAFL07-18-H21 AV793202;AV825994;AY065003 unknown protein
7 1 8 2 RAFL07-18-A21 AY049241 Experimental RAFL07-18-A21 AV793086;AV825962;AY049241 putative protein
7 1 8 3 RAFL07-18-A18 AY049283 Experimental RAFL07-18-A18 AV793084;AV825960;AY049283 unknown protein
7 1 8 4 RAFL07-18-O17 AY049268 Experimental RAFL07-18-O17 AV793310;AV826023;AY049268 putative protein
7 1 8 5 RAFL07-18-H17 AY049265 Experimental RAFL07-18-H17 AV793200;AV825993;AY049265 ADPG pyrophosphorylase small subunit (gb|AAC39441.1)
7 1 8 6 RAFL07-18-D17 AV825979 Experimental RAFL07-18-D17 AV793132;AV825979 putative transport protein
7 1 8 7 RAFL07-18-K16 AV826006 Experimental RAFL07-18-K16 AV793243;AV826006 putative protein
7 1 8 8 RAFL07-18-E16 AY139750 Experimental RAFL07-18-E16 AV793148;AV825982;AY139750 putative protein
7 1 8 9 RAFL07-18-C13 AY049284 Experimental RAFL07-18-C13 AV793112;AV825971;AY049284 unknown protein (At1g31070)
7 1 8 10 RAFL07-18-D12 AV825977 Experimental RAFL07-18-D12 AV793129;AV825977;AF462854 phosphatidylinositol 4-kinase (emb|CAB37928.1)
7 1 8 11 RAFL07-18-C11 AY049262 Experimental RAFL07-18-C11 AV793110;AV825970;AY049262
7 1 8 12 RAFL07-18-N10 AV826018 Experimental RAFL07-18-N10 AV793287;AV826018;AF462849 putative branched-chain amino acid aminotransferase
7 1 8 13 RAFL07-18-A10 AY049252 Experimental RAFL07-18-A10 AV793079;AV825959;AY049252 putative glutamate/ornithine acetyltransferase
7 1 8 14 RAFL07-18-L09 AV826009 Experimental RAFL07-18-L09 AV793256;AV826009
7 1 9 1 RAFL08-12-J10 AY050972 Experimental RAFL08-12-J10 AV794375;AV826315;AY050972 unknown protein
7 1 9 2 RAFL08-12-D10 AY050938 Experimental RAFL08-12-D10 AV794281;AV826290;AY050938
7 1 9 3 RAFL08-12-K09 AY050927 Experimental RAFL08-12-K09 AV794387;AV826320;AY050927
7 1 9 4 RAFL08-12-N08 AY050818 Experimental RAFL08-12-N08 AV794430;AV826332;AY050818 putative spore coat protein
7 1 9 5 RAFL08-12-D05 AY063947 Experimental RAFL08-12-D05 AV794278;AV826288;AY063947
7 1 9 6 RAFL08-12-K04 AY050950 Experimental RAFL08-12-K04 AV794384;AV826318;AY050950 putative protein
7 1 9 7 RAFL08-12-F04 AY056331 Experimental RAFL08-12-F04 AV794306;AV826297;AY056331 plastid division protein FtsZ-like
7 1 9 8 RAFL08-12-D04 AY050937 Experimental RAFL08-12-D04 AV794277;AV826287;AY050937 unknown protein
7 1 9 9 RAFL08-12-K03 AY050836 Experimental RAFL08-12-K03 AV794383;AY050836 putative leucine-rich repeat disease resistance protein
7 1 9 10 RAFL08-12-E03 AY050922 Experimental RAFL08-12-E03 AV794289;AV826292;AY050922 unknown protein
7 1 9 11 RAFL07-18-H24 AV825995 Experimental RAFL07-18-H24 AV793203;AV825995 putative mitogen activated protein kinase kinase
7 1 9 12 RAFL07-18-C24 AY049276 Experimental RAFL07-18-C24 AV793119;AV825974;AY049276 unknown protein
7 1 9 13 RAFL07-18-E23 AY065012 Experimental RAFL07-18-E23 AV793154;AV825984;AY065012 hypothetical protein
7 1 9 14 RAFL07-18-N21 AY065006 Experimental RAFL07-18-N21 AV793293;AV826020;AY065006 unknown protein
7 1 10 1 RAFL08-13-I04 AY056187 Experimental RAFL08-13-I04 AV794586;AV826363;AY056187 root cap 1 (RCP1)
7 1 10 2 RAFL08-13-B04 BP561576 Experimental RAFL08-13-B04 AV794482;BP561576;AY056156 Pto kinase interactor - like protein
7 1 10 3 RAFL08-13-A03 BT000805 Experimental RAFL08-13-A03 AV794465;AV826342;BT000805 putative tetracycline resistance efflux protein
7 1 10 4 RAFL08-13-A02 AY050844 Experimental RAFL08-13-A02 AV794464;AY050844 chloroplast division protein AtFtsZ2-1 (AtFtsZ2-1)
7 1 10 5 RAFL08-13-C01 AY056281 Experimental RAFL08-13-C01 AV794494;AV826348;AY056281 WD40-repeat protein
7 1 10 6 RAFL08-12-J24 AV794381 Experimental RAFL08-12-J24 AV794381
7 1 10 7 RAFL08-12-E19 AY056186 Experimental RAFL08-12-E19 AV794300;AV826295;AY056186 peroxidase (emb|CAA68212.1)
7 1 10 8 RAFL08-12-F18 AY050913 Experimental RAFL08-12-F18 AV794312;AV826299;AY050913 6,7-dimethyl-8-ribityllumazine synthase precursor
7 1 10 9 RAFL08-12-C18 AY056163 Experimental RAFL08-12-C18 AV794268;AV826282;AY056163 xyloglucan endo-transglycosylase
7 1 10 10 RAFL08-12-J17 AY050939 Experimental RAFL08-12-J17 AV794377;AV826316;AY050939 ubiquinone/menaquinone biosynthesis methyltransferase-like
7 1 10 11 RAFL08-12-O16 AY050833 Experimental RAFL08-12-O16 AV794448;AV826337;AY050833 putative pseudouridine synthase (NAP57)
7 1 10 12 RAFL08-12-N15 AY050820 Experimental RAFL08-12-N15 AV794433;AV826333;AY050820 putative phosphoribosylglycinamide synthetase
7 1 10 13 RAFL08-12-D11 BP561565 Experimental RAFL08-12-D11 AV794282;BP561565 putative katanin
7 1 10 14 RAFL08-12-M10 AY063910 Experimental RAFL08-12-M10 AV794417;AV826329;AY063910 putative mudrA protein
7 1 11 1 RAFL08-19-M03 BT002383 Experimental RAFL08-19-M03 AV795917;BP561640;BT002383 unknown protein
7 1 11 2 RAFL08-19-K02 AY059898 Experimental RAFL08-19-K02 AV795887;AV826632;AY059898 unknown protein
7 1 11 3 RAFL08-18-N19 AY062726 Experimental RAFL08-18-N19 AV795726;AV826607;AY062726 arabinogalactan-protein AGP2
7 1 11 4 RAFL08-18-K18 AY062725 Experimental RAFL08-18-K18 AV795675;AV826599;AY062725 putative cysteine proteinase RD21A precursor
7 1 11 5 RAFL08-18-K17 AV795674 Experimental RAFL08-18-K17 AV795674 unknown protein
7 1 11 6 RAFL08-18-F17 BT002399 Experimental RAFL08-18-F17 AV795607;BT002399
7 1 11 7 RAFL08-18-K16 BP561634 Experimental RAFL08-18-K16 AV795673;BP561634;AY062724
7 1 11 8 RAFL08-18-K15 AY062723 Experimental RAFL08-18-K15 AV795672;AV826598;AY062723 transcription factor IIA large subunit
7 1 11 9 RAFL08-18-L11 AY059892 Experimental RAFL08-18-L11 AV795685;AV826602;AY059892 beta-galactosidase like protein
7 1 11 10 RAFL08-18-B11 BP561629 Experimental RAFL08-18-B11 AV795543;BP561629;AY120760 heat shock transcription factor HSF4
7 1 11 11 RAFL08-18-I10 AY062716 Experimental RAFL08-18-I10 AV795646;AV826590;AY062716 beta-D-glucan exohydrolase - like protein
7 1 11 12 RAFL08-18-A10 AY062586 Experimental RAFL08-18-A10 AV795527;AY062586 similar to MURA transposase of maize Mutator transposon
7 1 11 13 RAFL08-18-J09 AY059891 Experimental RAFL08-18-J09 AV795658;AV826593;AY059891 unknown protein
7 1 11 14 RAFL08-18-A09 BT002402 Experimental RAFL08-18-A09 AV795526;AV826562;BT002402 unknown protein
7 1 12 5 RAFL08-19-C17 AY062606 Experimental RAFL08-19-C17 AV795797;AY062606 unknown protein
7 1 12 6 RAFL08-19-O15 AY062744 Experimental RAFL08-19-O15 AV795948;AY062744 putative vacuolar sorting receptor
7 1 12 7 RAFL08-19-G15 AY062743 Experimental RAFL08-19-G15 AV795843;AV826623;AY062743 putative glucosyl transferase
7 1 12 8 RAFL08-19-L12 AY062604 Experimental RAFL08-19-L12 AV795909;AV826633;AY062604 Unknown protein (At2g01540; F2I9.16)
7 1 12 9 RAFL08-19-M11 AY062741 Experimental RAFL08-19-M11 AV795922;AY062741 putative protein
7 1 12 10 RAFL08-19-G11 AY062740 Experimental RAFL08-19-G11 AV795841;AY062740 unknown protein
7 1 12 11 RAFL08-19-P05 AY062596 Experimental RAFL08-19-P05 AV795955;AV826643;AY062596
7 1 12 12 RAFL08-19-A05 AY062595 Experimental RAFL08-19-A05 AV795758;AV826612;AY062595 reticuline oxidase - like protein
7 1 12 13 RAFL08-19-M04 AV826635 Experimental RAFL08-19-M04 AV795918;AV826635 NAC domain protein, putative
7 1 12 14 RAFL08-19-D04 AY062734 Experimental RAFL08-19-D04 AV795800;AV826616;AY062734 malate oxidoreductase (malic enzyme)
7 1 13 1 RAFL09-09-N03 BP561678 Experimental RAFL09-09-N03 AV796853;BP561678;AF462825 unknown protein
7 1 13 2 RAFL09-09-K03 BP561675 Experimental RAFL09-09-K03 AV796796;BP561675;AF462824 putative protein
7 1 13 3 RAFL09-09-I03 AV826909 Experimental RAFL09-09-I03 AV796759;AV826909 eukaryotic initiation factor 4, eIF4-like protein
7 1 13 4 RAFL09-09-G03 AY090351 Experimental RAFL09-09-G03 AV796722;AY090351 hypothetical protein
7 1 13 5 RAFL09-09-M02 AY128281 Experimental RAFL09-09-M02 AV796833;AV826939;AY128281 chloroplast NAD-dependent malate dehydrogenase
7 1 13 6 RAFL09-09-G02 BP561674 Experimental RAFL09-09-G02 AV796721;BP561674 isp4 like protein
7 1 14 1 RAFL09-12-F06 AV827193 Experimental RAFL09-12-F06 AV797492;AV827193;AF361623 NAM-like protein (no apical meristem)
7 1 14 2 RAFL09-12-O05 AV827244 Experimental RAFL09-12-O05 AV797636;AV827244;AF367296 unknown protein
7 1 14 3 RAFL09-12-F03 AV827192 Experimental RAFL09-12-F03 AV797490;AV827192;AF367328 putative bHLH transcription factor (bHLH059)
7 1 14 4 RAFL09-12-N02 AV827239 Experimental RAFL09-12-N02 AV797614;AV827239;AF361615 unknown protein
7 1 14 5 RAFL09-12-K02 AV827220 Experimental RAFL09-12-K02 AV797561;AV827220;AF367307 chloroplast cyclophilin ROC8
7 1 14 6 RAFL09-12-B02 AY065067 Experimental RAFL09-12-B02 AV797421;AV827166;AY065067 purple acid phosphatase precursor
7 1 14 7 RAFL09-12-K01 AV827219 Experimental RAFL09-12-K01 AV797560;AV827219;AF361624 acidic ribosomal protein p1
7 1 14 8 RAFL09-11-I24 AV797299 Experimental RAFL09-11-I24 AV797299;AF367299 methyltransferase, putative
7 1 14 9 RAFL09-09-J07 AV826922 Experimental RAFL09-09-J07 AV796780;AV826922
7 1 14 10 RAFL09-09-E07 BP561671 Experimental RAFL09-09-E07 AV796691;BP561671 unknown protein
7 1 14 11 RAFL09-09-P06 AV826964 Experimental RAFL09-09-P06 AV796886;AV826964 phenylalanine ammonia-lyase
7 1 14 12 RAFL09-09-N06 AV826952 Experimental RAFL09-09-N06 AV796854;AV826952 putative pre-mRNA splicing factor RNA helicase
7 1 14 13 RAFL09-09-H06 AY090350 Experimental RAFL09-09-H06 AV796744;AV826902;AY090350 putative beta-glucosidase
7 1 14 14 RAFL09-09-B06 AY139752 Experimental RAFL09-09-B06 AV796636;AV826864;AY139752 putative protein
7 2 1 1 RAFL06-07-B19 AY074368 Experimental RAFL06-07-B19 AV784656;AV823651;AY074368 protein phosphatase 2C (PP2C)
7 2 1 2 RAFL06-07-D07 BT000659 Experimental RAFL06-07-D07 AV784666;AV823659;BT000659 small Ras-like GTP-binding protein
7 2 1 3 RAFL06-07-E23 AV823667 Experimental RAFL06-07-E23 AV784676;AV823667 vesicle-associated membrane protein 7C (At VAMP7C)
7 2 1 4 RAFL06-07-A07 AY045819 Experimental RAFL06-07-A07 AV784646;AV823642;AY045819 protein phosphatase 2C-like
7 2 1 5 RAFL06-07-D01 AY045994 Experimental RAFL06-07-D01 AV784664;AV823657;AY045994 60S ribosomal protein L7
7 2 1 6 RAFL06-07-E13 AY080788 Experimental RAFL06-07-E13 AV784674;AY080788 phosphate/phosphoenolpyruvate translocator precursor
7 2 1 7 RAFL05-21-N24 AV823622 Experimental RAFL05-21-N24 AV784625;AV823622 amino acid transporter-like protein 2 (AATL2)
7 2 1 8 RAFL05-21-L22 AV823609 Experimental RAFL05-21-L22 AV784612;AV823609
7 2 1 9 RAFL05-21-J21 AY080776 Experimental RAFL05-21-J21 AV784597;AV823595;AY080776 putative protein
7 2 1 10 RAFL05-21-G18 AY080769 Experimental RAFL05-21-G18 AV784583;AV823586;AY080769 unknown protein (At1g55280)
7 2 1 11 RAFL05-21-G14 AY096499 Experimental RAFL05-21-G14 AV784580;AV823584;AY096499 cytochrome P450 - like protein
7 2 1 12 RAFL05-21-G10 AY080787 Experimental RAFL05-21-G10 AV823582;AY080787 enoyl-CoA hydratase like protein
7 2 1 13 RAFL05-20-O24 BP561036 Experimental RAFL05-20-O24 AV784533;BP561036;AY080885 unknown protein
7 2 1 14 RAFL05-21-L24 AV823610 Experimental RAFL05-21-L24 AV784613;AV823610
7 2 2 1 RAFL06-08-F22 AY059943 Experimental RAFL06-08-F22 AV784797;AV823758;AY059943 GTP-binding protein typA (tyrosine phosphorylated protein A)
7 2 2 2 RAFL06-08-D06 AV823742 Experimental RAFL06-08-D06 AV784778;AV823742 putative pyruvate dehydrogenase E1 beta subunit
7 2 2 3 RAFL06-07-H01 AY062850 Experimental RAFL06-07-H01 AV784693;AV823679;AY062850 unknown protein
7 2 2 4 RAFL06-08-M13 BT002423 Experimental RAFL06-08-M13 AV784837;AV823785;BT002423 elongation factor 1-alpha
7 2 2 5 RAFL06-08-H20 AY062847 Experimental RAFL06-08-H20 AV784806;AV823763;AY062847 RAP2.6 (At1g43160)
7 2 2 6 RAFL06-09-L23 AY059942 Experimental RAFL06-09-L23 AV784941;AV823870;AY059942 putative UDP-galactose transporter MSS4
7 2 2 7 RAFL06-08-B20 AV823734 Experimental RAFL06-08-B20 AV784768;AV823734 ferredoxin-NADP+ reductase
7 2 2 8 RAFL06-08-A07 AY065161 Experimental RAFL06-08-A07 AV784759;AV823726;AY065161 unknown protein
7 2 2 9 RAFL06-07-E12 AV823665 Experimental RAFL06-07-E12 AV784673;AV823665 putative protein
7 2 2 10 RAFL06-07-E11 AY080872 Experimental RAFL06-07-E11 AV784672;AV823664;AY080872 putative protein
7 2 2 11 RAFL06-07-B07 BT000723 Experimental RAFL06-07-B07 AV784652;AV823647;BT000723 salt stress inducible small GTP binding protein Ran1 homolog
7 2 2 12 RAFL06-07-E06 AY050788 Experimental RAFL06-07-E06 AV784671;AV823663;AY050788 unknown protein
7 2 2 13 RAFL06-07-B05 BP561056 Experimental RAFL06-07-B05 AV784651;BP561056;AY045996 remorin
7 2 2 14 RAFL06-07-E03 AY045961 Experimental RAFL06-07-E03 AV784670;AV823662;AY045961 unknown protein
7 2 3 1 RAFL06-09-N04 BP561111 Experimental RAFL06-09-N04 AV784948;BP561111;AY059952 unknown protein
7 2 3 2 RAFL06-09-M19 AY065183 Experimental RAFL06-09-M19 AV784947;AV823875;AY065183 sugar transporter like protein
7 2 3 3 RAFL06-09-M18 AY062866 Experimental RAFL06-09-M18 AV784946;AV823874;AY062866 Unknown protein (At3g04680; F7O18.15)
7 2 3 4 RAFL06-09-O09 AY093013 Experimental RAFL06-09-O09 AV784955;AY093013 unknown protein
7 2 3 5 RAFL06-09-J06 AY065177 Experimental RAFL06-09-J06 AV784926;AY065177 putative heat-shock protein (At1g79920)
7 2 3 6 RAFL06-09-G02 AY062861 Experimental RAFL06-09-G02 AV784904;AV823839;AY062861 unknown protein
7 2 3 7 RAFL06-09-A21 AY093011 Experimental RAFL06-09-A21 AV784872;AV823814;AY093011 20S proteasome beta subunit PBB2
7 2 3 8 RAFL06-08-P09 AY062860 Experimental RAFL06-08-P09 AV784862;AV823807;AY062860 26S proteasome ATPase subunit
7 2 3 9 RAFL06-08-N18 AY093009 Experimental RAFL06-08-N18 AV784851;AV823798;AY093009 FKBP-type peptidyl-prolyl cis-trans isomerases, putative
7 2 3 10 RAFL06-08-M19 AY059948 Experimental RAFL06-08-M19 AV784839;AV823787;AY059948 water channel - like protein
7 2 3 11 RAFL06-07-K05 AY062856 Experimental RAFL06-07-K05 AV784717;AV823697;AY062856 unknown protein
7 2 3 12 RAFL06-08-P08 AY062855 Experimental RAFL06-08-P08 AV784861;AV823806;AY062855 putative ribosomal protein
7 2 3 13 RAFL06-08-N17 AV823797 Experimental RAFL06-08-N17 AV784850;AV823797 eukaryotic protein synthesis initiation factor 4A
7 2 3 14 RAFL06-08-M17 AY065168 Experimental RAFL06-08-M17 AV784838;AV823786;AY065168 unknown protein (At1g71010)
7 2 4 1 RAFL06-16-N17 AV824273 Experimental RAFL06-16-N17 AV785493;AV824273
7 2 4 2 RAFL06-16-P04 AY094448 Experimental RAFL06-16-P04 AV785503;AV824278;AY094448 putative LIM-domain protein
7 2 4 3 RAFL06-16-L20 AV785482 Experimental RAFL06-16-L20 AV785482 putative protein
7 2 4 4 RAFL06-16-N13 AY090364 Experimental RAFL06-16-N13 AV785491;AV824271;AY090364 unknown protein
7 2 4 5 RAFL06-16-N12 AY127014 Experimental RAFL06-16-N12 AV785490;AV824270;AY127014 chloroplast import-associated channel protein homolog
7 2 4 6 RAFL06-16-L14 AY090359 Experimental RAFL06-16-L14 AV785480;AV824263;AY090359 60S ribosomal protein L13a
7 2 4 7 RAFL06-15-O10 AY125519 Experimental RAFL06-15-O10 AV785392;AV824201;AY125519 putative beta-hydroxyacyl-ACP dehydratase
7 2 4 8 RAFL06-15-N08 AV824194 Experimental RAFL06-15-N08 AV785385;AV824194 unknown protein
7 2 4 9 RAFL06-15-L15 BP561192 Experimental RAFL06-15-L15 AV785374;BP561192 dnaJ protein homolog atj3
7 2 4 10 RAFL06-13-B05 AY094447 Experimental RAFL06-13-B05 AV785209;AV824069;AY094447 putative protein kinase
7 2 4 11 RAFL06-12-P20 AV824060 Experimental RAFL06-12-P20 AV785199;AV824060 hypothetical protein
7 2 4 12 RAFL06-15-C16 AV824164 Experimental RAFL06-15-C16 AV785335;AV824164 putative protein
7 2 4 13 RAFL06-09-N13 BP561112 Experimental RAFL06-09-N13 AV784951;BP561112;AY120786 putative coatomer complex subunit
7 2 4 14 RAFL06-09-N10 AY120784 Experimental RAFL06-09-N10 AV784949;AV823876;AY120784 histone deacetylase - like
7 2 5 1 RAFL07-10-M14 AY045892 Experimental RAFL07-10-M14 AV791501;AV825545;AY045892 putative protein
7 2 5 2 RAFL07-10-P13 AY057581 Experimental RAFL07-10-P13 AV791550;AV825562;AY057581 putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase
7 2 5 11 RAFL06-16-P21 AY075602 Experimental RAFL06-16-P21 AV785510;AV824282;AY075602 unknown protein
7 2 5 12 RAFL06-16-N09 AY090365 Experimental RAFL06-16-N09 AV785489;AV824269;AY090365 unknown protein
7 2 5 13 RAFL06-16-P20 AY075601 Experimental RAFL06-16-P20 AV785509;AV824281;AY075601
7 2 5 14 RAFL06-16-P19 AY075599 Experimental RAFL06-16-P19 AV785508;AV824280;AY075599 putative protein
7 2 6 1 RAFL07-11-C06 AY050884 Experimental RAFL07-11-C06 AV791583;AV825571;AY050884 unknown protein
7 2 6 2 RAFL07-11-I04 AY045875 Experimental RAFL07-11-I04 AV791663;AY045875 putative protein
7 2 6 3 RAFL07-11-B03 AV825567 Experimental RAFL07-11-B03 AV791568;AV825567 scarecrow-like 13 (SCL13)
7 2 6 4 RAFL07-11-D02 AY063821 Experimental RAFL07-11-D02 AV791598;AV825573;AY063821 Mg-chelatase like protein
7 2 6 5 RAFL07-10-M22 AY050801 Experimental RAFL07-10-M22 AV791507;AV825549;AY050801 unknown protein
7 2 6 6 RAFL07-10-G22 AY056132 Experimental RAFL07-10-G22 AV791418;AV825502;AY056132
7 2 6 7 RAFL07-10-A22 AY050881 Experimental RAFL07-10-A22 AV791329;AV825458;AY050881 putative protein phosphatase
7 2 6 8 RAFL07-10-L21 AY045873 Experimental RAFL07-10-L21 AV791490;AV825540;AY045873 SIR2-family protein
7 2 6 9 RAFL07-10-H21 AY045893 Experimental RAFL07-10-H21 AV791430;AV825508;AY045893 2-oxoglutarate/malate translocator
7 2 6 10 RAFL07-10-A21 AY059755 Experimental RAFL07-10-A21 AV791328;AV825457;AY059755 putative membrane related protein CP5 (At1g55960)
7 2 6 11 RAFL07-10-H16 AY059762 Experimental RAFL07-10-H16 AV791428;AY059762 unknown protein
7 2 6 12 RAFL07-10-F16 BT000702 Experimental RAFL07-10-F16 AV791394;AV825490;BT000702 putative acetyltransferase
7 2 6 13 RAFL07-10-C16 AY059778 Experimental RAFL07-10-C16 AV791347;AV825464;AY059778 unknown protein
7 2 6 14 RAFL07-10-I15 BT000666 Experimental RAFL07-10-I15 AV791442;AV825516;BT000666 putative protein
7 2 7 1 RAFL07-15-E13 AY054504 Experimental RAFL07-15-E13 AV792489;AV825812;AY054504 Unknown protein
7 2 7 2 RAFL07-15-I12 AV825831 Experimental RAFL07-15-I12 AV792546;AV825831 eukaryotic translation initiation factor 3 delta subunit
7 2 7 3 RAFL07-15-P11 BP561487 Experimental RAFL07-15-P11 AV792638;BP561487 unknown protein
7 2 7 4 RAFL07-15-P10 AV825853 Experimental RAFL07-15-P10 AV792637;AV825853 hypothetical protein
7 2 7 5 RAFL07-15-H10 AY062503 Experimental RAFL07-15-H10 AV792533;AV825827;AY062503
7 2 7 6 RAFL07-15-D10 AY059851 Experimental RAFL07-15-D10 AV792473;AV825808;AY059851 unknown protein
7 2 7 7 RAFL07-11-G22 AY059763 Experimental RAFL07-11-G22 AV791649;AV825586;AY059763
7 2 7 8 RAFL07-11-D20 BT000665 Experimental RAFL07-11-D20 AV791608;AV825576;BT000665 putative protein
7 2 7 9 RAFL07-11-E19 AY050887 Experimental RAFL07-11-E19 AV791621;AV825579;AY050887 putative protein
7 2 7 10 RAFL07-11-E17 AY045876 Experimental RAFL07-11-E17 AV791619;AV825578;AY045876 Unknown protein (F24O1.10)
7 2 7 11 RAFL07-11-F16 AY080840 Experimental RAFL07-11-F16 AV791631;AV825582;AY080840 SCARECROW1
7 2 7 12 RAFL07-11-C16 AY056207 Experimental RAFL07-11-C16 AV791591;AV825572;AY056207 unknown protein
7 2 7 13 RAFL07-11-H07 BP561451 Experimental RAFL07-11-H07 AV791653;BP561451;AY050805 protein phosphatase 2C like protein
7 2 7 14 RAFL07-11-B07 AY064010 Experimental RAFL07-11-B07 AV791570;AV825568;AY064010 ubiquitin carboxyl-terminal hydrolase like protein
7 2 8 1 RAFL07-16-A17 AY059859 Experimental RAFL07-16-A17 AV792652;AV825854;AY059859 40S ribosomal protein S28 (sp|P34789)
7 2 8 2 RAFL07-16-C15 AY059858 Experimental RAFL07-16-C15 AV792682;AY059858 cellulose synthase catalytic subunit (Ath-A)
7 2 8 3 RAFL07-16-D07 AY062656 Experimental RAFL07-16-D07 AV792692;AY062656 beta-D-glucan exohydrolase-like protein
7 2 8 4 RAFL07-16-A05 AY128386 Experimental RAFL07-16-A05 AV792644;AY128386 putative DNA-binding protein
7 2 8 5 RAFL07-16-F02 AY062520 Experimental RAFL07-16-F02 AV792718;AY062520 serine/threonine specific protein kinase -like
7 2 8 6 RAFL07-16-C01 AY081306 Experimental RAFL07-16-C01 AV792671;AY081306 unknown protein
7 2 8 7 RAFL07-15-K24 AV825840 Experimental RAFL07-15-K24 AV792582;AV825840 putative potassium transport protein
7 2 8 8 RAFL07-15-C24 AY062655 Experimental RAFL07-15-C24 AV792466;AV825805;AY062655 diacylglycerol kinase
7 2 8 9 RAFL07-15-H18 AY128384 Experimental RAFL07-15-H18 AV792536;AY128384 putative protein
7 2 8 10 RAFL07-15-E18 AY062510 Experimental RAFL07-15-E18 AV792492;AV825814;AY062510 unknown protein
7 2 8 11 RAFL07-15-G17 AV792520 Experimental RAFL07-15-G17 AV792520
7 2 8 12 RAFL07-15-D17 AY054505 Experimental RAFL07-15-D17 AV792478;AV825810;AY054505 unknown protein
7 2 8 13 RAFL07-15-L16 AY062509 Experimental RAFL07-15-L16 AV792590;AY062509 Unknown protein (F6I1.13)
7 2 8 14 RAFL07-15-E16 BT002056 Experimental RAFL07-15-E16 AV792490;BT002056 eukaryotic initiation factor 4, eIF4-like protein
7 2 9 1 RAFL08-10-G02 AY048276 Experimental RAFL08-10-G02 AV793820;AY048276 calmodulin 1 (CAM1)
7 2 9 2 RAFL08-10-E01 AV826152 Experimental RAFL08-10-E01 AV793793;AV826152
7 2 9 3 RAFL08-09-C24 AY075647 Experimental RAFL08-09-C24 AV793555;AY075647 putative disease resistance protein
7 2 9 4 RAFL08-09-F23 BP561529 Experimental RAFL08-09-F23 AV793592;BP561529;AY049229 unknown protein
7 2 9 5 RAFL08-09-G19 AY048292 Experimental RAFL08-09-G19 AV793607;AV826108;AY048292 unknown protein
7 2 9 6 RAFL08-09-L17 AY048288 Experimental RAFL08-09-L17 AV793680;AV826132;AY048288 unknown protein
7 2 9 7 RAFL08-09-H17 AY048275 Experimental RAFL08-09-H17 AV793623;AV826113;AY048275 elongation factor 1-alpha
7 2 9 8 RAFL08-09-N16 AY048266 Experimental RAFL08-09-N16 AV793705;AV826139;AY048266 hypothetical protein
7 2 9 9 RAFL08-09-D16 AY048249 Experimental RAFL08-09-D16 AV793564;AV826097;AY048249 unknown protein
7 2 9 10 RAFL08-09-K15 AY048243 Experimental RAFL08-09-K15 AV793667;AV826128;AY048243 putative protein
7 2 9 11 RAFL07-16-C24 AY128389 Experimental RAFL07-16-C24 AV792687;AY128389 unknown protein
7 2 9 12 RAFL07-16-C20 AY059861 Experimental RAFL07-16-C20 AV792686;AY059861 chlorophyll a/b-binding protein CP29
7 2 9 13 RAFL07-16-D18 BT000443 Experimental RAFL07-16-D18 AV792699;BT000443 putative isoamylase
7 2 9 14 RAFL07-16-E17 BP561491 Experimental RAFL07-16-E17 AV792714;BP561491 phosphate transporter, putative
7 2 10 1 RAFL08-10-K24 AY048299 Experimental RAFL08-10-K24 AV793895;AV826178;AY048299
7 2 10 2 RAFL08-10-I23 AY048282 Experimental RAFL08-10-I23 AV793866;AV826170;AY048282 vegetative storage protein Vsp2
7 2 10 3 RAFL08-10-M22 AY049234 Experimental RAFL08-10-M22 AV793922;AV826184;AY049234 unknown protein
7 2 10 4 RAFL08-10-D22 AY048269 Experimental RAFL08-10-D22 AV793790;AV826151;AY048269 putative beta-fructosidase (At1g62660)
7 2 10 5 RAFL08-10-G21 AY048259 Experimental RAFL08-10-G21 AV793831;AY048259
7 2 10 6 RAFL08-10-E21 AY048239 Experimental RAFL08-10-E21 AV793803;AV826154;AY048239 putative protein
7 2 10 7 RAFL08-10-M13 AY048302 Experimental RAFL08-10-M13 AV793915;AV826182;AY048302 SRG1-like protein
7 2 10 8 RAFL08-10-E13 AV793797 Experimental RAFL08-10-E13 AV793797 putative fatty acid elongase 3-ketoacyl-CoA synthase 1 (At1g01120)
7 2 10 9 RAFL08-10-K12 BP561544 Experimental RAFL08-10-K12 AV793887;BP561544;AY048274
7 2 10 10 RAFL08-10-K11 AY048268 Experimental RAFL08-10-K11 AV793886;AV826177;AY048268 homeodomain - like protein
7 2 10 11 RAFL08-10-J10 AY048253 Experimental RAFL08-10-J10 AV793872;AV826171;AY048253 zinc finger protein 2, putative
7 2 10 12 RAFL08-10-A10 BP561536 Experimental RAFL08-10-A10 AV793742;BP561536;AY048244 putative protein phosphatase 2C
7 2 10 13 RAFL08-10-G06 AY048300 Experimental RAFL08-10-G06 AV793822;AV826157;AY048300 chlorophyll a/b-binding protein CP29
7 2 10 14 RAFL08-10-N03 AY048286 Experimental RAFL08-10-N03 AV793923;AV826185;AY048286 unknown protein
7 2 11 1 RAFL08-15-K23 AY080804 Experimental RAFL08-15-K23 AV795029;AV826460;AY080804 unknown protein
7 2 11 2 RAFL08-15-G22 AY056144 Experimental RAFL08-15-G22 AV794975;AV826448;AY056144 unknown protein (At1g17440)
7 2 11 3 RAFL08-15-J15 AY056185 Experimental RAFL08-15-J15 AV795009;AV826456;AY056185
7 2 11 4 RAFL08-15-H14 AY056155 Experimental RAFL08-15-H14 AV794986;AV826452;AY056155 unknown protein
7 2 11 5 RAFL08-15-M13 AY050975 Experimental RAFL08-15-M13 AV795050;AV826465;AY050975 acidic ribosomal protein, putative
7 2 11 6 RAFL08-15-I12 AY056191 Experimental RAFL08-15-I12 AV794995;AV826454;AY056191 oligosaccharyl transferase STT3-like protein
7 2 11 7 RAFL08-15-A12 AY080604 Experimental RAFL08-15-A12 AV794877;AV826433;AY080604 unknown protein
7 2 11 8 RAFL08-15-K10 AY045877 Experimental RAFL08-15-K10 AV795020;AY045877 unknown protein
7 2 11 9 RAFL08-15-I05 BP561602 Experimental RAFL08-15-I05 AV794990;BP561602
7 2 11 10 RAFL08-15-G04 BP561601 Experimental RAFL08-15-G04 AV794966;BP561601 unknown protein
7 2 11 11 RAFL08-15-H03 AY056147 Experimental RAFL08-15-H03 AV794979;AV826450;AY056147 succinic semialdehyde dehydrogenase 1 (SSADH1)
7 2 11 12 RAFL08-15-J02 AY056240 Experimental RAFL08-15-J02 AV795002;AV826455;AY056240 putative nonsense-mediated mRNA decay protein
7 2 11 13 RAFL08-15-F02 AY050831 Experimental RAFL08-15-F02 AV794949;AV826445;AY050831 putative protein
7 2 11 14 RAFL08-15-B02 BT000689 Experimental RAFL08-15-B02 AV794887;AV826434;BT000689 putative jasmonate inducible protein
7 2 12 1 RAFL09-06-B19 AY062607 Experimental RAFL09-06-B19 AV795995;AV826658;AY062607 Unknown protein
7 2 12 2 RAFL09-06-P18 BT000441 Experimental RAFL09-06-P18 AV796202;AV826758;BT000441
7 2 12 3 RAFL09-06-M18 AY120764 Experimental RAFL09-06-M18 AV796154;AV826735;AY120764 beta-1,3-glucanase-like protein
7 2 12 4 RAFL09-06-J18 AY062748 Experimental RAFL09-06-J18 AV796109;AV826713;AY062748 cytochrome p450 (CYP78A9)
7 2 12 5 RAFL08-16-E23 AV795167 Experimental RAFL08-16-E23 AV795167 unknown protein
7 2 12 6 RAFL08-16-C23 AY056157 Experimental RAFL08-16-C23 AV795140;AV826482;AY056157 putative nodulin
7 2 12 7 RAFL08-16-E21 AY142546 Experimental RAFL08-16-E21 AV795166;AY142546 beta-glucosidase
7 2 12 8 RAFL08-16-A20 AY050845 Experimental RAFL08-16-A20 AV795113;AV826475;AY050845 unknown protein
7 2 12 9 RAFL08-16-A19 AY050929 Experimental RAFL08-16-A19 AV795112;AV826474;AY050929 cytochrome c biogenesis protein precursor (gb|AAF35369.1)
7 2 12 10 RAFL08-16-C17 AY091160 Experimental RAFL08-16-C17 AV795137;AY091160 putative protein
7 2 12 11 RAFL08-16-B05 AV795117 Experimental RAFL08-16-B05 AV795117 unknown protein
7 2 12 12 RAFL08-16-A03 AY063945 Experimental RAFL08-16-A03 AV795104;AV826473;AY063945 predicted protein
7 2 12 13 RAFL08-16-C02 AY050976 Experimental RAFL08-16-C02 AV795126;AV826479;AY050976 I-box binding factor-like protein
7 2 12 14 RAFL08-16-B01 AY056243 Experimental RAFL08-16-B01 AV795115;AV826476;AY056243 putative receptor protein kinase (F13J11.14/At2g13790)
7 2 13 1 RAFL09-07-A12 AY062765 Experimental RAFL09-07-A12 AV796212;AV826764;AY062765 serine/threonine protein kinase -like protein
7 2 13 2 RAFL09-07-B11 BP561653 Experimental RAFL09-07-B11 AV796226;BP561653;AY062764 putative serine/threonine kinase
7 2 13 3 RAFL09-07-A10 AV826763 Experimental RAFL09-07-A10 AV796210;AV826763
7 2 13 4 RAFL09-07-A09 BP561652 Experimental RAFL09-07-A09 AV796209;BP561652 unknown protein
7 2 13 5 RAFL09-07-E08 AY062619 Experimental RAFL09-07-E08 AV796274;AV826797;AY062619 myb-related protein M4
7 2 13 6 RAFL09-07-B08 AY059912 Experimental RAFL09-07-B08 AV796224;AV826772;AY059912 aspartate aminotransferase (AAT1)
7 2 13 7 RAFL09-07-E01 AY062620 Experimental RAFL09-07-E01 AV796268;AV826794;AY062620 putative C2H2-type zinc finger protein
7 2 13 8 RAFL09-06-F24 BP561645 Experimental RAFL09-06-F24 AV796055;BP561645;AY059905 auxin-regulated protein (IAA8)
7 2 13 9 RAFL09-06-K23 AY059904 Experimental RAFL09-06-K23 AV796131;AV826722;AY059904 translation elongation factor eEF-1 alpha chain (gene A4)
7 2 13 10 RAFL09-06-G23 AV796070 Experimental RAFL09-06-G23 AV796070 metal-transporting ATPase - like protein
7 2 13 11 RAFL09-06-O22 AY062611 Experimental RAFL09-06-O22 AV796192;AV826753;AY062611 lipoxygenase (AtLox2)
7 2 13 12 RAFL09-06-M22 AY062610 Experimental RAFL09-06-M22 AV796157;AV826737;AY062610 putative protein
7 2 13 13 RAFL09-06-P19 AY120766 Experimental RAFL09-06-P19 AV796203;AV826759;AY120766 putative fibrillin
7 2 13 14 RAFL09-06-G19 AY062752 Experimental RAFL09-06-G19 AV796068;AV826695;AY062752 putative PRL1 associated protein
7 2 14 1 RAFL09-10-F09 AV826995 Experimental RAFL09-10-F09 AV796986;AV826995 putative protein
7 2 14 2 RAFL09-10-A09 AY058153 Experimental RAFL09-10-A09 AV796903;AV826971;AY058153 putative receptor-like protein kinase
7 2 14 3 RAFL09-10-B06 AV796916 Experimental RAFL09-10-B06 AV796916
7 2 14 4 RAFL09-10-J05 AY058190 Experimental RAFL09-10-J05 AV797049;AV827021;AY058190 unknown protein
7 2 14 5 RAFL09-10-E05 AY058186 Experimental RAFL09-10-E05 AV796961;AV826990;AY058186 pEARLI 1-like protein
7 2 14 6 RAFL09-10-L04 AY058169 Experimental RAFL09-10-L04 AV797080;AV827034;AY058169 putative protein
7 2 14 7 RAFL09-10-G04 AY069875 Experimental RAFL09-10-G04 AV797000;AV827001;AY069875 ethylene-insensitive 3
7 2 14 8 RAFL09-10-N03 BP561684 Experimental RAFL09-10-N03 AV797112;BP561684;AY058154 glyoxalase II
7 2 14 9 RAFL09-07-E24 AY092986 Experimental RAFL09-07-E24 AV796283;AV826801;AY092986 enolase (2-phospho-D-glycerate hydroylase)
7 2 14 10 RAFL09-07-E23 AY062624 Experimental RAFL09-07-E23 AV796282;AV826800;AY062624 Unknown protein (F16B3.27)
7 2 14 11 RAFL09-07-C23 AY092984 Experimental RAFL09-07-C23 AV796246;AY092984 putative phospholipid cytidylyltransferase
7 2 14 12 RAFL09-07-B22 AV826776 Experimental RAFL09-07-B22 AV796234;AV826776 BRCA1-associated RING domain protein isolog
7 2 14 13 RAFL09-07-D21 AY059920 Experimental RAFL09-07-D21 AV796264;AV826791;AY059920 putative zeta-carotene desaturase precursor
7 2 14 14 RAFL09-07-E20 AY062623 Experimental RAFL09-07-E20 AV796279;AY062623 SOF1 protein like protein
7 3 1 1 RAFL06-07-K11 BT002434 Experimental RAFL06-07-K11 AV784719;AV823699;BT002434 unknown protein, 5'partial
7 3 1 2 RAFL06-08-P10 AY065151 Experimental RAFL06-08-P10 AV784863;AV823808;AY065151 unknown protein
7 3 1 3 RAFL06-08-N22 AV823799 Experimental RAFL06-08-N22 AV784852;AV823799 putative protein
7 3 1 4 RAFL06-08-L06 BP561094 Experimental RAFL06-08-L06 BP561094;AY062834 unknown protein
7 3 1 5 RAFL06-10-M10 AY065150 Experimental RAFL06-10-M10 AV785034;AV823942;AY065150 unknown protein
7 3 1 6 RAFL06-10-H17 AY093002 Experimental RAFL06-10-H17 AV785019;AV823931;AY093002 putative U3 small nucleolar ribonucleoprotein
7 3 1 7 RAFL06-10-D22 BT002426 Experimental RAFL06-10-D22 AV784992;AV823911;BT002426 WRKY-like protein
7 3 1 8 RAFL06-11-N07 BP561138 Experimental RAFL06-11-N07 AV785116;BP561138;AY062827 putative protein
7 3 1 9 RAFL06-11-L24 AV823998 Experimental RAFL06-11-L24 AV785105;AV823998 glucosyltransferase-like protein
7 3 1 10 RAFL06-11-J16 AY065145 Experimental RAFL06-11-J16 AV785095;AV823990;AY065145 cinnamate-4-hydroxylase
7 3 1 11 RAFL06-11-F20 AY065144 Experimental RAFL06-11-F20 AV785074;AV823974;AY065144 putative protein
7 3 1 12 RAFL06-11-B16 AV823958 Experimental RAFL06-11-B16 AV785057;AV823958 fructose bisphosphate aldolase - like protein
7 3 1 13 RAFL06-10-G07 AY062818 Experimental RAFL06-10-G07 AV785010;AV823925;AY062818 putative small nuclear ribonucleoprotein polypeptide G
7 3 1 14 RAFL06-11-O22 BP561139 Experimental RAFL06-11-O22 BP561139 hypothetical protein
7 3 2 1 RAFL06-15-O18 AV824204 Experimental RAFL06-15-O18 AV824204;AF410284 putative protein
7 3 2 2 RAFL06-15-N16 AV824198 Experimental RAFL06-15-N16 AV785389;AV824198;AF410266 heat shock protein 17
7 3 2 3 RAFL06-16-G16 AV785440 Experimental RAFL06-16-G16 AV785440;AF410329 translation elongation factor EF-Tu precursor, chloroplast
7 3 2 4 RAFL06-16-E18 AV824230 Experimental RAFL06-16-E18 AV785432;AV824230;AF410325 putative protein
7 3 2 5 RAFL06-16-B15 AV785413 Experimental RAFL06-16-B15 AV785413;AF410311 unknown protein
7 3 2 6 RAFL06-13-I08 AV824099 Experimental RAFL06-13-I08 AV824099;AF410298
7 3 2 7 RAFL06-13-H09 AV824091 Experimental RAFL06-13-H09 AV785239;AV824091;AF410280 60s ribosomal protein l27a.
7 3 2 8 RAFL06-13-G03 AV824085 Experimental RAFL06-13-G03 AV785230;AV824085;AF410265 proteasome regulatory subunit, putative
7 3 2 9 RAFL06-08-D17 AV823746 Experimental RAFL06-08-D17 AV784781;AV823746 alcohol dehydrogenase (EC 1.1.1.1) class III (pir||S71244)
7 3 2 10 RAFL06-09-G04 AY093005 Experimental RAFL06-09-G04 AV784906;AV823841;AY093005 putative cruciferin 12S seed storage protein
7 3 2 11 RAFL06-09-D19 AY093004 Experimental RAFL06-09-D19 AV784884;AV823823;AY093004 hypothetical protein
7 3 2 12 RAFL06-09-B06 BP561100 Experimental RAFL06-09-B06 AV784873;BP561100;AY093003 putative steroid dehydrogenase
7 3 2 13 RAFL06-07-I02 AY059940 Experimental RAFL06-07-I02 AV784697;AV823683;AY059940 putative protein
7 3 2 14 RAFL06-07-F24 AV823675 Experimental RAFL06-07-F24 AV784686;AV823675 unknown
7 3 3 1 RAFL06-16-H01 AY127004 Experimental RAFL06-16-H01 AV785441;AY127004 putative protein
7 3 3 2 RAFL06-16-F11 AV824231 Experimental RAFL06-16-F11 AV785434;AV824231 unknown protein
7 3 3 3 RAFL06-16-D17 AV785426 Experimental RAFL06-16-D17 AV785426;AF410289 unknown protein
7 3 3 4 RAFL06-16-B20 AV824217 Experimental RAFL06-16-B20 AV785415;AV824217;AF410278 putative protein
7 3 3 5 RAFL06-15-D12 AV824165 Experimental RAFL06-15-D12 AV785339;AV824165;AF410337 unknown protein
7 3 3 6 RAFL06-16-K21 AV824257 Experimental RAFL06-16-K21 AV785472;AV824257;AF410324 unknown protein
7 3 3 7 RAFL06-14-H08 AV824150 Experimental RAFL06-14-H08 AV785314;AV824150;AF410303 pyrroline-5-carboxylate reductase
7 3 3 8 RAFL06-14-C14 AV824141 Experimental RAFL06-14-C14 AV785303;AV824141;AF410291 putative protein
7 3 3 9 RAFL06-13-N13 AV824126 Experimental RAFL06-13-N13 AV785283;AV824126;AF410279 unknown protein
7 3 3 10 RAFL06-13-M02 AV824119 Experimental RAFL06-13-M02 AV785271;AV824119;AF410271 putative protein
7 3 3 11 RAFL06-14-G14 AV824149 Experimental RAFL06-14-G14 AV785313;AV824149;AF410338 obtusifoliol 14-alpha demethylase like protein
7 3 3 12 RAFL06-13-P08 AV824134 Experimental RAFL06-13-P08 AV785292;AV824134;AF410316 unknown protein
7 3 3 13 RAFL06-13-L20 BP561168 Experimental RAFL06-13-L20 AV785270;BP561168;AF410302 unknown protein
7 3 3 14 RAFL06-13-K08 AV824109 Experimental RAFL06-13-K08 AV785258;AV824109;AF410294 Unknown protein (F10K1.15)
7 3 4 1 RAFL07-08-L18 AY064011 Experimental RAFL07-08-L18 AV791081;AV825360;AY064011 putative protein
7 3 4 2 RAFL07-08-E18 AY080800 Experimental RAFL07-08-E18 AV790977;AV825324;AY080800 ferredoxin, putative
7 3 4 3 RAFL07-08-O17 AY050963 Experimental RAFL07-08-O17 AV791117;AV825374;AY050963 hypothetical protein identical to T10M13.21
7 3 4 4 RAFL07-08-I17 AY064007 Experimental RAFL07-08-I17 AV791038;AV825345;AY064007 putative auxin-induced protein AUX2-11
7 3 4 5 RAFL07-08-A17 AY091144 Experimental RAFL07-08-A17 AV790914;AV825305;AY091144 putative protein
7 3 4 6 RAFL07-08-C16 BP561413 Experimental RAFL07-08-C16 AV790942;BP561413
7 3 4 7 RAFL07-08-F13 AY059761 Experimental RAFL07-08-F13 AV790990;AV825329;AY059761 putative receptor protein kinase
7 3 4 8 RAFL07-08-B13 AY056299 Experimental RAFL07-08-B13 AV790928;AV825308;AY056299 peroxisomal targeting signal type 1 receptor
7 3 4 9 RAFL07-08-I12 AY050988 Experimental RAFL07-08-I12 AV791036;AV825344;AY050988 AR781, similar to yeast pheromone receptor
7 3 4 10 RAFL07-08-N11 AV825368 Experimental RAFL07-08-N11 AV791100;AV825368 plasma membrane proton ATPase (PMA)
7 3 4 11 RAFL07-08-O10 AY056125 Experimental RAFL07-08-O10 AV791112;AY056125 putative FKBP type peptidyl-prolyl cis-trans isomerase
7 3 4 12 RAFL07-08-K09 AY059753 Experimental RAFL07-08-K09 AV791062;AV825353;AY059753 myosin heavy chain like protein
7 3 4 13 RAFL06-12-M21 BP561151 Experimental RAFL06-12-M21 AV785184;BP561151;AF410330
7 3 4 14 RAFL06-16-H23 AY094444 Experimental RAFL06-16-H23 AV785451;AV824242;AY094444 unknown protein
7 3 5 1 RAFL07-12-M12 AY062482 Experimental RAFL07-12-M12 AV791962;AV825685;AY062482 serine/threonine kinase, putative
7 3 5 2 RAFL07-12-E12 BT002415 Experimental RAFL07-12-E12 AV791849;AV825653;BT002415 fructose bisphosphate aldolase like protein
7 3 5 3 RAFL07-09-H05 AY050905 Experimental RAFL07-09-H05 AV791220;AV825410;AY050905 unknown protein
7 3 5 4 RAFL07-09-C05 AY050953 Experimental RAFL07-09-C05 AV791157;AV825390;AY050953 unknown protein
7 3 5 5 RAFL07-09-K04 AY050885 Experimental RAFL07-09-K04 AV791250;AV825423;AY050885 putative nuclear-encoded chloroplast DNA repair protein (YUP8H12R.33)
7 3 5 6 RAFL07-09-C04 BP561428 Experimental RAFL07-09-C04 AV791156;BP561428;AY050860 obtusifoliol 14-alpha demethylase like protein
7 3 5 7 RAFL07-09-N03 BT000670 Experimental RAFL07-09-N03 AV791284;AV825438;BT000670 aquaporin/MIP - like protein
7 3 5 8 RAFL07-09-G03 AY074521 Experimental RAFL07-09-G03 AV791204;AV825405;AY074521 putative serine proteinase (At1g32950)
7 3 5 9 RAFL07-08-H24 AY056192 Experimental RAFL07-08-H24 AV791027;AV825339;AY056192 enoyl-ACP reductase (ENR1)
7 3 5 10 RAFL07-08-E24 AY056141 Experimental RAFL07-08-E24 AV790981;AV825327;AY056141 60S ribosomal protein - like
7 3 5 11 RAFL07-08-I23 BP561421 Experimental RAFL07-08-I23 AV791042;BP561421;AY050882 unknown protein
7 3 5 12 RAFL07-08-D22 BT000703 Experimental RAFL07-08-D22 AV790961;AV825315;BT000703 3-hydroxy-3-methylglutaryl CoA reductase (AA 1-592)
7 3 5 13 RAFL07-08-L21 BT000671 Experimental RAFL07-08-L21 AV791082;AV825361;BT000671 cytoplasmic ribosomal protein S15a - like
7 3 5 14 RAFL07-08-I21 AY080834 Experimental RAFL07-08-I21 AV791040;AV825347;AY080834 KNAT1 homeobox-like protein
7 3 6 1 RAFL07-13-J05 AV825725 Experimental RAFL07-13-J05 AV792132;AV825725 elongation factor 1-alpha
7 3 6 2 RAFL07-13-L04 AY062487 Experimental RAFL07-13-L04 AV792162;AV825733;AY062487 putative protein
7 3 6 3 RAFL07-13-K02 AY059848 Experimental RAFL07-13-K02 AV792147;AV825728;AY059848 integral membrane protein, putative
7 3 6 4 RAFL07-13-H02 AY054492 Experimental RAFL07-13-H02 AV792102;AV825720;AY054492 Unknown protein (K19M22.18)
7 3 6 5 RAFL07-12-O20 AY120757 Experimental RAFL07-12-O20 AV792001;AV825700;AY120757 phosphoprotein phosphatase 2A regulatory subunit A (RCN1)
7 3 6 6 RAFL07-12-O19 AY054491 Experimental RAFL07-12-O19 AV792000;AV825699;AY054491 unknown protein
7 3 6 7 RAFL07-12-J19 BP561464 Experimental RAFL07-12-J19 AV791922;BP561464;AY062647 putative protein
7 3 6 8 RAFL07-12-L18 AY054490 Experimental RAFL07-12-L18 AV791951;AV825682;AY054490 putative polyA-binding protein, PAB3
7 3 6 9 RAFL07-12-J18 AV825672 Experimental RAFL07-12-J18 AV791921;AV825672 unknown protein
7 3 6 10 RAFL07-12-D18 AY062475 Experimental RAFL07-12-D18 AV791837;AV825647;AY062475 phosphate/phosphoenolpyruvate translocator - like protein
7 3 6 11 RAFL07-12-H15 AY062645 Experimental RAFL07-12-H15 AV791892;AV825663;AY062645 cyclin D3-like protein
7 3 6 12 RAFL07-12-M14 AV825687 Experimental RAFL07-12-M14 AV791964;AV825687 pitrilysin
7 3 6 13 RAFL07-12-K13 AY062502 Experimental RAFL07-12-K13 AV791934;AV825675;AY062502 DEAD-Box RNA helicase like protein
7 3 6 14 RAFL07-12-A13 AY062489 Experimental RAFL07-12-A13 AV791793;AV825635;AY062489
7 3 7 1 RAFL07-18-J01 AY049282 Experimental RAFL07-18-J01 AV793218;AV825997;AY049282 fructose bisphosphate aldolase like protein
7 3 7 2 RAFL07-17-J24 AY049275 Experimental RAFL07-17-J24 AV792989;AV825937;AY049275 sucrose transport protein SUC1
7 3 7 3 RAFL07-17-D23 AY049261 Experimental RAFL07-17-D23 AV792906;AV825916;AY049261 unknown protein
7 3 7 4 RAFL07-17-M22 AY065007 Experimental RAFL07-17-M22 AV793032;AV825946;AY065007 calnexin - like protein
7 3 7 5 RAFL07-17-H21 AY049247 Experimental RAFL07-17-H21 AV792958;AV825927;AY049247 putative pseudouridine synthase (NAP57)
7 3 7 6 RAFL07-17-M20 AY049244 Experimental RAFL07-17-M20 AV793030;AV825945;AY049244 unknown protein
7 3 7 7 RAFL07-13-J16 AY054498 Experimental RAFL07-13-J16 AV792139;AV825727;AY054498 Unknown protein (At1g04790; F13M7.22)
7 3 7 8 RAFL07-13-C16 AV825706 Experimental RAFL07-13-C16 AV792045;AV825706 putative protein
7 3 7 9 RAFL07-13-A16 AY081304 Experimental RAFL07-13-A16 AV792021;AV825702;AY081304 zeaxanthin epoxidase
7 3 7 10 RAFL07-13-K15 AY062495 Experimental RAFL07-13-K15 AV792155;AV825731;AY062495 unknown protein
7 3 7 11 RAFL07-13-O14 AY062494 Experimental RAFL07-13-O14 AV792202;AY062494 putative eukaryotic initiation factor 4, eIF4
7 3 7 12 RAFL07-13-A14 AY054494 Experimental RAFL07-13-A14 AV792019;AV825701;AY054494 AAA-type like ATPase
7 3 7 13 RAFL07-13-C08 AV825705 Experimental RAFL07-13-C08 AV792040;AV825705 Acyl-CoA independent ceramide synthase (AtCES1)
7 3 7 14 RAFL07-13-J07 AV792133 Experimental RAFL07-13-J07 AV792133 unknown protein
7 3 8 1 RAFL07-18-O18 AY065005 Experimental RAFL07-18-O18 AV793311;AV826024;AY065005 glucosyltransferase -like protein
7 3 8 2 RAFL07-18-D18 AY065000 Experimental RAFL07-18-D18 AV793133;AV825980;AY065000 beta adaptin - like protein
7 3 8 3 RAFL07-18-P15 AY139765 Experimental RAFL07-18-P15 AV793326;AV826026;AY139765 unknown protein
7 3 8 4 RAFL07-18-G15 AY049270 Experimental RAFL07-18-G15 AV793182;AV825989;AY049270 unknown protein
7 3 8 5 RAFL07-18-F14 AY065015 Experimental RAFL07-18-F14 AV793165;AV825988;AY065015
7 3 8 6 RAFL07-18-C14 AY049258 Experimental RAFL07-18-C14 AV793113;AV825972;AY049258 unknown protein
7 3 8 7 RAFL07-18-M13 AV826011 Experimental RAFL07-18-M13 AV793271;AV826011;AF462847 unknown protein
7 3 8 8 RAFL07-18-G13 AY065002 Experimental RAFL07-18-G13 AV793181;AY065002
7 3 8 9 RAFL07-18-O08 AY049281 Experimental RAFL07-18-O08 AV793302;AV826021;AY049281 unknown protein
7 3 8 10 RAFL07-18-J08 AY049269 Experimental RAFL07-18-J08 AV793223;AV826000;AY049269 unknown protein
7 3 8 11 RAFL07-18-N07 AY049263 Experimental RAFL07-18-N07 AV793284;AV826017;AY049263 protein kinase like protein
7 3 8 12 RAFL07-18-D07 AY065011 Experimental RAFL07-18-D07 AV793124;AV825975;AY065011 putative protein
7 3 8 13 RAFL07-18-N06 AY049253 Experimental RAFL07-18-N06 AV793283;AV826016;AY049253
7 3 8 14 RAFL07-18-J05 AY049246 Experimental RAFL07-18-J05 AV793221;AV825999;AY049246 unknown protein
7 3 9 1 RAFL08-12-D06 AY057575 Experimental RAFL08-12-D06 AV794279;AV826289;AY057575 MtN3-like protein
7 3 9 2 RAFL08-12-P05 BT000684 Experimental RAFL08-12-P05 AV794453;AV826340;BT000684 putative sucrose transport protein, SUC2
7 3 9 3 RAFL08-12-N05 AY080803 Experimental RAFL08-12-N05 AV794428;AV826331;AY080803
7 3 9 4 RAFL08-12-K05 AY050816 Experimental RAFL08-12-K05 AV794385;AV826319;AY050816 unknown protein
7 3 9 5 RAFL08-12-M02 AY056184 Experimental RAFL08-12-M02 AV794413;AV826328;AY056184 putative auxin response factor protein (T32E8.16)
7 3 9 6 RAFL08-12-F01 BT000806 Experimental RAFL08-12-F01 AV794304;AV826296;BT000806 putative RING zinc finger protein
7 3 9 7 RAFL08-12-D01 AY056329 Experimental RAFL08-12-D01 AV794274;AV826285;AY056329 2-oxoglutarate/malate translocator
7 3 9 8 RAFL08-11-C23 AY050936 Experimental RAFL08-11-C23 AV794009;AV826209;AY050936 late embryogenesis abundant protein LEA like
7 3 9 9 RAFL08-11-J22 AY056279 Experimental RAFL08-11-J22 AV794131;AV826240;AY056279 unknown protein
7 3 9 10 RAFL08-11-H22 AY064015 Experimental RAFL08-11-H22 AV794097;AV826230;AY064015
7 3 9 11 RAFL07-18-C20 AY049286 Experimental RAFL07-18-C20 AV793117;AV825973;AY049286 fructose bisphosphate aldolase like protein
7 3 9 12 RAFL07-18-N19 AV826019 Experimental RAFL07-18-N19 AV793292;AV826019 cysteine synthase (AtcysC1)
7 3 9 13 RAFL07-18-J19 BP561512 Experimental RAFL07-18-J19 AV793227;BP561512;AY094452 putative protein
7 3 9 14 RAFL07-18-D19 AY094451 Experimental RAFL07-18-D19 AV793134;AV825981;AY094451 putative protein
7 3 10 1 RAFL08-12-C24 AY059743 Experimental RAFL08-12-C24 AV794273;AV826284;AY059743 unknown protein
7 3 10 2 RAFL08-12-F23 AY059794 Experimental RAFL08-12-F23 AV794316;AV826303;AY059794 unknown protein (At3g56080)
7 3 10 3 RAFL08-12-K22 BP561571 Experimental RAFL08-12-K22 AV794396;BP561571;AY056164 unknown protein
7 3 10 4 RAFL08-12-F21 AV826301 Experimental RAFL08-12-F21 AV794314;AV826301 unknown protein
7 3 10 5 RAFL08-12-F20 AY080793 Experimental RAFL08-12-F20 AV794313;AV826300;AY080793
7 3 10 6 RAFL08-12-O19 AY050821 Experimental RAFL08-12-O19 AV794449;AV826338;AY050821 putative K+ channel, beta subunit
7 3 10 7 RAFL08-12-A15 BT000777 Experimental RAFL08-12-A15 AV794242;AV826276;BT000777 unknown protein
7 3 10 8 RAFL08-12-L14 AY080807 Experimental RAFL08-12-L14 AV794407;AV826325;AY080807
7 3 10 9 RAFL08-12-P13 AY059786 Experimental RAFL08-12-P13 AV794456;AV826341;AY059786
7 3 10 10 RAFL08-12-E12 AY056241 Experimental RAFL08-12-E12 AV794295;AV826294;AY056241 receptor-like protein kinase
7 3 10 11 RAFL08-12-N11 AV794431 Experimental RAFL08-12-N11 AV794431 splicing factor like protein
7 3 10 12 RAFL08-12-G11 AY050923 Experimental RAFL08-12-G11 AV794325;AV826304;AY050923 bZip transcription factor AtbZip53
7 3 10 13 RAFL08-12-F08 AY059742 Experimental RAFL08-12-F08 AV794308;AV826298;AY059742 unknown protein
7 3 10 14 RAFL08-12-J07 AY056153 Experimental RAFL08-12-J07 AV794372;AV826313;AY056153 unknown protein
7 3 11 1 RAFL08-18-F20 AY062729 Experimental RAFL08-18-F20 AV795610;AV826582;AY062729 putative chaperonin
7 3 11 2 RAFL08-18-A20 AY062727 Experimental RAFL08-18-A20 AV795535;AV826566;AY062727
7 3 11 3 RAFL08-18-H14 AY059894 Experimental RAFL08-18-H14 AV795634;AV826587;AY059894 putative protein
7 3 11 4 RAFL08-18-B14 AV826568 Experimental RAFL08-18-B14 AV795545;AV826568 unknown protein
7 3 11 5 RAFL08-18-M13 AY062721 Experimental RAFL08-18-M13 AV795704;AV826605;AY062721 Unknown protein (At2g38110; F16M14.4)
7 3 11 6 RAFL08-18-E13 AY062719 Experimental RAFL08-18-E13 AV795589;AV826578;AY062719 unknown protein
7 3 11 7 RAFL08-18-A12 AY062718 Experimental RAFL08-18-A12 AV795528;AV826563;AY062718 phosphatidylinositol-4-phosphate 5-kinase isolog
7 3 11 8 RAFL08-18-N11 AY062584 Experimental RAFL08-18-N11 AV795721;AY062584 unknown protein
7 3 11 9 RAFL08-18-K08 AY062714 Experimental RAFL08-18-K08 AV795669;AV826597;AY062714 unknown protein
7 3 11 10 RAFL08-18-B08 AY062580 Experimental RAFL08-18-B08 AV795540;AV826567;AY062580 similar to mitochondrial NAD-dependent malate dehydrogenase
7 3 11 11 RAFL08-18-C07 AY062601 Experimental RAFL08-18-C07 AV795557;AV826571;AY062601 unknown protein
7 3 11 12 RAFL08-18-D05 AY062732 Experimental RAFL08-18-D05 AV795574;AV826574;AY062732 Unknown protein (At1g23390)
7 3 11 13 RAFL08-18-I03 AY062589 Experimental RAFL08-18-I03 AV795640;AV826589;AY062589 glucosyltransferase like protein
7 3 11 14 RAFL08-18-C03 AY062583 Experimental RAFL08-18-C03 AV795554;AV826570;AY062583 putative protein
7 3 12 5 RAFL08-19-B11 BT002394 Experimental RAFL08-19-B11 AV795778;BP561636;BT002394
7 3 12 6 RAFL08-19-A10 AY120770 Experimental RAFL08-19-A10 AV795763;AY120770 putative protein phosphatase type 2C
7 3 12 7 RAFL08-19-J09 AY062608 Experimental RAFL08-19-J09 AV795878;AV826628;AY062608 cysteine protease component of protease-inhibitor complex
7 3 12 8 RAFL08-19-P08 AY062738 Experimental RAFL08-19-P08 AV795958;AV826644;AY062738 unknown protein
7 3 12 9 RAFL08-19-A08 AY062598 Experimental RAFL08-19-A08 AV795761;AV826613;AY062598 putative protein
7 3 12 10 RAFL08-19-N06 AY059899 Experimental RAFL08-19-N06 AV795931;AY059899 unknown protein
7 3 12 11 RAFL08-18-N23 BT002381 Experimental RAFL08-18-N23 AV795729;BP561635;BT002381 unknown protein
7 3 12 12 RAFL08-18-G23 AY062591 Experimental RAFL08-18-G23 AV795629;AV826586;AY062591 AT3g01540/F4P13_9
7 3 12 13 RAFL08-18-M22 AY062590 Experimental RAFL08-18-M22 AV795713;AV826606;AY062590 putative preprotein translocase SECY protein
7 3 12 14 RAFL08-18-I21 AY059897 Experimental RAFL08-18-I21 AV795651;AV826591;AY059897 receptor protein kinase-like protein
7 3 13 1 RAFL09-09-C02 BP561668 Experimental RAFL09-09-C02 AV796651;BP561668;AY128283 hypothetical protein
7 3 13 2 RAFL09-09-J01 AY094458 Experimental RAFL09-09-J01 AV796775;AV826919;AY094458 unknown protein
7 3 13 3 RAFL09-09-G01 AY090355 Experimental RAFL09-09-G01 AV796720;AV826893;AY090355 lectin like protein
7 3 13 4 RAFL09-09-D01 AV826879 Experimental RAFL09-09-D01 AV796667;AV826879 unknown protein
7 3 14 1 RAFL09-12-P03 AV827250 Experimental RAFL09-12-P03 AV797650;AV827250;AF361621 tropinone reductase-I, putative
7 3 14 2 RAFL09-12-J03 AV827215 Experimental RAFL09-12-J03 AV797550;AV827215;AF367329 putative cytochrome P450
7 3 14 3 RAFL09-11-G24 AV827108 Experimental RAFL09-11-G24 AV797263;AV827108;AF367325 overlap with bases 100,099-109,160 of 'IGF' clone F20N2, gb|AC002328. This region is annotated in the F20N2 entry, gb|AC002328
7 3 14 4 RAFL09-11-I23 AV827121 Experimental RAFL09-11-I23 AV797298;AV827121;AF367310 putative s-adenosylmethionine synthetase
7 3 14 5 RAFL09-11-L22 AV827140 Experimental RAFL09-11-L22 AV797345;AV827140;AF367308 phenylalanine ammonia-lyase
7 3 14 6 RAFL09-11-C22 AY048201 Experimental RAFL09-11-C22 AV797204;AV827090;AY048201 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
7 3 14 7 RAFL09-11-K21 AV827135 Experimental RAFL09-11-K21 AV797328;AV827135;AF367305 methyltransferase - like protein
7 3 14 8 RAFL09-11-I21 AY048199 Experimental RAFL09-11-I21 AV797297;AV827120;AY048199 cytosolic factor, putative
7 3 14 9 RAFL09-09-M05 AY127009 Experimental RAFL09-09-M05 AV796835;AV826941;AY127009 unknown protein
7 3 14 10 RAFL09-09-K05 AV826930 Experimental RAFL09-09-K05 AV796798;AV826930;AF462822 ribulose bisphosphate carboxylase small chain 3b precursor (RuBisCO small subunit 3b) (sp|P10798)
7 3 14 11 RAFL09-09-G05 AV826894 Experimental RAFL09-09-G05 AV796724;AV826894 unknown protein
7 3 14 12 RAFL09-09-O04 AY090353 Experimental RAFL09-09-O04 AV796870;AY090353
7 3 14 13 RAFL09-09-K04 AY128279 Experimental RAFL09-09-K04 AV796797;AV826929;AY128279 protein kinase
7 3 14 14 RAFL09-09-H04 AY127015 Experimental RAFL09-09-H04 AV796742;AV826901;AY127015 unknown protein
7 4 1 1 RAFL06-07-B10 AY074354 Experimental RAFL06-07-B10 AV784654;AV823649;AY074354 putative protein
7 4 1 2 RAFL05-21-P24 AY074344 Experimental RAFL05-21-P24 AV784643;AV823639;AY074344 putative syntaxin-related protein (U39451)
7 4 1 3 RAFL05-21-N22 AY050791 Experimental RAFL05-21-N22 AV784624;AV823621;AY050791 putative protein
7 4 1 4 RAFL05-21-B16 AY045817 Experimental RAFL05-21-B16 AV784553;AV823558;AY045817
7 4 1 5 RAFL05-21-H10 AY045993 Experimental RAFL05-21-H10 AV784587;AV823589;AY045993 putative protein
7 4 1 6 RAFL05-21-K02 AY056219 Experimental RAFL05-21-K02 AV784598;AV823596;AY056219 peroxisomal Ca-dependent solute carrier - like protein
7 4 1 7 RAFL05-21-A06 AV823548 Experimental RAFL05-21-A06 AV784542;AV823548 peptidylprolyl isomerase ROC1
7 4 1 8 RAFL05-21-J02 AY096648 Experimental RAFL05-21-J02 AV784594;AV823594;AY096648 unknown protein
7 4 1 9 RAFL05-20-M15 BP561032 Experimental RAFL05-20-M15 AV784519;BP561032;AY080775 F6D8.26
7 4 1 10 RAFL05-21-O19 BP561055 Experimental RAFL05-21-O19 AV784630;BP561055;AY045814 lipase, putative
7 4 1 11 RAFL05-21-F10 AY045991 Experimental RAFL05-21-F10 AV784573;AY045991 putative protein
7 4 1 12 RAFL05-21-P05 AY045956 Experimental RAFL05-21-P05 AV784633;AV823629;AY045956 unknown protein
7 4 1 13 RAFL05-20-L21 AY090963 Experimental RAFL05-20-L21 AV784513;AV823528;AY090963 unknown protein
7 4 1 14 RAFL05-21-K17 AY080789 Experimental RAFL05-21-K17 AV784602;AV823599;AY080789 membrane related protein-like
7 4 2 1 RAFL06-09-D01 AV823820 Experimental RAFL06-09-D01 AV784880;AV823820 putative protein
7 4 2 2 RAFL06-09-A13 AY120782 Experimental RAFL06-09-A13 AV784870;AV823812;AY120782 ATP-dependent RNA helicase-like protein
7 4 2 3 RAFL06-07-O19 AY059941 Experimental RAFL06-07-O19 AV784748;AV823719;AY059941 putative GH3-like protein
7 4 2 4 RAFL06-07-N15 AY065159 Experimental RAFL06-07-N15 AV784738;AV823714;AY065159 putative elongation factor 1-beta
7 4 2 5 RAFL06-07-L24 AV823707 Experimental RAFL06-07-L24 AV784727;AV823707 ubiquinol-cytochrome-c reductase like protein
7 4 2 6 RAFL06-07-I21 AY065175 Experimental RAFL06-07-I21 AV784704;AV823687;AY065175 unknown protein
7 4 2 7 RAFL06-08-M11 AY059944 Experimental RAFL06-08-M11 AV784836;AV823784;AY059944 putative tetrahydrofolate synthase
7 4 2 8 RAFL06-08-J04 AY062848 Experimental RAFL06-08-J04 AV784818;AV823771;AY062848 unknown protein
7 4 2 9 RAFL06-07-B04 AY074370 Experimental RAFL06-07-B04 AV784650;AV823646;AY074370
7 4 2 10 RAFL06-07-E01 AV823661 Experimental RAFL06-07-E01 AV784669;AV823661 low temperature and salt responsive protein homolog
7 4 2 11 RAFL06-07-B02 AY045846 Experimental RAFL06-07-B02 AV784649;AV823645;AY045846 putative 40S ribosomal protein S5
7 4 2 12 RAFL06-07-D23 AY045820 Experimental RAFL06-07-D23 AV784668;AY045820 helicase like protein
7 4 2 13 RAFL06-07-D22 AY080764 Experimental RAFL06-07-D22 AV784667;AV823660;AY080764
7 4 2 14 RAFL06-07-A15 AY045959 Experimental RAFL06-07-A15 AV784648;AV823644;AY045959 unknown protein
7 4 3 1 RAFL06-09-P21 AY065179 Experimental RAFL06-09-P21 AV784961;AV823884;AY065179 calmodulin (cam2)
7 4 3 2 RAFL06-09-L09 AY059951 Experimental RAFL06-09-L09 AV784938;AV823867;AY059951 putative nonspecific lipid-transfer protein
7 4 3 3 RAFL06-08-E22 AY062863 Experimental RAFL06-08-E22 AV784789;AV823752;AY062863 unknown protein
7 4 3 4 RAFL06-09-K18 AY062862 Experimental RAFL06-09-K18 AV784935;AV823864;AY062862 unknown protein
7 4 3 5 RAFL06-08-J12 BT002436 Experimental RAFL06-08-J12 AV784820;AV823772;BT002436 chloroplast membrane protein (ALBINO3)
7 4 3 6 RAFL06-08-D08 AY065173 Experimental RAFL06-08-D08 AV784779;AV823743;AY065173 peroxidase ATP3a homolog
7 4 3 7 RAFL06-08-C02 AY062859 Experimental RAFL06-08-C02 AV823736;AY062859 light-inducible protein ATLS1
7 4 3 8 RAFL06-09-H09 AY059947 Experimental RAFL06-09-H09 AV784914;AV823848;AY059947 cytosolic ribosomal protein S11
7 4 3 9 RAFL06-07-N20 AY062858 Experimental RAFL06-07-N20 AV784740;AV823715;AY062858 unknown protein
7 4 3 10 RAFL06-07-M11 AY062857 Experimental RAFL06-07-M11 AV784729;AV823708;AY062857 unknown protein
7 4 3 11 RAFL06-08-C01 AY065166 Experimental RAFL06-08-C01 AV784769;AV823735;AY065166 Putative MYB47 transcription factor
7 4 3 12 RAFL06-08-A11 AY120783 Experimental RAFL06-08-A11 AV784760;AV823727;AY120783 unknown protein
7 4 3 13 RAFL06-09-F20 AY065164 Experimental RAFL06-09-F20 AV784902;AV823837;AY065164 tubulin alpha-5 chain-like protein
7 4 3 14 RAFL06-09-E17 AY065163 Experimental RAFL06-09-E17 AV784891;AV823829;AY065163 homocysteine S-methyltransferase AtHMT-1 identical to GB:AAF23821 from [Arabidopsis thaliana]
7 4 4 1 RAFL06-16-K04 AV824254 Experimental RAFL06-16-K04 AV785468;AV824254 putative photosystem II type I chlorophyll a/b binding protein.
7 4 4 2 RAFL06-16-I12 AY127010 Experimental RAFL06-16-I12 AV785457;AV824247;AY127010 putative glutaredoxin
7 4 4 3 RAFL06-13-O15 AY127018 Experimental RAFL06-13-O15 AV785288;AV824130;AY127018 nuclear antigen homolog
7 4 4 4 RAFL06-13-M23 AY090366 Experimental RAFL06-13-M23 AV785278;AY090366 dnaJ protein homolog atj3
7 4 4 5 RAFL06-13-L06 AY090361 Experimental RAFL06-13-L06 AV785266;AV824116;AY090361 unknown protein
7 4 4 6 RAFL06-13-J20 AV824106 Experimental RAFL06-13-J20 AV785254;AV824106 unknown protein
7 4 4 7 RAFL06-16-L13 BP561208 Experimental RAFL06-16-L13 AV785479;BP561208 pyruvate decarboxylase (gb|AAB16855.1)
7 4 4 8 RAFL06-16-K01 AV824253 Experimental RAFL06-16-K01 AV785467;AV824253
7 4 4 9 RAFL06-16-I08 AY090368 Experimental RAFL06-16-I08 AV785456;AV824246;AY090368 putative expansin
7 4 4 10 RAFL06-14-B04 AV824139 Experimental RAFL06-14-B04 AV785299;AV824139 putative tropinone reductase
7 4 4 11 RAFL06-13-O11 AY075600 Experimental RAFL06-13-O11 AV785287;AY075600 protein kinase - like
7 4 4 12 RAFL06-13-M22 AY127016 Experimental RAFL06-13-M22 AV785277;AY127016 hypothetical protein
7 4 4 13 RAFL06-09-O07 AV823879 Experimental RAFL06-09-O07 AV784954;AV823879 unknown protein
7 4 4 14 RAFL06-09-P22 AY065181 Experimental RAFL06-09-P22 AV784962;AV823885;AY065181 delta tonoplast integral protein (delta-TIP)
7 4 5 1 RAFL07-10-D11 AY045866 Experimental RAFL07-10-D11 AV791360;AV825475;AY045866 putative 60S Ribosomal Protein L10
7 4 5 2 RAFL07-10-O10 AV825557 Experimental RAFL07-10-O10 AV791534;AV825557 pyrophosphate-dependent phosphofructo-1-kinase-like protein
7 4 5 9 RAFL06-16-P17 BP561212 Experimental RAFL06-16-P17 AV785507;BP561212
7 4 5 10 RAFL06-16-N03 AY139764 Experimental RAFL06-16-N03 AV785488;AV824268;AY139764 putative protein
7 4 5 11 RAFL06-16-M17 AV824267 Experimental RAFL06-16-M17 AV785487;AV824267 beta-amylase (ct-bmy gene)
7 4 5 12 RAFL06-16-O07 BP561210 Experimental RAFL06-16-O07 AV785496;BP561210 arabinogalactan-protein AGP9
7 4 5 13 RAFL06-16-O05 AY094450 Experimental RAFL06-16-O05 AV785495;AV824275;AY094450 unknown protein
7 4 5 14 RAFL06-16-N18 AY094449 Experimental RAFL06-16-N18 AV785494;AV824274;AY094449 fasciclin-like arabinogalactan protein FLA7
7 4 6 1 RAFL07-10-J24 AY056131 Experimental RAFL07-10-J24 AV791461;AV825525;AY056131 unknown protein
7 4 6 2 RAFL07-10-H24 AY045874 Experimental RAFL07-10-H24 AV791433;AV825509;AY045874 unknown protein
7 4 6 3 RAFL07-10-C24 AY045894 Experimental RAFL07-10-C24 AV791350;AV825466;AY045894 homeobox protein (HAT22)
7 4 6 4 RAFL07-10-E23 AY059756 Experimental RAFL07-10-E23 AV791381;AV825485;AY059756 unknown protein
7 4 6 5 RAFL07-10-A20 AY056265 Experimental RAFL07-10-A20 AV791327;AV825456;AY056265 pasticcino 1-A (PAS1-A)
7 4 6 6 RAFL07-10-O19 AY056300 Experimental RAFL07-10-O19 AV791540;AY056300 unknown protein
7 4 6 7 RAFL07-10-A19 AY050880 Experimental RAFL07-10-A19 AV791326;AV825455;AY050880 peroxiredoxin - like protein
7 4 6 8 RAFL07-10-L18 AY080846 Experimental RAFL07-10-L18 AV791487;AV825539;AY080846 unknown protein
7 4 6 9 RAFL07-10-A18 AY074373 Experimental RAFL07-10-A18 AV791325;AV825454;AY074373 APETALA2 protein - like
7 4 6 10 RAFL07-10-O16 AY056216 Experimental RAFL07-10-O16 AV791538;AV825558;AY056216 cinnamoyl CoA reductase - like protein
7 4 6 11 RAFL07-10-L13 AY080792 Experimental RAFL07-10-L13 AV791484;AV825538;AY080792 putative ABC transporter (At1g17840)
7 4 6 12 RAFL07-10-G12 BT000784 Experimental RAFL07-10-G12 AV791412;AV825499;BT000784 ARF1-binding protein
7 4 6 13 RAFL07-10-E12 AY050989 Experimental RAFL07-10-E12 AV791374;AV825482;AY050989 putative protein
7 4 6 14 RAFL07-10-F11 AY045872 Experimental RAFL07-10-F11 AV791389;AV825488;AY045872 unknown protein
7 4 7 1 RAFL07-15-M09 AY062501 Experimental RAFL07-15-M09 AV792598;AV825843;AY062501 protein kinase (EC 2.7.1.37) 5 (pir||JN0505)
7 4 7 2 RAFL07-15-K08 AY062500 Experimental RAFL07-15-K08 AV792570;AV825838;AY062500 Putative S-phase-specific ribosomal protein
7 4 7 3 RAFL07-15-M07 AY054508 Experimental RAFL07-15-M07 AV792596;AV825842;AY054508 unknown
7 4 7 4 RAFL07-15-M06 AY062515 Experimental RAFL07-15-M06 AV792595;AV825841;AY062515 Unknown protein (At1g70700)
7 4 7 5 RAFL07-15-H06 AY062652 Experimental RAFL07-15-H06 AV792530;AV825825;AY062652 unknown protein
7 4 7 6 RAFL07-15-A06 AV825798 Experimental RAFL07-15-A06 AV792435;AV825798 chloroplast GrpE protein
7 4 7 7 RAFL07-11-C15 AY056266 Experimental RAFL07-11-C15 AV791590;AY056266 eukaryotic initiation factor 4, eIF4-like protein
7 4 7 8 RAFL07-11-H13 AV791658 Experimental RAFL07-11-H13 AV791658
7 4 7 9 RAFL07-11-E12 AY046042 Experimental RAFL07-11-E12 AV791616;AV825577;AY046042 unknown protein
7 4 7 10 RAFL07-11-A11 AY050861 Experimental RAFL07-11-A11 AV791561;AV825565;AY050861 putative auxin-responsive protein
7 4 7 11 RAFL07-11-F09 AV791626 Experimental RAFL07-11-F09 AV791626 sulfite oxidase (SOX)
7 4 7 12 RAFL07-11-G08 AV825585 Experimental RAFL07-11-G08 AV791640;AV825585 En/Spm-like transposon protein
7 4 7 13 RAFL07-11-G01 AY050802 Experimental RAFL07-11-G01 AV791635;AV825584;AY050802 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR)
7 4 7 14 RAFL07-10-M24 BP561445 Experimental RAFL07-10-M24 AV791508;BP561445 putative protein
7 4 8 1 RAFL07-16-A10 BT002042 Experimental RAFL07-16-A10 AV792647;BT002042 unknown protein
7 4 8 2 RAFL07-16-B09 AV825856 Experimental RAFL07-16-B09 AV792662;AV825856 unknown protein
7 4 8 3 RAFL07-15-J22 AY062654 Experimental RAFL07-15-J22 AV792561;AV825835;AY062654 unknown protein
7 4 8 4 RAFL07-15-N21 AY062653 Experimental RAFL07-15-N21 AV792619;AV825848;AY062653 unknown protein
7 4 8 5 RAFL07-15-K21 BT002053 Experimental RAFL07-15-K21 AV792581;BT002053 putative protein
7 4 8 6 RAFL07-15-J20 AV792559 Experimental RAFL07-15-J20 AV792559
7 4 8 7 RAFL07-15-N19 BT002055 Experimental RAFL07-15-N19 AV792618;BP561485;BT002055
7 4 8 8 RAFL07-15-A19 AY062512 Experimental RAFL07-15-A19 AV792443;AY062512 putative photosystem I reaction center subunit II precursor
7 4 8 9 RAFL07-15-M15 AV825844 Experimental RAFL07-15-M15 AV792601;AV825844 Unknown protein (F24O1.10)
7 4 8 10 RAFL07-15-I15 AV825832 Experimental RAFL07-15-I15 AV792547;AV825832 elongation factor, putative
7 4 8 11 RAFL07-15-P14 AV792640 Experimental RAFL07-15-P14 AV792640 unknown protein
7 4 8 12 RAFL07-15-D14 BT003337 Experimental RAFL07-15-D14 AV792477;AV825809;BT003337 putative zinc-finger protein
7 4 8 13 RAFL07-15-A14 AY059852 Experimental RAFL07-15-A14 AV792440;AV825799;AY059852 glucosyltransferase-like protein
7 4 8 14 RAFL07-15-K13 AY062506 Experimental RAFL07-15-K13 AV792574;AV825839;AY062506 unknown protein
7 4 9 1 RAFL08-09-I21 AY075650 Experimental RAFL08-09-I21 AV793636;AV826116;AY075650 unknown protein
7 4 9 2 RAFL08-09-J20 AY048262 Experimental RAFL08-09-J20 AV793652;AV826123;AY048262 chlorophyll a/b-binding protein CP29
7 4 9 3 RAFL08-09-F20 AY048254 Experimental RAFL08-09-F20 AV793590;AV826104;AY048254 unknown protein
7 4 9 4 RAFL08-09-J19 AY048246 Experimental RAFL08-09-J19 AV793651;AV826122;AY048246 putative protein
7 4 9 5 RAFL08-09-C15 BP561527 Experimental RAFL08-09-C15 AV793549;BP561527;AY048291 unknown protein
7 4 9 6 RAFL08-09-K14 BP561531 Experimental RAFL08-09-K14 AV793666;BP561531;AY075652
7 4 9 7 RAFL08-09-A13 AY049235 Experimental RAFL08-09-A13 AV793523;AV826085;AY049235 alpha-glucan phosphorylase, putative
7 4 9 8 RAFL08-09-L12 AY048264 Experimental RAFL08-09-L12 AV793675;AV826131;AY048264 putative peroxiredoxin
7 4 9 9 RAFL08-09-H12 AY075648 Experimental RAFL08-09-H12 AV793620;AV826112;AY075648 protease like protein
7 4 9 10 RAFL08-09-L11 AY048245 Experimental RAFL08-09-L11 AV793674;AV826130;AY048245 putative protein
7 4 9 11 RAFL07-16-C14 AY128387 Experimental RAFL07-16-C14 AV792681;AV825860;AY128387 unknown protein
7 4 9 12 RAFL07-16-F13 AY062523 Experimental RAFL07-16-F13 AV792728;AV825869;AY062523 Unknown protein (At5g38640; MBB18.19)
7 4 9 13 RAFL07-16-E12 AY120758 Experimental RAFL07-16-E12 AV792711;AV825866;AY120758
7 4 9 14 RAFL07-16-D11 AV825861 Experimental RAFL07-16-D11 AV792693;AV825861 unknown protein
7 4 10 1 RAFL08-10-G20 AY102109 Experimental RAFL08-10-G20 AV793830;AV826163;AY102109 glutamate-1-semialdehyde 2,1-aminomutase 1 precursor (GSA 1) (glutamate-1-semialdehyde aminotransferase 1) (GSA-AT 1) (sp|P42799)
7 4 10 2 RAFL08-10-L18 AY094453 Experimental RAFL08-10-L18 AV793903;AV826179;AY094453 chaperonin like protein
7 4 10 3 RAFL08-10-G18 AY075651 Experimental RAFL08-10-G18 AV793829;AV826162;AY075651 auxin-induced protein, putative
7 4 10 4 RAFL08-10-J17 AY102107 Experimental RAFL08-10-J17 AV793873;AV826172;AY102107 unknown protein (At1g70830)
7 4 10 5 RAFL08-10-H15 AV826166 Experimental RAFL08-10-H15 AV793844;AV826166 endoplasmic reticulum alpha-mannosidase, putative
7 4 10 6 RAFL08-10-E14 AY056778 Experimental RAFL08-10-E14 AV793798;AV826153;AY056778 unknown protein
7 4 10 7 RAFL08-10-A09 AY056783 Experimental RAFL08-10-A09 AV793741;AV826144;AY056783 alcohol dehydrogenase-like protein
7 4 10 8 RAFL08-10-I08 BP561542 Experimental RAFL08-10-I08 AV793856;BP561542;AY048287 putative protein
7 4 10 9 RAFL08-10-G08 AY056781 Experimental RAFL08-10-G08 AV793823;AV826158;AY056781 putative 60S ribosomal protein L1
7 4 10 10 RAFL08-10-C08 AY048267 Experimental RAFL08-10-C08 AV793765;AV826149;AY048267 ubiquitin-conjugating enzyme E2-17 kd 3 (ubiquitin-protein ligase 3) (ubiquitin carrier protein 3)-like protein (sp|P42746)
7 4 10 11 RAFL08-10-M07 AY048252 Experimental RAFL08-10-M07 AV793912;AV826181;AY048252 unknown protein
7 4 10 12 RAFL08-10-K06 AY048241 Experimental RAFL08-10-K06 AV793882;AV826173;AY048241 unknown protein
7 4 10 13 RAFL08-09-H22 AY048296 Experimental RAFL08-09-H22 AV793626;AV826115;AY048296 RIBOSOMAL PROTEIN, putative (At1g71710)
7 4 10 14 RAFL08-09-F22 AY048279 Experimental RAFL08-09-F22 AV793591;AV826105;AY048279 putative protein
7 4 11 1 RAFL08-15-D17 AY050928 Experimental RAFL08-15-D17 AV794925;AV826443;AY050928 unknown protein
7 4 11 2 RAFL08-15-M16 AY050819 Experimental RAFL08-15-M16 AV795052;AV826467;AY050819 vegetative storage protein Vsp2
7 4 11 3 RAFL08-15-A10 AY050966 Experimental RAFL08-15-A10 AV794875;AV826432;AY050966 ribosomal protein S15-like
7 4 11 4 RAFL08-15-H09 AY056154 Experimental RAFL08-15-H09 AV794982;AV826451;AY056154 scarecrow 3 -like protein
7 4 11 5 RAFL08-15-I08 AY056161 Experimental RAFL08-15-I08 AV794992;AV826453;AY056161 putative surfeit 1 protein
7 4 11 6 RAFL08-15-A08 AV826431 Experimental RAFL08-15-A08 AV794874;AV826431 arginine decarboxylase (spe2)
7 4 11 7 RAFL08-15-J07 BP561603 Experimental RAFL08-15-J07 AV795005;BP561603;AY050832 histidinol-phosphate aminotransferase-like protein
7 4 11 8 RAFL08-15-A07 AY050817 Experimental RAFL08-15-A07 AV794873;AV826430;AY050817 ubiquitin-specific protease 6 (UBP6)
7 4 11 9 RAFL08-15-K01 AV826457 Experimental RAFL08-15-K01 AV795015;AV826457 putative beta-fructosidase (At1g62660)
7 4 11 10 RAFL08-14-D23 AY063909 Experimental RAFL08-14-D23 AV794737;AV826401;AY063909 unknown protein
7 4 11 11 RAFL08-14-F20 BP561594 Experimental RAFL08-14-F20 AV794764;BP561594;AY056330 unknown protein
7 4 11 12 RAFL08-14-P19 AY059768 Experimental RAFL08-14-P19 AV794867;AV826429;AY059768 putative RNA polymerase sigma-70 factor
7 4 11 13 RAFL08-14-G19 AY050830 Experimental RAFL08-14-G19 AV794773;AV826408;AY050830 putative protein
7 4 11 14 RAFL08-14-O18 AY056252 Experimental RAFL08-14-O18 AV794857;AV826425;AY056252 unknown protein
7 4 12 1 RAFL09-06-I17 AV826707 Experimental RAFL09-06-I17 AV796097;AV826707 polyubiquitin (ubq10)
7 4 12 2 RAFL09-06-F17 BT000442 Experimental RAFL09-06-F17 AV796051;BP561644;BT000442 delta-8 sphingolipid desaturase (sld1)
7 4 12 3 RAFL09-06-A17 AY059901 Experimental RAFL09-06-A17 AV795981;AV826648;AY059901 protein kinase, putative
7 4 12 4 RAFL09-06-N16 AY062751 Experimental RAFL09-06-N16 AV796173;AV826747;AY062751 protein kinase, putative
7 4 12 5 RAFL08-16-B16 AV795122 Experimental RAFL08-16-B16 AV795122 unknown protein
7 4 12 6 RAFL08-16-C13 BT000803 Experimental RAFL08-16-C13 AV795134;AV826480;BT000803 unknown protein
7 4 12 7 RAFL08-16-D12 AY056165 Experimental RAFL08-16-D12 AV795147;AV826484;AY056165 putative protein
7 4 12 8 RAFL08-16-A10 BP561606 Experimental RAFL08-16-A10 AV795107;BP561606;AY050843 xylulose kinase
7 4 12 9 RAFL08-16-D08 AY056280 Experimental RAFL08-16-D08 AV795145;AV826483;AY056280 unknown protein
7 4 12 10 RAFL08-16-B06 AY050822 Experimental RAFL08-16-B06 AV795118;AV826477;AY050822
7 4 12 11 RAFL08-15-B22 AY063948 Experimental RAFL08-15-B22 AV794898;AV826437;AY063948 putative mitochondrial carrier protein
7 4 12 12 RAFL08-15-I20 AY050951 Experimental RAFL08-15-I20 AV794998;AY050951 Yippee-like protein
7 4 12 13 RAFL08-15-P18 AY056162 Experimental RAFL08-15-P18 AV795099;AV826472;AY056162
7 4 12 14 RAFL08-15-A18 BP561598 Experimental RAFL08-15-A18 AV794882;BP561598;AY056242 putative endomembrane protein EMP70 precusor isolog (At1g10950)
7 4 13 1 RAFL09-07-F06 BP561658 Experimental RAFL09-07-F06 AV796288;BP561658;AY059911 unknown protein
7 4 13 2 RAFL09-07-C06 AY120776 Experimental RAFL09-07-C06 AV796238;AV826777;AY120776 putative photosystem II type I chlorophyll a/b binding protein.
7 4 13 3 RAFL09-07-E05 AY059909 Experimental RAFL09-07-E05 AV796272;AV826796;AY059909 vacuolar-type H+-ATPase subunit A (VHA-A)
7 4 13 4 RAFL09-07-B04 AY062616 Experimental RAFL09-07-B04 AV796221;AV826770;AY062616 vacuolar-type H+-ATPase subunit B3 (VHA-B3)
7 4 13 5 RAFL09-07-A03 AY062614 Experimental RAFL09-07-A03 AV796207;AV826762;AY062614 tubulin beta-2/beta-3 chain (sp|P29512)
7 4 13 6 RAFL09-07-B02 AV826769 Experimental RAFL09-07-B02 AV796220;AV826769 bZIP protein BZO2H2
7 4 13 7 RAFL09-06-D22 AY120774 Experimental RAFL09-06-D22 AV796022;AV826673;AY120774 unknown protein (At1g79690)
7 4 13 8 RAFL09-06-A22 AY062758 Experimental RAFL09-06-A22 AV795984;AV826650;AY062758 60S RIBOSOMAL PROTEIN L7A protein
7 4 13 9 RAFL09-06-N21 AY062609 Experimental RAFL09-06-N21 AV796176;AV826748;AY062609 unknown protein
7 4 13 10 RAFL09-06-K21 AY062612 Experimental RAFL09-06-K21 AV796129;AV826720;AY062612 putative protein
7 4 13 11 RAFL09-06-B21 AY062755 Experimental RAFL09-06-B21 AV795996;AV826659;AY062755 unknown protein
7 4 13 12 RAFL09-06-K20 AY062754 Experimental RAFL09-06-K20 AV796128;AV826719;AY062754 Unknown protein (T12C24.22)
7 4 13 13 RAFL09-06-C18 AY062747 Experimental RAFL09-06-C18 AV796007;AV826664;AY062747 putative potassium transporter
7 4 13 14 RAFL09-06-K17 BT002403 Experimental RAFL09-06-K17 AV796126;AV826718;BT002403 unknown protein
7 4 14 1 RAFL09-10-L06 AY058165 Experimental RAFL09-10-L06 AV797081;AV827035;AY058165 unknown protein
7 4 14 2 RAFL09-10-F06 AV826994 Experimental RAFL09-10-F06 AV796983;AV826994;AF462826 unknown protein
7 4 14 3 RAFL09-10-H03 BP561681 Experimental RAFL09-10-H03 AV797015;BP561681;AY058202 putative thioredoxin
7 4 14 4 RAFL09-10-N02 AY058194 Experimental RAFL09-10-N02 AV797111;AV827052;AY058194 signal response protein (GAI)
7 4 14 5 RAFL09-10-I02 AY058180 Experimental RAFL09-10-I02 AV797030;AV827012;AY058180 putative protein
7 4 14 6 RAFL09-10-E02 AV826988 Experimental RAFL09-10-E02 AV796959;AV826988 vacuolar-type H+-ATPase subunit A (VHA-A)
7 4 14 7 RAFL09-10-A02 AY058168 Experimental RAFL09-10-A02 AV796901;AV826970;AY058168 unknown protein
7 4 14 8 RAFL09-10-L01 AY069873 Experimental RAFL09-10-L01 AV797078;AV827033;AY069873 unknown protein
7 4 14 9 RAFL09-07-A19 BT002393 Experimental RAFL09-07-A19 AV796217;AV826767;BT002393 PRT1
7 4 14 10 RAFL09-07-A18 AV826766 Experimental RAFL09-07-A18 AV796216;AV826766 unknown protein
7 4 14 11 RAFL09-07-E15 AY120767 Experimental RAFL09-07-E15 AV796277;AV826799;AY120767 xylosidase
7 4 14 12 RAFL09-07-B15 AY062622 Experimental RAFL09-07-B15 AV796229;AV826774;AY062622 putative 60S ribosomal protein L6
7 4 14 13 RAFL09-07-D13 AY062621 Experimental RAFL09-07-D13 AV796259;AV826789;AY062621 fatty acid multifunctional protein (AtMFP2)
7 4 14 14 RAFL09-07-D12 AY062625 Experimental RAFL09-07-D12 AV796258;AV826788;AY062625 NAD dependent epimerase, putative
8 1 1 1 RAFL06-07-O17 AY059931 Experimental RAFL06-07-O17 AV784746;AV823717;AY059931 Unknown protein (A_TM021B04.14)
8 1 1 2 RAFL06-07-N12 AY062807 Experimental RAFL06-07-N12 AV784736;AV823712;AY062807 unknown protein
8 1 1 3 RAFL06-07-L14 BT002441 Experimental RAFL06-07-L14 AV784725;AV823705;BT002441 putative rubisco subunit binding-protein alpha subunit
8 1 1 4 RAFL06-07-J21 AY065134 Experimental RAFL06-07-J21 AV784713;AV823693;AY065134 malate dehydrogenase like protein
8 1 1 5 RAFL06-08-O23 AV823804 Experimental RAFL06-08-O23 AV784858;AV823804 putative Tub family protein
8 1 1 6 RAFL06-08-K11 AY065133 Experimental RAFL06-08-K11 AV784825;AV823775;AY065133 unknown protein
8 1 1 7 RAFL06-07-J20 AY059927 Experimental RAFL06-07-J20 AV784712;AV823692;AY059927 putative nonspecific lipid-transfer protein
8 1 1 8 RAFL06-08-O17 AY062799 Experimental RAFL06-08-O17 AV784857;AV823803;AY062799 unknown protein
8 1 1 9 RAFL06-08-M01 AY065128 Experimental RAFL06-08-M01 AV784834;AV823782;AY065128 laccase (diphenol oxidase)-like protein
8 1 1 10 RAFL06-08-I23 AY062797 Experimental RAFL06-08-I23 AV784815;AV823770;AY062797 germin - like protein
8 1 1 11 RAFL06-08-F10 AY072344 Experimental RAFL06-08-F10 AV784793;AV823755;AY072344 plastid ribosomal protein S6, putative
8 1 1 12 RAFL06-08-C12 AY128407 Experimental RAFL06-08-C12 AV784774;AV823739;AY128407 putative protein
8 1 1 13 RAFL06-08-F08 AY062792 Experimental RAFL06-08-F08 AV784792;AV823754;AY062792 Unknown protein (At1g06200; F9P14.6)
8 1 1 14 RAFL06-08-C09 AY065124 Experimental RAFL06-08-C09 AV784773;AV823738;AY065124 dehydroascorbate reductase, putative
8 1 2 1 RAFL06-15-K24 AY126995 Experimental RAFL06-15-K24 AV785372;AV824186;AY126995 transport protein particle component Bet3p-like protein
8 1 2 2 RAFL06-15-I18 AY127000 Experimental RAFL06-15-I18 AV785362;AV824179;AY127000 40S ribosomal protein S26
8 1 2 3 RAFL06-13-K18 AY093774 Experimental RAFL06-13-K18 AV785262;AV824113;AY093774 unknown protein
8 1 2 4 RAFL06-15-P02 AV785399 Experimental RAFL06-15-P02 AV785399 putative protein
8 1 2 5 RAFL06-13-G20 AY126997 Experimental RAFL06-13-G20 AV785234;AV824088;AY126997 transcription factor like protein
8 1 2 6 RAFL06-13-E17 AY070749 Experimental RAFL06-13-E17 AV824078;AY070749 histon H3 protein
8 1 2 7 RAFL06-13-A19 AY070744 Experimental RAFL06-13-A19 AV785206;AY070744 sucrose cleavage protein -like
8 1 2 8 RAFL06-12-P13 AY070728 Experimental RAFL06-12-P13 AV785195;AV824056;AY070728 pyruvate dehydrogenase E1 component beta subunit, mitochondrial precursor (PDHE1-B) (sp|Q38799)
8 1 2 9 RAFL06-08-C18 AY062816 Experimental RAFL06-08-C18 AV784776;AV823741;AY062816 peroxidase, prxr2
8 1 2 10 RAFL06-08-B14 AY062815 Experimental RAFL06-08-B14 AV784767;AV823733;AY062815 putative calcium binding protein
8 1 2 11 RAFL06-08-A02 AY062814 Experimental RAFL06-08-A02 AV784758;AY062814 chlorophyll a/b-binding protein
8 1 2 12 RAFL06-07-O18 BT002444 Experimental RAFL06-07-O18 AV784747;AV823718;BT002444 RNA helicase -like protein
8 1 2 13 RAFL06-07-N14 AY065139 Experimental RAFL06-07-N14 AV784737;AV823713;AY065139 putative glycine-rich protein
8 1 2 14 RAFL06-09-C11 AV823819 Experimental RAFL06-09-C11 AV784878;AV823819 serine/threonine kinase - like protein
8 1 3 1 RAFL06-15-O09 AY070735 Experimental RAFL06-15-O09 AV785391;AV824200;AY070735 unknown protein
8 1 3 2 RAFL06-13-F04 AY093769 Experimental RAFL06-13-F04 AV785226;AV824081;AY093769 putative protein
8 1 3 3 RAFL06-13-D11 AY139761 Experimental RAFL06-13-D11 AV785216;AV824072;AY139761 hypothetical protein
8 1 3 4 RAFL06-13-B01 AV824068 Experimental RAFL06-13-B01 AV785208;AV824068 carbonic anhydrase, chloroplast precursor
8 1 3 5 RAFL06-13-O09 AY127002 Experimental RAFL06-13-O09 AV785286;AV824129;AY127002 ubiquitin-specific protease 24 (UBP24)
8 1 3 6 RAFL06-13-M17 AY072543 Experimental RAFL06-13-M17 AV785276;AY072543 putative transcription factor (MYB3)
8 1 3 7 RAFL06-16-A17 BP561197 Experimental RAFL06-16-A17 AV785410;BP561197
8 1 3 8 RAFL06-13-H21 AY070733 Experimental RAFL06-13-H21 AV785245;AV824096;AY070733 RNA binding like protein
8 1 3 9 RAFL06-13-G22 AY070747 Experimental RAFL06-13-G22 AV785236;AV824089;AY070747
8 1 3 10 RAFL06-15-L11 AY126998 Experimental RAFL06-15-L11 AY126998 unknown protein
8 1 3 11 RAFL06-16-C13 AY093772 Experimental RAFL06-16-C13 AV785418;AV824220;AY093772 choline kinase GmCK2p -like protein
8 1 3 12 RAFL06-16-A16 AV824214 Experimental RAFL06-16-A16 AV785409;AV824214 phosphoprotein phosphatase 1
8 1 3 13 RAFL06-15-P09 AY070734 Experimental RAFL06-15-P09 AV785400;AV824207;AY070734
8 1 3 14 RAFL06-15-M19 AY125508 Experimental RAFL06-15-M19 AV785382;AV824193;AY125508 cytokinin synthase (AtIPT3)
8 1 4 1 RAFL07-10-I01 AY050800 Experimental RAFL07-10-I01 AV791434;AV825510;AY050800 transformer-SR ribonucleoprotein, putative
8 1 4 2 RAFL07-10-E01 AY050899 Experimental RAFL07-10-E01 AV791367;AV825477;AY050899 putative protein
8 1 4 3 RAFL07-09-K24 BP561434 Experimental RAFL07-09-K24 AV791258;BP561434;AY142545 GTP cyclohydrolase II; 3,4-dihydroxy-2-butanone-4-phoshate synthase (emb|CAA03884.1)
8 1 4 4 RAFL07-09-G24 AY056260 Experimental RAFL07-09-G24 AV791216;AV825408;AY056260 putative protein
8 1 4 5 RAFL07-09-L23 AY059730 Experimental RAFL07-09-L23 AV791269;AV825431;AY059730
8 1 4 6 RAFL07-09-M22 AY059752 Experimental RAFL07-09-M22 AV791279;AV825436;AY059752 putative protein
8 1 4 7 RAFL07-09-P18 BT000693 Experimental RAFL07-09-P18 AV791312;BP561437;BT000693 ribosomal protein S6 - like
8 1 4 8 RAFL07-09-L18 AY050968 Experimental RAFL07-09-L18 AV791265;AV825429;AY050968 glycerol-3-phosphate dehydrogenase like protein
8 1 4 9 RAFL07-09-A18 AY045906 Experimental RAFL07-09-A18 AV791142;AV825384;AY045906 putative zinc finger protein (At1g51600)
8 1 4 10 RAFL07-09-A17 AY050794 Experimental RAFL07-09-A17 AV791141;AV825383;AY050794 putative protein
8 1 4 11 RAFL07-09-K16 AY045888 Experimental RAFL07-09-K16 AV791254;AV825425;AY045888
8 1 4 12 RAFL07-09-E16 AY056205 Experimental RAFL07-09-E16 AV791187;AV825396;AY056205 unknown protein (F14G9.10)
8 1 4 13 RAFL06-13-L01 AY093773 Experimental RAFL06-13-L01 AV785265;AV824115;AY093773 unknown protein
8 1 4 14 RAFL06-15-P12 AY070753 Experimental RAFL06-15-P12 AV785402;AV824209;AY070753 putative protein
8 1 5 1 RAFL07-14-K02 AY054471 Experimental RAFL07-14-K02 AV792355;AV825774;AY054471
8 1 5 2 RAFL07-14-N01 BP561477 Experimental RAFL07-14-N01 AV792395;BP561477;AY059839 unknown protein
8 1 5 3 RAFL07-10-K10 BT000685 Experimental RAFL07-10-K10 AV791469;BT000685 ferredoxin--nitrite reductase
8 1 5 4 RAFL07-10-I10 AY056298 Experimental RAFL07-10-I10 AV791440;AV825515;AY056298 unknown protein
8 1 5 5 RAFL07-10-D10 AY056295 Experimental RAFL07-10-D10 AV791359;AV825474;AY056295 polyubiquitin (ubq10)
8 1 5 6 RAFL07-10-B10 AV825459 Experimental RAFL07-10-B10 AV791333;AV825459
8 1 5 7 RAFL07-10-N09 AY045891 Experimental RAFL07-10-N09 AV791516;AV825552;AY045891 unknown protein
8 1 5 8 RAFL07-10-K09 BT000809 Experimental RAFL07-10-K09 AV791468;AV825530;BT000809 unknown protein
8 1 5 9 RAFL07-10-O06 BT000800 Experimental RAFL07-10-O06 AV791530;AV825555;BT000800 P-Protein - like protein
8 1 5 10 RAFL07-10-I06 BP561442 Experimental RAFL07-10-I06 AV791437;BP561442;AY080681 H+-transporting ATP synthase beta chain (mitochondrial) -like protein
8 1 5 11 RAFL07-10-F06 AY050962 Experimental RAFL07-10-F06 AV791385;AV825487;AY050962 putative TATA binding protein-associated factor (F13M7.6)
8 1 5 12 RAFL07-10-A06 AY050781 Experimental RAFL07-10-A06 AV791317;AV825452;AY050781 putative cyclin
8 1 5 13 RAFL07-10-K05 AY045865 Experimental RAFL07-10-K05 AV791464;AV825528;AY045865 xyloglucan endotransglycosylase-related protein XTR-7
8 1 5 14 RAFL07-10-D05 BT000677 Experimental RAFL07-10-D05 AV791354;AV825470;BT000677 putative protein
8 1 6 1 RAFL07-14-H20 BP561475 Experimental RAFL07-14-H20 AV792325;BP561475;AY062461 protein kinase
8 1 6 2 RAFL07-14-A20 AY054482 Experimental RAFL07-14-A20 AV792228;AV825749;AY054482 endoplasmic reticulum alpha-mannosidase, putative
8 1 6 3 RAFL07-14-L19 AY054523 Experimental RAFL07-14-L19 AV792377;AV825780;AY054523 30S ribosomal protein S5
8 1 6 4 RAFL07-14-L18 AV825779 Experimental RAFL07-14-L18 AV792376;AV825779 putative protein
8 1 6 5 RAFL07-14-F14 BP561471 Experimental RAFL07-14-F14 AV792293;BP561471 receptor-like serine/threonine kinase, putative
8 1 6 6 RAFL07-14-G13 AY062451 Experimental RAFL07-14-G13 AV792309;AV825763;AY062451 unknown protein
8 1 6 7 RAFL07-14-M12 AY062528 Experimental RAFL07-14-M12 AV792387;AV825781;AY062528 thioredoxin, putative
8 1 6 8 RAFL07-14-A11 AY062449 Experimental RAFL07-14-A11 AV792222;AV825746;AY062449 cdc2-like protein kinase
8 1 6 9 RAFL07-14-O09 AY054522 Experimental RAFL07-14-O09 AV792413;AV825789;AY054522 fucosyltransferase c3 protein, putative
8 1 6 10 RAFL07-14-J09 BT003335 Experimental RAFL07-14-J09 AV792344;AV825771;BT003335 unknown protein
8 1 6 11 RAFL07-14-P05 AY062444 Experimental RAFL07-14-P05 AV792420;AV825793;AY062444 unknown protein
8 1 6 12 RAFL07-14-J05 AY062442 Experimental RAFL07-14-J05 AV792342;AV825770;AY062442 unknown protein
8 1 6 13 RAFL07-14-P04 AV825792 Experimental RAFL07-14-P04 AV792419;AV825792 Na+/H+ exchanger (NHX1)
8 1 6 14 RAFL07-14-P03 AY054473 Experimental RAFL07-14-P03 AV792418;AV825791;AY054473 oxysterol-binding protein - like
8 1 7 1 RAFL08-08-E08 AY052364 Experimental RAFL08-08-E08 AV793374;AV826040;AY052364 casein kinase I
8 1 7 2 RAFL08-08-G07 AY052360 Experimental RAFL08-08-G07 AV793402;AV826049;AY052360
8 1 7 3 RAFL08-08-D06 AY045656 Experimental RAFL08-08-D06 AV793362;AV826036;AY045656 putative calcium-binding protein, calreticulin
8 1 7 4 RAFL08-08-E05 AY050409 Experimental RAFL08-08-E05 AV793372;AV826039;AY050409 unknown protein (At1g50630)
8 1 7 5 RAFL08-08-A05 AY045647 Experimental RAFL08-08-A05 AV793330;AV826029;AY045647 subtilisin-like serine protease AIR3
8 1 7 6 RAFL08-08-D04 AY050399 Experimental RAFL08-08-D04 AV793360;AV826035;AY050399 unknown protein
8 1 7 7 RAFL07-15-L05 BP561484 Experimental RAFL07-15-L05 AV792585;BP561484;AY072332 unknown protein
8 1 7 8 RAFL07-15-D05 BP561481 Experimental RAFL07-15-D05 AV792470;BP561481
8 1 7 9 RAFL07-15-F04 AY065073 Experimental RAFL07-15-F04 AV792499;AV825816;AY065073 putative protein
8 1 7 10 RAFL07-15-B04 AY128382 Experimental RAFL07-15-B04 AV792445;AY128382 telomere repeat-binding protein
8 1 7 11 RAFL07-15-O03 AY062644 Experimental RAFL07-15-O03 AV792621;AV825849;AY062644 similar to latex allergen from Hevea brasiliensis
8 1 7 12 RAFL07-15-G03 AY059844 Experimental RAFL07-15-G03 AV792512;AV825820;AY059844 receptor-like protein kinase
8 1 7 13 RAFL07-14-J21 AY054483 Experimental RAFL07-14-J21 AV792351;AV825773;AY054483 unknown protein
8 1 7 14 RAFL07-14-F21 AY062467 Experimental RAFL07-14-F21 AV792298;AV825762;AY062467 unknown protein
8 1 8 1 RAFL08-09-K08 AY045645 Experimental RAFL08-09-K08 AV793660;AV826125;AY045645
8 1 8 2 RAFL08-09-G07 AY050396 Experimental RAFL08-09-G07 AV793598;AV826107;AY050396 putative protein
8 1 8 3 RAFL08-09-D04 AY045670 Experimental RAFL08-09-D04 AV793557;AV826095;AY045670 unknown protein
8 1 8 4 RAFL08-09-G03 AY052359 Experimental RAFL08-09-G03 AV793594;AV826106;AY052359 unknown protein
8 1 8 5 RAFL08-09-J02 AY045652 Experimental RAFL08-09-J02 AV793640;AV826119;AY045652 putative protein
8 1 8 6 RAFL08-09-M01 AY045648 Experimental RAFL08-09-M01 AV793684;AY045648 unknown protein
8 1 8 7 RAFL08-08-J24 AY050406 Experimental RAFL08-08-J24 AV793442;AV826062;AY050406
8 1 8 8 RAFL08-08-H23 BP561522 Experimental RAFL08-08-H23 AV793422;BP561522;AY045642 twin LOV protein 1 (TLP1)
8 1 8 9 RAFL08-08-P16 AY056100 Experimental RAFL08-08-P16 AV793510;AV826079;AY056100 putative protein
8 1 8 10 RAFL08-08-L16 AY045667 Experimental RAFL08-08-L16 AV793459;AV826067;AY045667 putative protein
8 1 8 11 RAFL08-08-I16 AY045653 Experimental RAFL08-08-I16 AV793429;AV826057;AY045653 putative protein
8 1 8 12 RAFL08-08-I15 AY050416 Experimental RAFL08-08-I15 AV793428;AY050416 unknown protein
8 1 8 13 RAFL08-08-O14 AY056097 Experimental RAFL08-08-O14 AV793498;AV826076;AY056097 unknown protein
8 1 8 14 RAFL08-08-H14 AY045639 Experimental RAFL08-08-H14 AV793418;AV826054;AY045639 unknown protein
8 1 9 1 RAFL08-13-C17 BT000707 Experimental RAFL08-13-C17 AV794504;AV826350;BT000707 putative protein
8 1 9 2 RAFL08-13-J16 AY045879 Experimental RAFL08-13-J16 AV794604;AV826371;AY045879 putative lipid transfer protein (F11I4_8)
8 1 9 3 RAFL08-13-D16 AY090965 Experimental RAFL08-13-D16 AV794519;AV826355;AY090965
8 1 9 4 RAFL08-13-N15 AY050919 Experimental RAFL08-13-N15 AV794667;AV826387;AY050919 unknown protein
8 1 9 5 RAFL08-13-F10 AY050964 Experimental RAFL08-13-F10 AV794547;AV826357;AY050964 unknown protein
8 1 9 6 RAFL08-13-L09 AY050946 Experimental RAFL08-13-L09 AV794635;AV826379;AY050946 putative CCR4-associated factor protein
8 1 9 7 RAFL08-13-D09 AY056320 Experimental RAFL08-13-D09 AV794513;AV826352;AY056320 calreticulin like protein
8 1 9 8 RAFL08-13-D08 AY056287 Experimental RAFL08-13-D08 AV794512;AY056287 phytoene synthase (gb|AAB65697.1)
8 1 9 9 RAFL08-13-M07 AY056275 Experimental RAFL08-13-M07 AV794647;AV826381;AY056275 protein transport protein SEC23
8 1 9 10 RAFL08-13-D07 BP561578 Experimental RAFL08-13-D07 AV794511;BP561578;AY074378 beta-glucosidase, putative
8 1 9 11 RAFL08-09-I10 BP561530 Experimental RAFL08-09-I10 AV793632;BP561530;AY050423 putative 26S protease regulatory subunit 6A
8 1 9 12 RAFL08-09-C10 AY045663 Experimental RAFL08-09-C10 AV793546;AV826091;AY045663 unknown protein
8 1 9 13 RAFL08-09-K09 AY050420 Experimental RAFL08-09-K09 AV793661;AV826126;AY050420 unknown protein
8 1 9 14 RAFL08-09-E09 AY050408 Experimental RAFL08-09-E09 AV793572;AV826099;AY050408 unknown protein
8 1 10 1 RAFL08-14-E18 AY059741 Experimental RAFL08-14-E18 AV794749;AV826403;AY059741 calcium lipid binding protein - like
8 1 10 2 RAFL08-14-N17 AY050949 Experimental RAFL08-14-N17 AV794850;AV826424;AY050949 unknown protein
8 1 10 3 RAFL08-14-K16 AY056328 Experimental RAFL08-14-K16 AV794814;AV826416;AY056328 unknown protein
8 1 10 4 RAFL08-14-L15 BP561595 Experimental RAFL08-14-L15 AV794826;BP561595 receptor-like protein kinase - like protein
8 1 10 5 RAFL08-14-P13 AY056278 Experimental RAFL08-14-P13 AV794864;AV826428;AY056278 putative protein
8 1 10 6 RAFL08-14-K11 AY050921 Experimental RAFL08-14-K11 AV794809;AV826415;AY050921 putative 1-aminocyclopropane-1-carboxylate oxidase
8 1 10 7 RAFL08-14-M04 AY059738 Experimental RAFL08-14-M04 AV794832;AV826421;AY059738 unknown protein
8 1 10 8 RAFL08-14-E03 BT000737 Experimental RAFL08-14-E03 AV794739;AV826402;BT000737 unknown protein
8 1 10 9 RAFL08-14-B03 AY059771 Experimental RAFL08-14-B03 AV794704;AY059771 unknown protein
8 1 10 10 RAFL08-14-L02 AY056289 Experimental RAFL08-14-L02 AV794819;AV826418;AY056289 calmodulin-binding protein
8 1 10 11 RAFL08-14-D02 BT000697 Experimental RAFL08-14-D02 AV794725;AV826400;BT000697 GDP-mannose pyrophosphorylase
8 1 10 12 RAFL08-14-D01 AY064014 Experimental RAFL08-14-D01 AV794724;AV826399;AY064014 unknown protein
8 1 10 13 RAFL08-13-D19 BP561579 Experimental RAFL08-13-D19 AV794522;BP561579 cleft lip and palate associated transmembrane protein-like
8 1 10 14 RAFL08-13-J18 BP561582 Experimental RAFL08-13-J18 AV794606;BP561582;AY063944 putative disease resistance protein
8 1 11 1 RAFL09-06-G11 AY062701 Experimental RAFL09-06-G11 AV796062;AV826690;AY062701 unknown protein
8 1 11 2 RAFL09-06-L10 AV826725 Experimental RAFL09-06-L10 AV796137;AV826725 eukaryotic translation initiation factor 3 subunit 7
8 1 11 3 RAFL09-06-J08 AY062696 Experimental RAFL09-06-J08 AV796102;AV826709;AY062696 putative protein
8 1 11 4 RAFL09-06-K07 AY062564 Experimental RAFL09-06-K07 AV796118;AV826717;AY062564 putative Na+-dependent inorganic phosphate cotransporter
8 1 11 5 RAFL09-06-D07 AY062569 Experimental RAFL09-06-D07 AV796016;AV826669;AY062569 unknown protein
8 1 11 6 RAFL09-06-K06 AY081321 Experimental RAFL09-06-K06 AV796117;AV826716;AY081321 unknown protein
8 1 11 7 RAFL09-06-I06 AY062695 Experimental RAFL09-06-I06 AV796092;AV826705;AY062695 unknown protein
8 1 11 8 RAFL09-06-D06 AY062693 Experimental RAFL09-06-D06 AV796015;AV826668;AY062693 valyl tRNA synthetase (valRS)
8 1 11 9 RAFL09-06-H02 AY062559 Experimental RAFL09-06-H02 AV796073;AV826697;AY062559 receptor-like protein kinase
8 1 11 10 RAFL09-06-F02 AY062557 Experimental RAFL09-06-F02 AV796041;AV826683;AY062557 unknown protein
8 1 11 11 RAFL09-06-C02 AY059879 Experimental RAFL09-06-C02 AV795999;AV826660;AY059879 PSI type III chlorophyll a/b-binding protein
8 1 11 12 RAFL09-06-A02 AY059878 Experimental RAFL09-06-A02 AV795968;AV826645;AY059878 epsin-like protein
8 1 11 13 RAFL09-06-I01 AY059877 Experimental RAFL09-06-I01 AV796089;AV826703;AY059877 ABC transporter-like
8 1 11 14 RAFL08-19-F24 BT000433 Experimental RAFL08-19-F24 AV795835;AV826621;BT000433 integral membrane protein, putative
8 1 12 1 RAFL09-09-M10 AY058867 Experimental RAFL09-09-M10 AV796840;AV826946;AY058867
8 1 12 2 RAFL09-09-I10 AY058855 Experimental RAFL09-09-I10 AV796765;AV826912;AY058855 unknown protein
8 1 12 3 RAFL09-09-N09 AY057496 Experimental RAFL09-09-N09 AV796856;AV826953;AY057496 UDP-glucose:sterol glucosyltransferase
8 1 12 4 RAFL09-09-I09 AY058834 Experimental RAFL09-09-I09 AV796764;AV826911;AY058834 unknown protein
8 1 12 5 RAFL09-06-H16 AY059890 Experimental RAFL09-06-H16 AV796082;AV826701;AY059890 unknown protein
8 1 12 6 RAFL09-06-E16 AV826681 Experimental RAFL09-06-E16 AV796036;AV826681 putative glycine dehydrogenase
8 1 12 7 RAFL09-06-M15 AY059889 Experimental RAFL09-06-M15 AV796151;AV826733;AY059889 beta glucosidase like protein
8 1 12 8 RAFL09-06-G15 AY062709 Experimental RAFL09-06-G15 AV796065;AV826692;AY062709 similar to 26S proteasome AAA-ATPase subunit RPT4a gb|AAF22524.1; similar to ESTs dbj|AB015110.1, gb|AW443504.1, gb|AI732054.1, gb|AW030587.1, gb|AI812922.1, gb|AW442076.1, gb|AI997275.1, emb|Z17563.1
8 1 12 9 RAFL09-06-C15 AY092980 Experimental RAFL09-06-C15 AV796005;AV826663;AY092980 chlorophyll a/b-binding protein CP29
8 1 12 10 RAFL09-06-P14 AY128392 Experimental RAFL09-06-P14 AV796200;AV826756;AY128392 unknown protein
8 1 12 11 RAFL09-06-H12 AY062573 Experimental RAFL09-06-H12 AV796079;AV826700;AY062573 cytochrome P450, putative
8 1 12 12 RAFL09-06-F12 AY062571 Experimental RAFL09-06-F12 AV796048;AV826686;AY062571 putative protein
8 1 12 13 RAFL09-06-O11 AY059887 Experimental RAFL09-06-O11 AV796183;AV826749;AY059887 mRNA binding protein precursor - like
8 1 12 14 RAFL09-06-M11 AV826731 Experimental RAFL09-06-M11 AV796149;AV826731 photomorphogenesis repressor (COP1)
8 1 13 1 RAFL09-09-H20 AY070136 Experimental RAFL09-09-H20 AV796754;AV826905;AY070136 unknown protein
8 1 13 2 RAFL09-09-D20 AY058883 Experimental RAFL09-09-D20 AV796682;AV826882;AY058883 unknown protein
8 1 13 3 RAFL09-09-I19 AY058868 Experimental RAFL09-09-I19 AV796771;AV826916;AY058868 putative alanine aminotransferase
8 1 13 4 RAFL09-09-D19 AY058860 Experimental RAFL09-09-D19 AV796681;AY058860 putative protein
8 1 13 5 RAFL09-09-A19 AY058843 Experimental RAFL09-09-A19 AV796630;AV826862;AY058843 gda-1, putative
8 1 13 6 RAFL09-09-M18 AY057491 Experimental RAFL09-09-M18 AV796847;AV826949;AY057491 Mutator-like transposase
8 1 13 7 RAFL09-09-N16 AY058886 Experimental RAFL09-09-N16 AV796860;AY058886 flavanone 3-hydroxylase (FH3)
8 1 13 8 RAFL09-09-K16 AY058876 Experimental RAFL09-09-K16 AV796807;AY058876 mitochondrial carrier - like protein
8 1 13 9 RAFL09-09-I16 AY070133 Experimental RAFL09-09-I16 AV796768;AV826914;AY070133 cobalamin biosynthesis protein
8 1 13 10 RAFL09-09-P15 AY058863 Experimental RAFL09-09-P15 AV796894;AV826966;AY058863 unknown protein
8 1 13 11 RAFL09-09-K15 BP561676 Experimental RAFL09-09-K15 AV796806;BP561676;AY058849 acyl-CoA oxidase like protein
8 1 13 12 RAFL09-09-C15 AY058838 Experimental RAFL09-09-C15 AV796661;AV826877;AY058838 UDP-glucose:indole-3-acetate beta-D-glucosyltransferase (iaglu)
8 1 13 13 RAFL09-09-N11 AY058889 Experimental RAFL09-09-N11 AV796857;AV826954;AY058889 ubiquitin-specific protease (AtUBP3)
8 1 13 14 RAFL09-09-I11 AY058875 Experimental RAFL09-09-I11 AV796766;AV826913;AY058875 farnesylated protein - like
8 1 14 1 RAFL09-13-F04 AV827276 Experimental RAFL09-13-F04 AV797726;AV827276;AF367266 beta-xylosidase, putative
8 1 14 2 RAFL09-13-M03 AV827303 Experimental RAFL09-13-M03 AV797790;AV827303;AF361803 putative aminolevulinate dehydratase
8 1 14 3 RAFL09-12-F24 AV827200 Experimental RAFL09-12-F24 AV797503;AV827200;AF361830
8 1 14 4 RAFL09-12-C23 AV827177 Experimental RAFL09-12-C23 AV797452;AV827177;AF367287 unknown protein
8 1 14 5 RAFL09-12-I22 AV827214 Experimental RAFL09-12-I22 AV797546;AV827214;AF361823 unknown protein
8 1 14 6 RAFL09-12-A22 AV827165 Experimental RAFL09-12-A22 AV797419;AV827165;AF367275 putative protein
8 1 14 7 RAFL09-12-K21 BP561696 Experimental RAFL09-12-K21 AV797574;BP561696;AF367271 putative AT-hook DNA-binding protein
8 1 14 8 RAFL09-12-O20 AV827249 Experimental RAFL09-12-O20 AV797648;AV827249;AF367254 beta-VPE
8 1 14 9 RAFL09-09-K24 AY058890 Experimental RAFL09-09-K24 AV796813;AY058890 putative RNA helicase
8 1 14 10 RAFL09-09-C24 AY058881 Experimental RAFL09-09-C24 AV796666;AY058881 acetolactate synthase like protein
8 1 14 11 RAFL09-09-J23 AY057501 Experimental RAFL09-09-J23 AV796792;AV826928;AY057501 putative protein
8 1 14 12 RAFL09-09-M22 AY058862 Experimental RAFL09-09-M22 AV796851;AV826951;AY058862 unknown protein
8 1 14 13 RAFL09-09-I22 AY058851 Experimental RAFL09-09-I22 AV796773;AV826918;AY058851 CDPK-related kinase
8 1 14 14 RAFL09-09-E22 BP561672 Experimental RAFL09-09-E22 AV796701;BP561672;AY094460 phenylalanyl-trna synthetase - like protein
8 2 1 1 RAFL06-10-L13 BT002438 Experimental RAFL06-10-L13 AV785030;AV823939;BT002438 putative 60S ribosomal protein L1
8 2 1 2 RAFL06-10-E16 AV823914 Experimental RAFL06-10-E16 AV784999;AV823914 putative protein
8 2 1 3 RAFL06-11-O06 BT000460 Experimental RAFL06-11-O06 AV824007;BT000460 unknown protein
8 2 1 4 RAFL06-11-M15 AY065115 Experimental RAFL06-11-M15 AV785112;AV824001;AY065115 3-deoxy-D-manno-octulosonic acid transferase-like protein (MED24.5)
8 2 1 5 RAFL06-11-K13 BP561132 Experimental RAFL06-11-K13 AV785100;BP561132 hypothetical protein
8 2 1 6 RAFL06-11-J03 AY072336 Experimental RAFL06-11-J03 AV785090;AV823986;AY072336 unknown protein
8 2 1 7 RAFL06-11-F02 BT002431 Experimental RAFL06-11-F02 AV785069;AV823970;BT002431 unknown protein
8 2 1 8 RAFL06-10-O24 AY065113 Experimental RAFL06-10-O24 AV785045;AV823949;AY065113 putative protein
8 2 1 9 RAFL06-10-E11 AV823913 Experimental RAFL06-10-E11 AV784997;AV823913 unknown protein
8 2 1 10 RAFL06-10-D06 AY092993 Experimental RAFL06-10-D06 AV784987;AV823905;AY092993
8 2 1 11 RAFL06-11-M09 BT000458 Experimental RAFL06-11-M09 AV785110;BP561135;BT000458 unknown protein
8 2 1 12 RAFL06-11-G11 AY062775 Experimental RAFL06-11-G11 AV785079;AV823978;AY062775 unknown protein
8 2 1 13 RAFL06-11-I17 BT002421 Experimental RAFL06-11-I17 AV785089;AV823984;BT002421
8 2 1 14 RAFL06-11-A21 BP561126 Experimental RAFL06-11-A21 AV785051;BP561126;AY062771
8 2 2 1 RAFL06-15-C17 AY058123 Experimental RAFL06-15-C17 AV785336;AY058123 putative protein
8 2 2 2 RAFL06-15-B04 AY070759 Experimental RAFL06-15-B04 AV785328;AV824160;AY070759 aspartate-semialdehyde dehydrogenase, putative
8 2 2 3 RAFL06-12-C18 GGCTCAAAATATTGAATCATTATAACAAAAGATCTCTCATAAAGGAACAGTACAAATGAACACAATTCATGTGAGTTATT Experimental RAFL06-12-C18
8 2 2 4 RAFL06-12-I17 AY058146 Experimental RAFL06-12-I17 AV785169;AV824037;AY058146 unknown protein
8 2 2 5 RAFL06-12-C16 BP561143 Experimental RAFL06-12-C16 AV785138;BP561143;AY070768 unknown protein
8 2 2 6 RAFL06-12-H01 AY058126 Experimental RAFL06-12-H01 AV785161;AY058126 putative calmodulin-binding protein
8 2 2 7 RAFL06-12-A10 AV824015 Experimental RAFL06-12-A10 AV785128;AV824015 31 kDa RNA binding protein (rbp31)
8 2 2 8 RAFL06-12-G22 AV824032 Experimental RAFL06-12-G22 AV785160;AV824032 unknown protein
8 2 2 9 RAFL06-10-J18 AY065121 Experimental RAFL06-10-J18 AV785023;AV823934;AY065121 ribosomal protein
8 2 2 10 RAFL06-10-F19 AY065120 Experimental RAFL06-10-F19 AV785009;AV823924;AY065120 dehydration-induced protein (ERD15)
8 2 2 11 RAFL06-10-D18 AV823909 Experimental RAFL06-10-D18 AV823909 putative protein
8 2 2 12 RAFL06-10-C16 AV823902 Experimental RAFL06-10-C16 AV784982;AV823902 unknown protein
8 2 2 13 RAFL06-11-K17 AY062785 Experimental RAFL06-11-K17 AV785102;AV823995;AY062785 carbonic anhydrase, chloroplast precursor
8 2 2 14 RAFL06-11-H07 AV785083 Experimental RAFL06-11-H07 AV785083 putative glycerol kinase
8 2 3 1 RAFL06-12-O04 AV824052 Experimental RAFL06-12-O04 AV785191;AV824052 lysyl-tRNA synthetase
8 2 3 2 RAFL06-15-B12 BP561181 Experimental RAFL06-15-B12 AV785329;BP561181 putative protein
8 2 3 3 RAFL06-14-N16 AY058122 Experimental RAFL06-14-N16 AV785323;AV824157;AY058122 putative protein
8 2 3 4 RAFL06-14-F12 AY058115 Experimental RAFL06-14-F12 AV785311;AV824147;AY058115 alpha-hydroxynitrile lyase-like protein
8 2 3 5 RAFL06-15-L20 AY058149 Experimental RAFL06-15-L20 AV785375;AV824187;AY058149 unknown protein
8 2 3 6 RAFL06-15-J06 AY058135 Experimental RAFL06-15-J06 AV785366;AV824182;AY058135 unknown protein
8 2 3 7 RAFL06-12-P24 AV824062 Experimental RAFL06-12-P24 AV785200;AV824062 nucleoid DNA-binding protein cnd41 - like protein
8 2 3 8 RAFL06-12-M05 AY070767 Experimental RAFL06-12-M05 AV785181;AV824046;AY070767 small nuclear ribonucleoprotein, putative
8 2 3 9 RAFL06-16-K06 AY058124 Experimental RAFL06-16-K06 AV785469;AY058124
8 2 3 10 RAFL06-16-I15 AV824248 Experimental RAFL06-16-I15 AV785458;AV824248 unknown protein
8 2 3 11 RAFL06-13-H05 AY058151 Experimental RAFL06-13-H05 AV785238;AY058151 fatty acid hydroxylase - like protein
8 2 3 12 RAFL06-13-F21 AY058143 Experimental RAFL06-13-F21 AV785228;AV824083;AY058143 unknown protein
8 2 3 13 RAFL06-13-B06 AV785210 Experimental RAFL06-13-B06 AV785210 glutamyl-tRNA synthetase
8 2 3 14 RAFL06-15-E17 AY058131 Experimental RAFL06-15-E17 AV785345;AV824170;AY058131
8 2 4 1 RAFL07-07-J20 AY059760 Experimental RAFL07-07-J20 AV790838;AV825276;AY059760 putative protein
8 2 4 2 RAFL07-07-E18 BP561401 Experimental RAFL07-07-E18 AV790782;BP561401 MAP kinase phosphatase (MKP1)
8 2 4 3 RAFL07-07-M17 BP561407 Experimental RAFL07-07-M17 AV790872;BP561407 ferredoxin-dependent glutamate synthase
8 2 4 4 RAFL07-07-C17 AY050778 Experimental RAFL07-07-C17 AV790760;AV825252;AY050778 putative phosphatidate cytidylyltransferase (T14P1.4/At2g45150)
8 2 4 5 RAFL07-07-K16 AY050981 Experimental RAFL07-07-K16 AV790851;AV825282;AY050981 calcium-dependent protein kinase
8 2 4 6 RAFL07-07-M15 AY056213 Experimental RAFL07-07-M15 AV790871;AV825288;AY056213 unknown protein
8 2 4 7 RAFL07-07-N10 AY050798 Experimental RAFL07-07-N10 AV790880;AV825290;AY050798 polygalacturonase PG1, putative
8 2 4 8 RAFL07-07-N09 AY056140 Experimental RAFL07-07-N09 AV790879;AY056140 putative NADH dehydrogenase (ubiquinone) 76K chain precursor protein
8 2 4 9 RAFL07-07-D09 AY056293 Experimental RAFL07-07-D09 AV790766;AV825256;AY056293 putative retinoblastoma-associated protein
8 2 4 10 RAFL07-07-L08 AY080844 Experimental RAFL07-07-L08 AV790859;AY080844 putative protein
8 2 4 11 RAFL07-07-A08 AY045887 Experimental RAFL07-07-A08 AV790743;AV825246;AY045887 putative protein
8 2 4 12 RAFL07-07-H07 AY056212 Experimental RAFL07-07-H07 AV790812;AV825268;AY056212 unknown protein
8 2 4 13 RAFL06-13-E11 AY058148 Experimental RAFL06-13-E11 AV785219;AV824075;AY058148 putative protein
8 2 4 14 RAFL06-15-H16 BP561189 Experimental RAFL06-15-H16 AV785358;BP561189;AY058139 putative cinnamyl alcohol dehydrogenase
8 2 5 1 RAFL07-11-L11 AY054509 Experimental RAFL07-11-L11 AV791713;AV825610;AY054509 MAP kinase phosphatase (MKP1)
8 2 5 2 RAFL07-11-P07 AV825630 Experimental RAFL07-11-P07 AV791772;AV825630 hypothetical protein
8 2 5 3 RAFL07-08-B09 BT000785 Experimental RAFL07-08-B09 AV790924;AV825307;BT000785 pitrilysin
8 2 5 4 RAFL07-08-O08 BP561424 Experimental RAFL07-08-O08 AV791111;BP561424;AY050971 low affinity calcium antiporter CAX2
8 2 5 5 RAFL07-08-L08 AY050987 Experimental RAFL07-08-L08 AV791077;AV825358;AY050987 putative tyrosine aminotransferase
8 2 5 6 RAFL07-08-C08 AY045871 Experimental RAFL07-08-C08 AV790935;AV825310;AY045871 unknown protein
8 2 5 7 RAFL07-08-P07 AY074522 Experimental RAFL07-08-P07 AV791124;AV825376;AY074522 unknown protein
8 2 5 8 RAFL07-08-G07 AY057580 Experimental RAFL07-08-G07 AV791003;AV825331;AY057580 putative polyA-binding protein II
8 2 5 9 RAFL07-08-M04 AY056263 Experimental RAFL07-08-M04 AV791085;AV825363;AY056263 potassium transport protein-like
8 2 5 10 RAFL07-08-G04 BP561417 Experimental RAFL07-08-G04 AV791001;BP561417;AY059782 putative AP2 domain transcription factor
8 2 5 11 RAFL07-08-E03 AY050878 Experimental RAFL07-08-E03 AV790965;AV825316;AY050878 putative mitochondrial carrier protein
8 2 5 12 RAFL07-08-M02 AY050780 Experimental RAFL07-08-M02 AV791084;AV825362;AY050780 unknown protein
8 2 5 13 RAFL07-08-I02 AY050983 Experimental RAFL07-08-I02 AV791029;AV825340;AY050983 putative Helix pomatia br-1 protein (F3H7.11)
8 2 5 14 RAFL07-08-G02 BP561416 Experimental RAFL07-08-G02 AV791000;BP561416 apyrase (Atapy1)
8 2 6 1 RAFL07-12-A06 BT002049 Experimental RAFL07-12-A06 AV791787;AV825633;BT002049 unknown protein
8 2 6 2 RAFL07-12-H05 BT002051 Experimental RAFL07-12-H05 AV791886;AV825662;BT002051 unknown protein
8 2 6 3 RAFL07-12-K04 BT002052 Experimental RAFL07-12-K04 AV791927;AV825673;BT002052 t-complex polypeptide 1 homologue
8 2 6 4 RAFL07-12-E04 BT002410 Experimental RAFL07-12-E04 AV791843;AV825649;BT002410 hypothetical protein
8 2 6 5 RAFL07-12-D01 AY065186 Experimental RAFL07-12-D01 AV791825;AV825641;AY065186 unknown protein
8 2 6 6 RAFL07-11-I24 AV825591 Experimental RAFL07-11-I24 AV791672;AV825591 unknown protein
8 2 6 7 RAFL07-11-P22 BP561460 Experimental RAFL07-11-P22 AV791782;BP561460;AY054467 putative glycogen synthase
8 2 6 8 RAFL07-11-O21 AY081296 Experimental RAFL07-11-O21 AV791766;AV825629;AY081296 vacuolar-type H+-ATPase subunit A (VHA-A)
8 2 6 9 RAFL07-11-K21 AY062439 Experimental RAFL07-11-K21 AV791703;AV825606;AY062439 putative glucanse
8 2 6 10 RAFL07-11-O20 BP561458 Experimental RAFL07-11-O20 AV791765;BP561458 unknown protein
8 2 6 11 RAFL07-11-O14 AY054462 Experimental RAFL07-11-O14 AV791760;AV825625;AY054462 putative pectinesterase
8 2 6 12 RAFL07-11-N12 AY054511 Experimental RAFL07-11-N12 AV791741;AV825620;AY054511 unknown protein
8 2 6 13 RAFL07-11-L12 AY062437 Experimental RAFL07-11-L12 AV791714;AV825611;AY062437 ribulose bisphosphate carboxylase small chain 2b precursor (RuBisCO small subunit 2b) (sp|P10797)
8 2 6 14 RAFL07-11-O11 BP561457 Experimental RAFL07-11-O11 AV791757;BP561457;AY054510 serine/threonine-protein kinase Mak (male germ cell-associated kinase)-like protein
8 2 7 1 RAFL07-16-F16 AY050381 Experimental RAFL07-16-F16 AV792729;AV825870;AY050381 aspartate carbamoyltransferase precursor (aspartate transcarbamylase)
8 2 7 2 RAFL07-16-P13 AY050380 Experimental RAFL07-16-P13 AV792853;AV825902;AY050380 disease resistance protein
8 2 7 3 RAFL07-16-L12 BP561500 Experimental RAFL07-16-L12 AV792802;BP561500;AY065026 protein phosphatase 2C-like
8 2 7 4 RAFL07-16-P10 AY045612 Experimental RAFL07-16-P10 AV792850;AV825900;AY045612 alcohol dehydrogenase
8 2 7 5 RAFL07-16-I10 AY045607 Experimental RAFL07-16-I10 AV792767;AV825875;AY045607 putative ribosomal protein S16
8 2 7 6 RAFL07-16-L09 AY045601 Experimental RAFL07-16-L09 AV792801;AV825884;AY045601 elicitor like protein
8 2 7 7 RAFL07-12-A12 AV825634 Experimental RAFL07-12-A12 AV791792;AV825634 putative protein
8 2 7 8 RAFL07-12-O11 AY128381 Experimental RAFL07-12-O11 AV791993;AV825697;AY128381 dihydroxyacetone kinase, putative
8 2 7 9 RAFL07-12-J11 BT002408 Experimental RAFL07-12-J11 AV791916;AV825670;BT002408 unknown protein
8 2 7 10 RAFL07-12-F11 BP561463 Experimental RAFL07-12-F11 AV791860;BP561463 pectinesterase - like protein
8 2 7 11 RAFL07-12-A11 AV791791 Experimental RAFL07-12-A11 AV791791
8 2 7 12 RAFL07-12-E10 AV825652 Experimental RAFL07-12-E10 AV791847;AV825652 ATP sulfurylase, putative
8 2 7 13 RAFL07-12-E07 BT000451 Experimental RAFL07-12-E07 AV791844;BT000451 beta-ureidopropionase
8 2 7 14 RAFL07-12-C07 BT002046 Experimental RAFL07-12-C07 AV791815;AV825639;BT002046 putative malate oxidoreductase
8 2 8 1 RAFL07-17-J17 AY045604 Experimental RAFL07-17-J17 AV792983;AV825935;AY045604 unknown protein
8 2 8 2 RAFL07-17-C16 AY050369 Experimental RAFL07-17-C16 AV792889;AV825912;AY050369 unknown protein
8 2 8 3 RAFL07-17-F11 BP561503 Experimental RAFL07-17-F11 AV792930;BP561503;AY075646 putative protein
8 2 8 4 RAFL07-17-O10 AV793056 Experimental RAFL07-17-O10 AV793056
8 2 8 5 RAFL07-17-B10 AY050458 Experimental RAFL07-17-B10 AV792873;AV825909;AY050458 ubiquitin-fusion degradation protein-like
8 2 8 6 RAFL07-17-O09 BP561507 Experimental RAFL07-17-O09 AV793055;BP561507;AY050372 putative protein
8 2 8 7 RAFL07-17-A08 AV825907 Experimental RAFL07-17-A08 AV792863;AV825907 Argonaute protein AGO1
8 2 8 8 RAFL07-17-F06 AY075640 Experimental RAFL07-17-F06 AV792926;AV825922;AY075640 putative protein
8 2 8 9 RAFL07-17-J02 AY065031 Experimental RAFL07-17-J02 AV792976;AV825933;AY065031 putative cyclase associated protein CAP
8 2 8 10 RAFL07-17-B02 AY065030 Experimental RAFL07-17-B02 AV792872;AV825908;AY065030 ribosomal protein S2, putative
8 2 8 11 RAFL07-17-I01 AY045617 Experimental RAFL07-17-I01 AV792960;AV825929;AY045617 glucuronosyl transferase-like protein
8 2 8 12 RAFL07-16-G24 AY050371 Experimental RAFL07-16-G24 AV792746;AV825873;AY050371 putative protein
8 2 8 13 RAFL07-16-P22 AY045606 Experimental RAFL07-16-P22 AV792858;AV825904;AY045606 Unknown protein (YUP8H12.25)
8 2 8 14 RAFL07-16-J22 AY065018 Experimental RAFL07-16-J22 AV792787;AV825880;AY065018 Cu2+-transporting ATPase-like protein
8 2 9 1 RAFL08-11-P08 AY056322 Experimental RAFL08-11-P08 AV794222;AV826266;AY056322 unknown protein
8 2 9 2 RAFL08-11-G08 AV826219 Experimental RAFL08-11-G08 AV794068;AV826219 vegetative storage protein Vsp2
8 2 9 3 RAFL08-11-H07 AY056276 Experimental RAFL08-11-H07 AV794084;AV826226;AY056276 Tha4 protein - like
8 2 9 4 RAFL08-11-J06 BP561557 Experimental RAFL08-11-J06 AV794119;BP561557;AY056250 serine/threonine kinase, putative
8 2 9 5 RAFL08-11-A03 BP561547 Experimental RAFL08-11-A03 AV793962;BP561547;AY059736 acetoacetyl-CoA thiolase (AAT1)
8 2 9 6 RAFL08-11-G02 BT000731 Experimental RAFL08-11-G02 AV794065;BP561553;BT000731 Unknown protein (T2J15.12)
8 2 9 7 RAFL08-11-N01 BT000682 Experimental RAFL08-11-N01 AV794187;AV826258;BT000682 arginine decarboxylase (spe2)
8 2 9 8 RAFL08-11-L01 BP561560 Experimental RAFL08-11-L01 AV794151;BP561560;AY142550 alanine-glyoxylate aminotransferase
8 2 9 9 RAFL08-11-A01 AY050926 Experimental RAFL08-11-A01 AV793960;AV826199;AY050926 unknown protein
8 2 9 10 RAFL08-10-O22 AY050813 Experimental RAFL08-10-O22 AV793948;AV826197;AY050813 putative P-protein: chorismate mutase, prephenate dehydratase
8 2 9 11 RAFL07-17-P18 AY050462 Experimental RAFL07-17-P18 AV793072;AV825957;AY050462 eukaryotic release factor 1 homolog (gb|AAA91169.1)
8 2 9 12 RAFL07-17-K18 AY045619 Experimental RAFL07-17-K18 AV793002;AV825940;AY045619 At1g20880/F9H16_14
8 2 9 13 RAFL07-17-H18 AY079160 Experimental RAFL07-17-H18 AV792956;AY079160 disease resistance protein - like
8 2 9 14 RAFL07-17-B18 AY050428 Experimental RAFL07-17-B18 AV792877;AV825910;AY050428 pollen specific protein SF21
8 2 10 1 RAFL08-11-N21 AY059740 Experimental RAFL08-11-N21 AV794199;AV826262;AY059740 ATP-dependent RNA helicase like protein
8 2 10 2 RAFL08-11-K21 AY056152 Experimental RAFL08-11-K21 AV794148;AV826245;AY056152 putative protein
8 2 10 3 RAFL08-11-H20 AY056327 Experimental RAFL08-11-H20 AV794095;AV826229;AY056327 NAM / CUC2 - like protein
8 2 10 4 RAFL08-11-C20 AV826208 Experimental RAFL08-11-C20 AV794008;AV826208 DNA topoisomerase I like protein
8 2 10 5 RAFL08-11-O19 AY050829 Experimental RAFL08-11-O19 AV794215;AV826264;AY050829 serine palmitoyltransferase
8 2 10 6 RAFL08-11-H19 BP561556 Experimental RAFL08-11-H19 AV794094;BP561556;AY050815 AP2 transcription factor like protein
8 2 10 7 RAFL08-11-E16 AY056183 Experimental RAFL08-11-E16 AV794039;AV826214;AY056183 putative protein
8 2 10 8 RAFL08-11-N15 AY056151 Experimental RAFL08-11-N15 AV794194;AV826261;AY056151 putative protein phosphatase 2C
8 2 10 9 RAFL08-11-L15 AY056324 Experimental RAFL08-11-L15 AV794162;AV826249;AY056324 BCS1 - like protein
8 2 10 10 RAFL08-11-H15 AY059767 Experimental RAFL08-11-H15 AV794091;AV826227;AY059767 tyrosine phosphatase like protein
8 2 10 11 RAFL08-11-D15 AY059766 Experimental RAFL08-11-D15 AV794021;AY059766 unknown protein
8 2 10 12 RAFL08-11-D14 AY050920 Experimental RAFL08-11-D14 AV794020;AV826210;AY050920 unknown protein
8 2 10 13 RAFL08-11-J10 AV826236 Experimental RAFL08-11-J10 AV794121;AV826236 putative heat-shock protein
8 2 10 14 RAFL08-11-C10 AY080643 Experimental RAFL08-11-C10 AV794001;AV826207;AY080643 unknown protein
8 2 11 1 RAFL08-17-N09 BT002382 Experimental RAFL08-17-N09 AV795493;AV826556;BT002382 putative protein
8 2 11 2 RAFL08-17-H09 AV795406 Experimental RAFL08-17-H09 AV795406 unknown protein
8 2 11 3 RAFL08-17-N04 BT002398 Experimental RAFL08-17-N04 AV795490;BT002398 putative protein
8 2 11 4 RAFL08-17-D04 AV826529 Experimental RAFL08-17-D04 AV795346;AV826529 unknown protein
8 2 11 5 RAFL08-17-J03 AY059872 Experimental RAFL08-17-J03 AV795428;AV826543;AY059872 vacuolar ATP sythase subunit C (DET3)
8 2 11 6 RAFL08-16-H24 AY062670 Experimental RAFL08-16-H24 AV795206;AV826498;AY062670
8 2 11 7 RAFL08-16-I23 AY062667 Experimental RAFL08-16-I23 AV795217;AV826501;AY062667 G-box binding bZip transcription factor GBF2 / AtbZip54
8 2 11 8 RAFL08-16-F22 BT003324 Experimental RAFL08-16-F22 AV795178;AV826491;BT003324 hypothetical protein
8 2 11 9 RAFL08-16-N15 AY062662 Experimental RAFL08-16-N15 AV795283;AV826515;AY062662 nucellin-like protein
8 2 11 10 RAFL08-16-G14 AY062531 Experimental RAFL08-16-G14 AV795189;AV826494;AY062531 putative protein
8 2 11 11 RAFL08-16-M12 BP561617 Experimental RAFL08-16-M12 AV795269;BP561617;AY062661 putative calcium-binding EF-hand protein
8 2 11 12 RAFL08-16-O10 AY062660 Experimental RAFL08-16-O10 AV795295;AV826517;AY062660 unknown protein
8 2 11 13 RAFL08-16-M09 AY062530 Experimental RAFL08-16-M09 AV795268;AV826509;AY062530 unknown protein
8 2 11 14 RAFL08-16-K08 AV826505 Experimental RAFL08-16-K08 AV795240;AV826505 chloroplast FtsH protease, putative
8 2 12 1 RAFL09-07-M07 AV826838 Experimental RAFL09-07-M07 AV796394;AV826838;AF419585 unknown protein
8 2 12 2 RAFL09-07-G07 AV826809 Experimental RAFL09-07-G07 AV796308;AV826809;AF419571 unknown protein
8 2 12 3 RAFL09-07-N06 AY064996 Experimental RAFL09-07-N06 AV796410;AV826846;AY064996 unknown protein
8 2 12 4 RAFL09-07-L05 AV826834 Experimental RAFL09-07-L05 AV796379;AV826834;AF419552
8 2 12 5 RAFL08-18-K01 AY062554 Experimental RAFL08-18-K01 AV795665;AV826596;AY062554 nuclear receptor binding factor-like protein
8 2 12 6 RAFL08-18-C01 AY059875 Experimental RAFL08-18-C01 AV795552;AV826569;AY059875 small nuclear ribonucleoprotein U1A
8 2 12 7 RAFL08-17-J23 AY059874 Experimental RAFL08-17-J23 AV795440;AV826547;AY059874 WD-40 repeat protein MSI1 (sp|O22467); also highly similar to G1/S transition control protein-binding protein RbAp46
8 2 12 8 RAFL08-17-L22 AY062683 Experimental RAFL08-17-L22 AV795474;AV826552;AY062683 putative expansin
8 2 12 9 RAFL08-17-C21 AY062552 Experimental RAFL08-17-C21 AV795342;AV826528;AY062552 unknown protein
8 2 12 10 RAFL08-17-J20 BP561626 Experimental RAFL08-17-J20 AV795438;BP561626;AY062681 phosphoinositide-specific phospholipase C-line (MZN1.13)
8 2 12 11 RAFL08-17-K13 AY062546 Experimental RAFL08-17-K13 AV795452;AV826549;AY062546 sulfate transporter
8 2 12 12 RAFL08-17-I12 AY062544 Experimental RAFL08-17-I12 AV795421;AV826541;AY062544 Phospholipase like protein
8 2 12 13 RAFL08-17-G11 AY062551 Experimental RAFL08-17-G11 AV795393;AV826536;AY062551 putative protein
8 2 12 14 RAFL08-17-J10 AY062543 Experimental RAFL08-17-J10 AV795433;AV826544;AY062543 ribulose bisphosphate carboxylase small chain 2b precursor (RuBisCO small subunit 2b) (sp|P10797)
8 2 13 3 RAFL09-07-K24 AV826832 Experimental RAFL09-07-K24 AV796376;AV826832;AF419587 photosystem II type I chlorophyll a/b binding protein
8 2 13 4 RAFL09-07-M23 BP561666 Experimental RAFL09-07-M23 AV796405;BP561666;AF419577 polyphosphoinositide binding protein, putative
8 2 13 5 RAFL09-07-I23 AV826824 Experimental RAFL09-07-I23 AV796349;AV826824;AF419562 unknown protein
8 2 13 6 RAFL09-07-L22 AV796390 Experimental RAFL09-07-L22 AV796390;AF419550 RING-H2 finger protein RHA3b
8 2 13 7 RAFL09-07-H17 AV826818 Experimental RAFL09-07-H17 AV796334;AV826818;AF419614 hydroxymethylbilane synthase
8 2 13 8 RAFL09-07-L16 AV826836 Experimental RAFL09-07-L16 AV796386;AV826836;AF419593 nodulin-like protein
8 2 13 9 RAFL09-07-H16 AV826817 Experimental RAFL09-07-H16 AV796333;AV826817;AF419591 unknown protein
8 2 13 10 RAFL09-07-O15 AV826855 Experimental RAFL09-07-O15 AV796431;AV826855;AF419579 Unknown protein (At2g41640; T32G6.16)
8 2 13 11 RAFL09-07-G15 AV826812 Experimental RAFL09-07-G15 AV796314;AV826812;AF419569 peroxidase
8 2 13 12 RAFL09-07-G14 AV826811 Experimental RAFL09-07-G14 AV796313;AV826811;AF419551 unknown protein
8 2 13 13 RAFL09-07-P08 AV796438 Experimental RAFL09-07-P08 AV796438;AF419604 thiazole biosynthetic enzyme precursor (ARA6) (sp|Q38814)
8 2 13 14 RAFL09-07-J08 AV826826 Experimental RAFL09-07-J08 AV796355;AV826826;AF419595 putative protein
8 2 14 1 RAFL09-11-C07 AV827084 Experimental RAFL09-11-C07 AV797193;AV827084;AF367334 unknown protein (At1g22910)
8 2 14 2 RAFL09-11-I06 AY126988 Experimental RAFL09-11-I06 AV797285;AV827116;AY126988
8 2 14 3 RAFL09-11-F02 AV827100 Experimental RAFL09-11-F02 AV797239;AV827100;AF361599 unknown protein
8 2 14 4 RAFL09-11-N01 AV827146 Experimental RAFL09-11-N01 AV797361;AV827146;AF367355 squamosa promoter binding protein-like 7
8 2 14 5 RAFL09-11-J01 AY126992 Experimental RAFL09-11-J01 AV797300;AV827122;AY126992 putative phospho-ser/thr phosphatase
8 2 14 6 RAFL09-11-D01 AV827091 Experimental RAFL09-11-D01 AV797207;AV827091;AF367342 isochorismate synthase 1 precursor (ICS1)
8 2 14 7 RAFL09-10-O22 AV827069 Experimental RAFL09-10-O22 AV797142;AV827069;AF361580 putative protein
8 2 14 8 RAFL09-10-P21 AV827074 Experimental RAFL09-10-P21 AV797156;AV827074;AF367332 tubulin beta-2/beta-3 chain (sp|P29512)
8 3 1 1 RAFL06-08-F12 AY065132 Experimental RAFL06-08-F12 AV784794;AY065132 unknown protein
8 3 1 2 RAFL06-08-C15 AY065131 Experimental RAFL06-08-C15 AV784775;AV823740;AY065131 germin-like protein
8 3 1 3 RAFL06-08-B11 AY065130 Experimental RAFL06-08-B11 AV784765;AV823731;AY065130 predicted GPI-anchored protein
8 3 1 4 RAFL06-07-P22 AY065129 Experimental RAFL06-07-P22 AV784756;AV823724;AY065129 unknown protein
8 3 1 5 RAFL06-09-F14 AY062801 Experimental RAFL06-09-F14 AV784898;AV823833;AY062801 nodulin / glutamate-ammonia ligase - like protein
8 3 1 6 RAFL06-07-L10 AY059928 Experimental RAFL06-07-L10 AV784724;AV823704;AY059928 immunophilin (gb|AAB57847.1)
8 3 1 7 RAFL06-08-B09 AV823730 Experimental RAFL06-08-B09 AV784764;AV823730 putative 40S ribosomal protein s14
8 3 1 8 RAFL06-07-P20 AY092999 Experimental RAFL06-07-P20 AV784755;AV823723;AY092999 beta-glucosidase - like protein
8 3 1 9 RAFL06-09-E01 AY065127 Experimental RAFL06-09-E01 AV784887;AV823826;AY065127 unknown protein
8 3 1 10 RAFL06-08-P20 AY062793 Experimental RAFL06-08-P20 AV784866;AV823810;AY062793 putative 60S ribosomal protein L13A
8 3 1 11 RAFL06-08-O12 BT002428 Experimental RAFL06-08-O12 AV784856;AV823802;BT002428 proline-rich protein
8 3 1 12 RAFL06-08-N06 AY072342 Experimental RAFL06-08-N06 AV784844;AV823791;AY072342 putative APG protein
8 3 1 13 RAFL06-08-O07 AY072341 Experimental RAFL06-08-O07 AV784855;AV823801;AY072341 unknown protein (At1g42550)
8 3 1 14 RAFL06-08-N05 AV823790 Experimental RAFL06-08-N05 AV784843;AV823790 luminal binding protein
8 3 2 1 RAFL06-14-E06 AY127005 Experimental RAFL06-14-E06 AV785305;AV824143;AY127005 unknown protein
8 3 2 2 RAFL06-16-E03 BP561200 Experimental RAFL06-16-E03 AV785427;BP561200
8 3 2 3 RAFL06-12-N01 AV824048 Experimental RAFL06-12-N01 AV785185;AV824048 putative ribosomal protein L19
8 3 2 4 RAFL06-16-J18 AY072542 Experimental RAFL06-16-J18 AV785463;AV824252;AY072542 cadmium-induced protein
8 3 2 5 RAFL06-16-H24 BP561205 Experimental RAFL06-16-H24 AV785452;BP561205 unknown protein
8 3 2 6 RAFL06-14-A06 AV824137 Experimental RAFL06-14-A06 AV785295;AV824137 unknown protein
8 3 2 7 RAFL06-13-N23 AY070731 Experimental RAFL06-13-N23 AV785284;AV824128;AY070731 unknown protein
8 3 2 8 RAFL06-13-M05 AV824121 Experimental RAFL06-13-M05 AV785273;AV824121 unknown protein
8 3 2 9 RAFL06-07-G22 AV823678 Experimental RAFL06-07-G22 AV784691;AV823678 putative protein
8 3 2 10 RAFL06-08-M09 AV823783 Experimental RAFL06-08-M09 AV784835;AV823783 En/Spm-like transposon protein
8 3 2 11 RAFL06-08-H16 AY062812 Experimental RAFL06-08-H16 AV784804;AV823762;AY062812 Unknown protein (At1g33780)
8 3 2 12 RAFL06-08-E11 BP561080 Experimental RAFL06-08-E11 AV784786;BP561080;AY065135 unknown protein (At1g70890)
8 3 2 13 RAFL06-08-B12 AY062810 Experimental RAFL06-08-B12 AV784766;AV823732;AY062810 putative peroxidase
8 3 2 14 RAFL06-07-P24 AV823725 Experimental RAFL06-07-P24 AV784757;AV823725 putative ribokinase
8 3 3 1 RAFL06-16-L12 AY070751 Experimental RAFL06-16-L12 AV785478;AV824262;AY070751 unknown protein
8 3 3 2 RAFL06-16-J23 AY093770 Experimental RAFL06-16-J23 AV785466;AY093770 putative protein
8 3 3 3 RAFL06-14-E19 AY070746 Experimental RAFL06-14-E19 AV785307;AV824144;AY070746
8 3 3 4 RAFL06-14-A20 AV824138 Experimental RAFL06-14-A20 AV785298;AV824138 light-harvesting chlorophyll a/b-binding protein (Cab4)
8 3 3 5 RAFL06-13-A22 AY070756 Experimental RAFL06-13-A22 AV785207;AV824067;AY070756 putative protein
8 3 3 6 RAFL06-12-P16 AV824058 Experimental RAFL06-12-P16 AV785197;AV824058 sigma-like factor (emb|CAA77213.1)
8 3 3 7 RAFL06-15-C10 AV824163 Experimental RAFL06-15-C10 AV785333;AV824163 nodulin-like protein
8 3 3 8 RAFL06-16-L11 AV824261 Experimental RAFL06-16-L11 AV785477;AV824261 receptor protein kinase - like protein
8 3 3 9 RAFL06-14-K01 AV824153 Experimental RAFL06-14-K01 AV785318;AV824153 glyceraldehyde-3-phosphate dehydrogenase C subunit (GapC)
8 3 3 10 RAFL06-16-H06 AY070741 Experimental RAFL06-16-H06 AV785444;AV824238;AY070741 unknown protein
8 3 3 11 RAFL06-12-P15 AY127006 Experimental RAFL06-12-P15 AV785196;AV824057;AY127006 2'-hydroxyisoflavone reductase, putative
8 3 3 12 RAFL06-12-N03 AY070754 Experimental RAFL06-12-N03 AV785186;AV824049;AY070754 unknown protein
8 3 3 13 RAFL06-16-L10 AY127001 Experimental RAFL06-16-L10 AV785476;AV824260;AY127001 decoy
8 3 3 14 RAFL06-14-I03 AV824152 Experimental RAFL06-14-I03 AV785317;AV824152 ribosomal protein S13
8 3 4 1 RAFL07-09-K22 AY056304 Experimental RAFL07-09-K22 AV791256;AV825427;AY056304 putative auxin-independent growth promoter
8 3 4 2 RAFL07-09-F22 AY059781 Experimental RAFL07-09-F22 AV791202;AV825403;AY059781 glucose transporter
8 3 4 3 RAFL07-09-A22 AY045907 Experimental RAFL07-09-A22 AV791143;AV825385;AY045907 unknown protein
8 3 4 4 RAFL07-09-E20 AY080845 Experimental RAFL07-09-E20 AV791189;AV825398;AY080845 putative protein
8 3 4 5 RAFL07-09-B20 AV825389 Experimental RAFL07-09-B20 AV791153;AV825389 chromatin remodelling complex ATPase chain ISWI -like protein
8 3 4 6 RAFL07-09-E19 BT000780 Experimental RAFL07-09-E19 AV791188;AV825397;BT000780 unknown protein
8 3 4 7 RAFL07-09-M15 AV825434 Experimental RAFL07-09-M15 AV791275;AV825434 UDP-glucose dehydrogenase, putative
8 3 4 8 RAFL07-09-M14 AY050967 Experimental RAFL07-09-M14 AV791274;AV825433;AY050967 unknown protein
8 3 4 9 RAFL07-09-G13 AY050877 Experimental RAFL07-09-G13 AV791210;AV825406;AY050877
8 3 4 10 RAFL07-09-B13 AY050777 Experimental RAFL07-09-B13 AV791149;AV825387;AY050777 calnexin - like protein
8 3 4 11 RAFL07-09-A12 AY045886 Experimental RAFL07-09-A12 AV791138;AV825381;AY045886 unknown protein
8 3 4 12 RAFL07-09-N11 BT000678 Experimental RAFL07-09-N11 AV791289;AV825441;BT000678 unknown protein
8 3 4 13 RAFL06-12-P17 AY070757 Experimental RAFL06-12-P17 AV785198;AV824059;AY070757 unknown protein
8 3 4 14 RAFL06-15-C13 BP561183 Experimental RAFL06-15-C13 AV785334;BP561183;AY070739 unknown protein (At1g30520)
8 3 5 1 RAFL07-13-E22 AY054521 Experimental RAFL07-13-E22 AV792077;AV825714;AY054521 Unknown protein
8 3 5 2 RAFL07-13-K21 AY054474 Experimental RAFL07-13-K21 AV792159;AV825732;AY054474 putative sucrose-6F-phosphate phosphohydrolase
8 3 5 3 RAFL07-10-E09 AY050992 Experimental RAFL07-10-E09 AV791372;AV825480;AY050992 crooked neck-like protein
8 3 5 4 RAFL07-10-I08 AY050970 Experimental RAFL07-10-I08 AV791439;AV825514;AY050970
8 3 5 5 RAFL07-10-E08 AY050879 Experimental RAFL07-10-E08 AV791371;AV825479;AY050879 unknown protein
8 3 5 6 RAFL07-10-O07 AV825556 Experimental RAFL07-10-O07 AV791531;AV825556 beta-galactosidase like protein
8 3 5 7 RAFL07-10-J07 AY059731 Experimental RAFL07-10-J07 AV791453;AV825520;AY059731 WRKY transcription factor 11 (WRKY11)
8 3 5 8 RAFL07-10-G07 BT000797 Experimental RAFL07-10-G07 AV791407;AV825495;BT000797 beta-glucosidase, putative
8 3 5 9 RAFL07-10-N04 AY056262 Experimental RAFL07-10-N04 AV791511;AV825550;AY056262 unknown protein
8 3 5 10 RAFL07-10-H04 AY050900 Experimental RAFL07-10-H04 AV791421;AV825504;AY050900 glycine-rich protein like
8 3 5 11 RAFL07-10-E04 BT000660 Experimental RAFL07-10-E04 AV791368;AV825478;BT000660 unknown protein
8 3 5 12 RAFL07-10-K03 AV825527 Experimental RAFL07-10-K03 AV791463;AV825527
8 3 5 13 RAFL07-10-M02 AY050982 Experimental RAFL07-10-M02 AV791493;AV825541;AY050982 unknown protein
8 3 5 14 RAFL07-10-I02 AY080833 Experimental RAFL07-10-I02 AV791435;AV825511;AY080833 ABC transporter homolog PnATH - like
8 3 6 1 RAFL07-14-F17 BT002054 Experimental RAFL07-14-F17 AV792295;AV825761;BT002054 ATP phosphoribosyl transferase (AtATP-PRT2)
8 3 6 2 RAFL07-14-F16 AY062455 Experimental RAFL07-14-F16 AV792294;AV825760;AY062455 RNA-binding protein cp33 precursor
8 3 6 3 RAFL07-14-A15 AY062456 Experimental RAFL07-14-A15 AV792225;AV825748;AY062456 Unknown protein (At2g43060)
8 3 6 4 RAFL07-14-M14 AY062452 Experimental RAFL07-14-M14 AV792389;AV825782;AY062452 60S ribosomal protein - like
8 3 6 5 RAFL07-14-B09 BT002057 Experimental RAFL07-14-B09 AV792235;BT002057 histone acetyltransferase (HAT1)
8 3 6 6 RAFL07-14-N08 AY054478 Experimental RAFL07-14-N08 AV792399;AV825785;AY054478 unknown protein
8 3 6 7 RAFL07-14-A08 AY054520 Experimental RAFL07-14-A08 AV792220;AV825744;AY054520 unknown protein
8 3 6 8 RAFL07-14-E07 AY054477 Experimental RAFL07-14-E07 AV792273;AV825756;AY054477 transmembrane protein FT27/PFT27-like
8 3 6 9 RAFL07-14-O06 AY054476 Experimental RAFL07-14-O06 AV792411;AV825788;AY054476 putative retroelement
8 3 6 10 RAFL07-14-B06 AV825750 Experimental RAFL07-14-B06 AV792232;AV825750
8 3 6 11 RAFL07-13-H24 BP561467 Experimental RAFL07-13-H24 AV792114;BP561467;AY054470 putative ADP-ribosylation factor
8 3 6 12 RAFL07-13-F24 AY054519 Experimental RAFL07-13-F24 AV792090;AV825718;AY054519 Unknown protein (At1g07360; F22G5.30)
8 3 6 13 RAFL07-13-P22 AV825741 Experimental RAFL07-13-P22 AV792216;AV825741 putative protein
8 3 6 14 RAFL07-13-I22 AY120756 Experimental RAFL07-13-I22 AV792128;AV825724;AY120756 55 kDa B regulatory subunit of phosphatase 2A
8 3 7 1 RAFL08-08-N02 AY052366 Experimental RAFL08-08-N02 AV793479;AV826074;AY052366 unknown protein
8 3 7 2 RAFL08-08-K02 AY045659 Experimental RAFL08-08-K02 AV793444;AV826063;AY045659 ethylene-responsive element - like protein
8 3 7 3 RAFL08-08-F02 AY050417 Experimental RAFL08-08-F02 AV793385;AV826044;AY050417 invertase - like protein
8 3 7 4 RAFL08-08-I01 BP561523 Experimental RAFL08-08-I01 AV793423;BP561523;AY050415 cytochrome P450, putative
8 3 7 5 RAFL08-08-C01 AY052352 Experimental RAFL08-08-C01 AV793347;AY052352 kinesin like protein
8 3 7 6 RAFL07-18-L24 AY045641 Experimental RAFL07-18-L24 AV793263;AV826010;AY045641 unknown protein
8 3 7 7 RAFL07-15-H02 AY054488 Experimental RAFL07-15-H02 AV792528;AV825824;AY054488 unknown protein
8 3 7 8 RAFL07-15-F02 AY062464 Experimental RAFL07-15-F02 AV792498;AV825815;AY062464 putative spore coat protein
8 3 7 9 RAFL07-15-K01 AY062463 Experimental RAFL07-15-K01 AV792564;AV825836;AY062463 Unknown protein (At1g04860; F13M7.15)
8 3 7 10 RAFL07-14-I24 AY054485 Experimental RAFL07-14-I24 AV792340;AV825769;AY054485 vacuolar-pyrophosphatase like protein (AVPL1)
8 3 7 11 RAFL07-14-N23 BT000447 Experimental RAFL07-14-N23 AV792406;BT000447 clpB heat shock protein-like
8 3 7 12 RAFL07-14-G22 AY054484 Experimental RAFL07-14-G22 AV792313;AV825764;AY054484 nucleosome assembly protein I-like protein
8 3 7 13 RAFL07-14-G18 BP561473 Experimental RAFL07-14-G18 AV792311;BP561473;AY054481 Unknown protein
8 3 7 14 RAFL07-14-P17 AY062457 Experimental RAFL07-14-P17 AV792428;AV825794;AY062457 TATA binding protein-associated factor - like
8 3 8 1 RAFL08-09-D05 AY050404 Experimental RAFL08-09-D05 AV793558;AV826096;AY050404 pectate lyase
8 3 8 2 RAFL08-09-J04 AY045643 Experimental RAFL08-09-J04 AV793641;AV826120;AY045643 unknown protein
8 3 8 3 RAFL08-08-P22 AY056099 Experimental RAFL08-08-P22 AV793514;AV826080;AY056099 ARR1 protein, putative, 5' partial
8 3 8 4 RAFL08-08-L21 AY045660 Experimental RAFL08-08-L21 AV793462;AV826070;AY045660 sigma-like factor (emb|CAA77213.1)
8 3 8 5 RAFL08-08-D21 BP561520 Experimental RAFL08-08-D21 AV793366;BP561520;AY045655
8 3 8 6 RAFL08-08-L20 AY050410 Experimental RAFL08-08-L20 AV793461;AV826069;AY050410 putative galactinol synthase
8 3 8 7 RAFL08-08-M18 AY050407 Experimental RAFL08-08-M18 AV793475;AV826073;AY050407 cinnamyl-alcohol dehydrogenase ELI3-1
8 3 8 8 RAFL08-08-E18 AY091778 Experimental RAFL08-08-E18 AV793381;AV826042;AY091778 putative protein kinase
8 3 8 9 RAFL08-08-F13 AY052363 Experimental RAFL08-08-F13 AV793392;AV826046;AY052363 unknown protein
8 3 8 10 RAFL08-08-M12 AY091780 Experimental RAFL08-08-M12 AV793471;AV826072;AY091780 beta Galactosidase - like protein
8 3 8 11 RAFL08-08-D11 AY052358 Experimental RAFL08-08-D11 AV793363;AY052358 putative protein
8 3 8 12 RAFL08-08-I10 AY045651 Experimental RAFL08-08-I10 AV793427;AV826056;AY045651 hypothetical protein
8 3 8 13 RAFL08-08-O08 AY052351 Experimental RAFL08-08-O08 AV793495;AV826075;AY052351 GTP binding protein-like
8 3 8 14 RAFL08-08-H08 AY045635 Experimental RAFL08-08-H08 AV793415;AV826052;AY045635 unknown protein
8 3 9 1 RAFL08-13-F13 BP561580 Experimental RAFL08-13-F13 AV794548;BP561580;AY056321 unknown protein
8 3 9 2 RAFL08-13-J12 AV826370 Experimental RAFL08-13-J12 AV794603;AV826370 unknown protein
8 3 9 3 RAFL08-13-N11 BP561586 Experimental RAFL08-13-N11 AV794666;BP561586
8 3 9 4 RAFL08-13-E11 AV794530 Experimental RAFL08-13-E11 AV794530 unknown protein
8 3 9 5 RAFL08-13-P06 BT000739 Experimental RAFL08-13-P06 AV794688;AV826393;BT000739 unknown protein
8 3 9 6 RAFL08-13-M06 AY056150 Experimental RAFL08-13-M06 AV794646;AV826380;AY056150 unknown protein
8 3 9 7 RAFL08-13-K06 AY063904 Experimental RAFL08-13-K06 AV794615;AV826374;AY063904 putative beta-fructosidase (At1g62660)
8 3 9 8 RAFL08-13-I06 AY056286 Experimental RAFL08-13-I06 AV794588;AV826365;AY056286 unknown protein
8 3 9 9 RAFL08-13-P05 AY056146 Experimental RAFL08-13-P05 AV794687;AV826392;AY056146
8 3 9 10 RAFL08-13-C05 BP561577 Experimental RAFL08-13-C05 AV794496;BP561577;AY050973 unknown protein
8 3 9 11 RAFL08-09-C07 AY050422 Experimental RAFL08-09-C07 AV793543;AV826089;AY050422 unknown protein
8 3 9 12 RAFL08-09-P06 AY052362 Experimental RAFL08-09-P06 AV793724;AV826141;AY052362 PGPD14 protein
8 3 9 13 RAFL08-09-A06 AY056101 Experimental RAFL08-09-A06 AV793517;AV826081;AY056101 unknown protein
8 3 9 14 RAFL08-09-N05 AY052354 Experimental RAFL08-09-N05 AV793700;AV826138;AY052354 multicatalytic endopeptidase complex, proteasome precursor, beta subunit
8 3 10 1 RAFL08-14-E11 BP561593 Experimental RAFL08-14-E11 AV794745;BP561593;AY050965 unknown protein
8 3 10 2 RAFL08-14-N09 BT000732 Experimental RAFL08-14-N09 AV794846;AV826423;BT000732 putative anion exchange protein
8 3 10 3 RAFL08-14-G09 AY056326 Experimental RAFL08-14-G09 AV794771;AV826407;AY056326 unknown protein (At1g13740)
8 3 10 4 RAFL08-14-K07 AY056290 Experimental RAFL08-14-K07 AV794807;AV826414;AY056290 putative protein
8 3 10 5 RAFL08-14-P06 AY050828 Experimental RAFL08-14-P06 AV794860;AV826426;AY050828 uridylate kinase, putative
8 3 10 6 RAFL08-14-N05 BP561596 Experimental RAFL08-14-N05 AV794843;BP561596 pyruvate dehydrogenase E1 alpha subunit
8 3 10 7 RAFL08-13-I24 AY063943 Experimental RAFL08-13-I24 AV794597;AV826367;AY063943 dihydrodipicolinate synthase precursor
8 3 10 8 RAFL08-13-H23 AY050948 Experimental RAFL08-13-H23 AV794583;AV826362;AY050948
8 3 10 9 RAFL08-13-M21 BT000768 Experimental RAFL08-13-M21 AV794659;AV826385;BT000768
8 3 10 10 RAFL08-13-K20 AY056288 Experimental RAFL08-13-K20 AV794623;AV826376;AY056288 putative nucleic acid binding protein
8 3 10 11 RAFL08-13-B20 AY056277 Experimental RAFL08-13-B20 AV794492;AV826347;AY056277 putative glucosyltransferase
8 3 10 12 RAFL08-13-I19 AY080801 Experimental RAFL08-13-I19 AV794594;AV826366;AY080801 putative protein
8 3 10 13 RAFL08-13-C15 AY059737 Experimental RAFL08-13-C15 AV794502;AV826349;AY059737 protein phosphatase 2C like protein
8 3 10 14 RAFL08-13-O14 AY050947 Experimental RAFL08-13-O14 AV794680;AV826391;AY050947 Ran binding protein 1 homolog (RanBP1)
8 3 11 1 RAFL09-06-G09 AY062567 Experimental RAFL09-06-G09 AV796061;AV826689;AY062567 isovaleryl-CoA-dehydrogenase precursor (IVD)
8 3 11 2 RAFL09-06-E09 AV826678 Experimental RAFL09-06-E09 AV796030;AV826678 cytochrome-b5 reductase - like protein
8 3 11 3 RAFL09-06-E05 AY062563 Experimental RAFL09-06-E05 AV796027;AV826677;AY062563 putative chlorophyll a/b binding protein
8 3 11 4 RAFL09-06-B05 AY062691 Experimental RAFL09-06-B05 AV795988;AV826654;AY062691 Unknown protein (At5g55580; MDF20.2)
8 3 11 5 RAFL09-06-M04 AY092977 Experimental RAFL09-06-M04 AV796146;AV826730;AY092977 putative protein
8 3 11 6 RAFL09-06-D04 AY062690 Experimental RAFL09-06-D04 AV796013;AV826666;AY062690 myrosinase-associated protein, putative
8 3 11 7 RAFL09-06-E03 AY092976 Experimental RAFL09-06-E03 AV796026;AV826676;AY092976 cytosolic IMP-GMP specific 5'-nucleotidase, putative
8 3 11 8 RAFL09-06-N02 AY059881 Experimental RAFL09-06-N02 AV796161;AV826739;AY059881 unknown protein
8 3 11 9 RAFL08-19-D22 BP561638 Experimental RAFL08-19-D22 AV795810;BP561638;AY065184 putative protein
8 3 11 10 RAFL08-19-M20 AY062684 Experimental RAFL08-19-M20 AV795927;AV826638;AY062684
8 3 11 11 RAFL08-19-N19 AY062705 Experimental RAFL08-19-N19 AV795940;AV826641;AY062705 26S proteasome AAA-ATPase subunit RPT5a
8 3 11 12 RAFL08-19-G19 AY092978 Experimental RAFL08-19-G19 AV795845;AV826624;AY092978
8 3 11 13 RAFL08-19-M18 AY062694 Experimental RAFL08-19-M18 AV795926;AV826637;AY062694 putative eukaryotic translation initiation factor 5 (EIF-5) sp|P48724; similar to ESTs emb|F19992, gb|N96933, emb|Z33699, emb|F19991
8 3 11 14 RAFL08-19-D18 AY062686 Experimental RAFL08-19-D18 AV795807;AV826618;AY062686 RNA-binding protein-like
8 3 12 1 RAFL09-09-J08 AY058871 Experimental RAFL09-09-J08 AV796781;AV826923;AY058871 putative protein
8 3 12 2 RAFL09-09-C08 AY058852 Experimental RAFL09-09-C08 AV796655;AV826874;AY058852 chloroplast omega-6 fatty acid desaturase (fad6)
8 3 12 3 RAFL09-09-O07 AY058841 Experimental RAFL09-09-O07 AV796873;AV826959;AY058841 ribosomal protein
8 3 12 4 RAFL09-09-M07 AY058832 Experimental RAFL09-09-M07 AV796837;AV826943;AY058832
8 3 12 5 RAFL09-06-N14 AY062578 Experimental RAFL09-06-N14 AV796172;AV826746;AY062578 putative AP2 domain transcription factor
8 3 12 6 RAFL09-06-E14 AY062574 Experimental RAFL09-06-E14 AV796034;AV826680;AY062574 unknown protein
8 3 12 7 RAFL09-06-B14 AY062706 Experimental RAFL09-06-B14 AV795993;AV826657;AY062706 pectinacetylesterase
8 3 12 8 RAFL09-06-O13 AY062704 Experimental RAFL09-06-O13 AV796185;AV826750;AY062704 unknown protein
8 3 12 9 RAFL09-06-M13 AY081322 Experimental RAFL09-06-M13 AV796150;AV826732;AY081322 unknown protein
8 3 12 10 RAFL09-06-N12 AY059888 Experimental RAFL09-06-N12 AV796170;AV826744;AY059888 S-adenosyl-L-homocysteinas, putative
8 3 12 11 RAFL09-06-E10 AY062575 Experimental RAFL09-06-E10 AV796031;AY062575 putative homeotic protein
8 3 12 12 RAFL09-06-C10 AY062568 Experimental RAFL09-06-C10 AV796002;AV826661;AY062568 transport inhibitor response 1-like protein
8 3 12 13 RAFL09-06-L09 AY059885 Experimental RAFL09-06-L09 AV796136;AV826724;AY059885 putative protein
8 3 12 14 RAFL09-06-J09 AV826710 Experimental RAFL09-06-J09 AV796103;AV826710 putative beta-glucosidase
8 3 13 1 RAFL09-09-H18 AY057508 Experimental RAFL09-09-H18 AV796752;AV826904;AY057508 proteasome regulatory subunit S3, putative
8 3 13 2 RAFL09-09-D18 AY057503 Experimental RAFL09-09-D18 AV796680;AV826881;AY057503 unknown protein
8 3 13 3 RAFL09-09-I17 AY058870 Experimental RAFL09-09-I17 AV796769;AV826915;AY058870 pectate lyase - like protein
8 3 13 4 RAFL09-09-F17 AY058861 Experimental RAFL09-09-F17 AV796714;AV826889;AY058861 unknown protein
8 3 13 5 RAFL09-09-C17 AY058840 Experimental RAFL09-09-C17 AV796662;AV826878;AY058840 putative bHLH transcription factor (bHLH032)
8 3 13 6 RAFL09-09-P16 AY057490 Experimental RAFL09-09-P16 AV796895;AV826967;AY057490 putative myosin heavy chain
8 3 13 7 RAFL09-09-A15 AY057506 Experimental RAFL09-09-A15 AV796627;AV826861;AY057506 random slug protein - like
8 3 13 8 RAFL09-09-K14 AY058884 Experimental RAFL09-09-K14 AV796805;AV826932;AY058884 unknown protein
8 3 13 9 RAFL09-09-N13 AY058865 Experimental RAFL09-09-N13 AV796859;AV826955;AY058865 beta-glucosidase, putative
8 3 13 10 RAFL09-09-G13 AY058857 Experimental RAFL09-09-G13 AV796730;AV826897;AY058857 26S proteasome regulatory particle chain RPT6-like protein
8 3 13 11 RAFL09-09-O12 AV826961 Experimental RAFL09-09-O12 AV796877;AV826961 putative protein
8 3 13 12 RAFL09-09-E12 AY058839 Experimental RAFL09-09-E12 AV796694;AV826884;AY058839 putative protein
8 3 13 13 RAFL09-09-B09 AY094459 Experimental RAFL09-09-B09 AV796638;AV826865;AY094459 methionine S-methyltransferase (gb|AAD49574.1)
8 3 13 14 RAFL09-09-M08 AY058877 Experimental RAFL09-09-M08 AV796838;AV826944;AY058877 unknown protein
8 3 14 1 RAFL09-13-A01 AY126989 Experimental RAFL09-13-A01 AV797665;AV827253;AY126989 unknown protein
8 3 14 2 RAFL09-12-M24 AV827237 Experimental RAFL09-12-M24 AV797612;AV827237;AF367257 unknown protein
8 3 14 3 RAFL09-12-M20 AV827236 Experimental RAFL09-12-M20 AV797610;AV827236;AF361832 unknown protein
8 3 14 4 RAFL09-12-A19 AV827163 Experimental RAFL09-12-A19 AV797417;AV827163 putative acetyltransferase
8 3 14 5 RAFL09-12-J18 AV827217 Experimental RAFL09-12-J18 AV797557;AV827217;AF361820 putative protein
8 3 14 6 RAFL09-12-D18 AV827183 Experimental RAFL09-12-D18 AV797465;AV827183;AF367282 putative protein
8 3 14 7 RAFL09-12-G17 AV827206 Experimental RAFL09-12-G17 AV797514;AV827206;AF367268 carbamoyl phosphate synthetase large chain (carB)
8 3 14 8 RAFL09-12-E17 AV827190 Experimental RAFL09-12-E17 AV797483;AV827190;AF367258 putative cytochrome c oxidase subunit Vb
8 3 14 9 RAFL09-09-B22 AY058894 Experimental RAFL09-09-B22 AV796649;AV826871;AY058894 hypothetical protein
8 3 14 10 RAFL09-09-J21 AY058879 Experimental RAFL09-09-J21 AV796791;AV826927;AY058879 predicted GPI-anchored protein (by homology)
8 3 14 11 RAFL09-09-C21 BP561669 Experimental RAFL09-09-C21 AV796664;BP561669;AY057502 putative protein
8 3 14 12 RAFL09-09-A21 AY057499 Experimental RAFL09-09-A21 AV796632;AV826863;AY057499 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
8 3 14 13 RAFL09-09-N20 AY058845 Experimental RAFL09-09-N20 AV796864;AY058845 unknown protein
8 3 14 14 RAFL09-09-K20 AY057492 Experimental RAFL09-09-K20 AV796811;AV826934;AY057492 putative protein
8 4 1 1 RAFL06-11-C09 BT003338 Experimental RAFL06-11-C09 AV785060;AV823961;BT003338 putative protein
8 4 1 2 RAFL06-10-E14 BP561117 Experimental RAFL06-10-E14 AV784998;BP561117 GTP-binding RAB2A like protein
8 4 1 3 RAFL06-10-D09 AV823906 Experimental RAFL06-10-D09 AV784988;AV823906 rotamase FKBP (ROF1)
8 4 1 4 RAFL06-10-C09 AY072334 Experimental RAFL06-10-C09 AV784979;AV823899;AY072334 unknown protein
8 4 1 5 RAFL06-10-A20 AV823891 Experimental RAFL06-10-A20 AV784970;AV823891 vacuolar-type H+-ATPase (v-ATPase) subunit D (vATPD / VHA-D)
8 4 1 6 RAFL06-11-J01 AY059923 Experimental RAFL06-11-J01 AV823985;AY059923 putative 60S ribosomal protein L21
8 4 1 7 RAFL06-11-A22 AY092992 Experimental RAFL06-11-A22 AV785052;AV823954;AY092992 extensin - like protein
8 4 1 8 RAFL06-10-N05 AY065111 Experimental RAFL06-10-N05 AV785038;AV823944;AY065111
8 4 1 9 RAFL06-10-G18 AY128398 Experimental RAFL06-10-G18 AV785013;AV823926;AY128398 glutathione S-transferase (erd13)
8 4 1 10 RAFL06-10-E08 AY120778 Experimental RAFL06-10-E08 AV784996;AV823912;AY120778 60S ribosomal protein L18A
8 4 1 11 RAFL06-10-C07 BT002424 Experimental RAFL06-10-C07 AV784978;AV823898;BT002424 unknown protein
8 4 1 12 RAFL06-10-A16 AY128396 Experimental RAFL06-10-A16 AV784969;AV823890;AY128396 putative malate oxidoreductase
8 4 1 13 RAFL06-11-A17 AY092990 Experimental RAFL06-11-A17 AV785050;AV823953;AY092990 unknown protein
8 4 1 14 RAFL06-10-I08 AY062766 Experimental RAFL06-10-I08 AV785020;AV823932;AY062766 unknown protein
8 4 2 1 RAFL06-12-C19 AY090342 Experimental RAFL06-12-C19 AV785139;AV824019;AY090342 12S cruciferin seed storage protein
8 4 2 2 RAFL06-12-I20 AV824038 Experimental RAFL06-12-I20 AV785170;AV824038 predicted GPI-anchored protein
8 4 2 3 RAFL06-12-C05 AV785137 Experimental RAFL06-12-C05 AV785137 unknown protein
8 4 2 4 RAFL06-12-F08 AY058140 Experimental RAFL06-12-F08 AV785152;AY058140 glyceraldehyde 3-phosphate dehydrogenase A subunit (GapA)
8 4 2 5 RAFL06-12-C04 AY075591 Experimental RAFL06-12-C04 AV785136;AV824018;AY075591 beta-1,3-glucanase-like protein
8 4 2 6 RAFL06-12-E24 AY058128 Experimental RAFL06-12-E24 AV785151;AV824028;AY058128 20S proteasome subunit PAF1 (gb|AAC32062.1)
8 4 2 7 RAFL06-12-B20 AY070764 Experimental RAFL06-12-B20 AV785134;AV824017;AY070764 regulatory protein of P-starvation acclimation response Psr1, putative
8 4 2 8 RAFL06-12-E14 AY058119 Experimental RAFL06-12-E14 AV785150;AV824027;AY058119 unknown protein
8 4 2 9 RAFL06-11-B11 AY081323 Experimental RAFL06-11-B11 AV785054;AV823955;AY081323 putative trypsin inhibitor (At1g73260)
8 4 2 10 RAFL06-10-H04 BP561120 Experimental RAFL06-10-H04 AV785015;BP561120;AY128403
8 4 2 11 RAFL06-10-E18 AY065117 Experimental RAFL06-10-E18 AV785000;AV823915;AY065117 tubulin alpha-2/alpha-4 chain, putative
8 4 2 12 RAFL06-10-C14 AV823901 Experimental RAFL06-10-C14 AV784981;AV823901 amidophosphoribosyltransferase 2 precursor
8 4 2 13 RAFL06-11-J06 AY092997 Experimental RAFL06-11-J06 AV785091;AV823987;AY092997 transcription factor Hap5a
8 4 2 14 RAFL06-11-C15 AY128402 Experimental RAFL06-11-C15 AV785061;AV823962;AY128402 putative ribose phosphate pyrophosphokinase
8 4 3 1 RAFL06-16-D08 AY070770 Experimental RAFL06-16-D08 AV785423;AV824224;AY070770 unknown protein
8 4 3 2 RAFL06-13-K04 AY075589 Experimental RAFL06-13-K04 AV785256;AV824108;AY075589 unknown protein
8 4 3 3 RAFL06-15-O15 AY090341 Experimental RAFL06-15-O15 AV785394;AY090341 amino acid transport protein AAP2
8 4 3 4 RAFL06-15-N11 AY058117 Experimental RAFL06-15-N11 AV785387;AV824196;AY058117 unknown protein
8 4 3 5 RAFL06-16-H13 AV824240 Experimental RAFL06-16-H13 AV785446;AV824240;AF462797 pectate lyase 1-like protein
8 4 3 6 RAFL06-16-G10 AY075593 Experimental RAFL06-16-G10 AV824235;AY075593 DYW7 protein
8 4 3 7 RAFL06-16-E16 AY090344 Experimental RAFL06-16-E16 AV785431;AV824229;AY090344 dehydrodolichyl diphosphate synthase - like protein
8 4 3 8 RAFL06-13-L14 AV824117 Experimental RAFL06-13-L14 AV785267;AV824117;AF462795 unknown protein
8 4 3 9 RAFL06-13-J24 AY090343 Experimental RAFL06-13-J24 AV785255;AV824107;AY090343 U2 snRNP auxiliary factor, putative
8 4 3 10 RAFL06-13-I05 AY058118 Experimental RAFL06-13-I05 AV785248;AV824098;AY058118 50S ribosomal protein L21 chloroplast precursor (CL21)
8 4 3 11 RAFL06-12-H12 AY058150 Experimental RAFL06-12-H12 AV785164;AV824034;AY058150 putative protein
8 4 3 12 RAFL06-12-D05 AY070771 Experimental RAFL06-12-D05 AV785140;AV824020;AY070771 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
8 4 3 13 RAFL06-12-H10 AV824033 Experimental RAFL06-12-H10 AV785163;AV824033 mitochondrial F1-ATPase, gamma subunit (ATP3_ARATH)
8 4 3 14 RAFL06-12-A20 AY075590 Experimental RAFL06-12-A20 AV785132;AV824016;AY075590 RING-H2 zinc finger like protein
8 4 4 1 RAFL07-07-G15 AY050799 Experimental RAFL07-07-G15 AV790807;AV825267;AY050799
8 4 4 2 RAFL07-07-B15 AY050969 Experimental RAFL07-07-B15 AV790755;AY050969 AtPP -like protein
8 4 4 3 RAFL07-07-E14 AY056130 Experimental RAFL07-07-E14 AV790780;AV825261;AY056130 unknown protein
8 4 4 4 RAFL07-07-K13 BT000667 Experimental RAFL07-07-K13 AV790849;AV825281;BT000667 monodehydroascorbate reductase
8 4 4 5 RAFL07-07-P12 AY045889 Experimental RAFL07-07-P12 AV790899;AV825297;AY045889 putative nucleoside triphosphatase
8 4 4 6 RAFL07-07-N11 AY059751 Experimental RAFL07-07-N11 AV790881;AV825291;AY059751 unknown protein (At1g78420)
8 4 4 7 RAFL07-07-A07 BT000695 Experimental RAFL07-07-A07 AV790742;AV825245;BT000695 Phospholipase like protein
8 4 4 8 RAFL07-07-K05 AY074376 Experimental RAFL07-07-K05 AV790845;AY074376 unknown protein
8 4 4 9 RAFL07-07-F05 AY050876 Experimental RAFL07-07-F05 AV790789;AV825262;AY050876 putative protein
8 4 4 10 RAFL07-07-I04 BT000668 Experimental RAFL07-07-I04 AV790820;AV825271;BT000668 nodulin-like protein
8 4 4 11 RAFL07-07-L03 AY050980 Experimental RAFL07-07-L03 AV790857;AV825284;AY050980 putative cytochrome P450 protein
8 4 4 12 RAFL07-07-J02 AY059750 Experimental RAFL07-07-J02 AV790830;AV825274;AY059750 abscisic acid-induced like protein
8 4 4 13 RAFL06-14-B16 AY058147 Experimental RAFL06-14-B16 AV785301;AV824140;AY058147 putative histone H2A
8 4 4 14 RAFL06-13-O21 AY058141 Experimental RAFL06-13-O21 AV785290;AV824132;AY058141 unknown protein
8 4 5 1 RAFL07-11-O03 BP561456 Experimental RAFL07-11-O03 AV791750;BP561456;AY054464 coatomer delta subunit (delta-coat protein) (delta-COP)
8 4 5 2 RAFL07-11-L03 AY081307 Experimental RAFL07-11-L03 AV791708;AV825608;AY081307 protein kinase like protein
8 4 5 3 RAFL07-08-M06 AY050991 Experimental RAFL07-08-M06 AV791086;AV825364;AY050991 unknown protein
8 4 5 4 RAFL07-08-F06 BP561415 Experimental RAFL07-08-F06 AV790985;BP561415;AY050901 putative proline-rich protein
8 4 5 5 RAFL07-08-D06 AY056294 Experimental RAFL07-08-D06 AV790951;AV825313;AY056294 Putative Serine/Threonine protein kinase
8 4 5 6 RAFL07-08-J05 AY050782 Experimental RAFL07-08-J05 AV791047;AV825349;AY050782 putative RNA-binding protein
8 4 5 7 RAFL07-08-E05 AY050984 Experimental RAFL07-08-E05 AV790967;AV825317;AY050984 unknown protein (At1g73920)
8 4 5 8 RAFL07-08-P04 AY056214 Experimental RAFL07-08-P04 AV791122;AV825375;AY056214 putative PCF2-like DNA binding protein
8 4 5 9 RAFL07-08-N01 AY056305 Experimental RAFL07-08-N01 AV791095;AV825366;AY056305 predicted protein of unknown function
8 4 5 10 RAFL07-07-J24 BP561406 Experimental RAFL07-07-J24 AV790841;BP561406;AY074377 acid phosphatase - like protein
8 4 5 11 RAFL07-07-C24 AY080622 Experimental RAFL07-07-C24 AV790765;AV825255;AY080622
8 4 5 12 RAFL07-07-C23 AY050779 Experimental RAFL07-07-C23 AV790764;AV825254;AY050779 putative alliin lyase
8 4 5 13 RAFL07-07-C22 AY045890 Experimental RAFL07-07-C22 AV790763;AV825253;AY045890 phosphoprotein phosphatase, putative
8 4 5 14 RAFL07-07-H21 AY051005 Experimental RAFL07-07-H21 AV790816;AV825269;AY051005 putative dehydrogenase (At1g71180)
8 4 6 1 RAFL07-12-E03 AV825648 Experimental RAFL07-12-E03 AV791842;AV825648
8 4 6 2 RAFL07-12-A03 AY081308 Experimental RAFL07-12-A03 AV791784;AV825632;AY081308 putative protein
8 4 6 3 RAFL07-12-N01 AV825691 Experimental RAFL07-12-N01 AV791973;AV825691
8 4 6 4 RAFL07-12-K01 AY081298 Experimental RAFL07-12-K01 AV791924;AY081298 putative peroxidase
8 4 6 5 RAFL07-11-O19 BT000453 Experimental RAFL07-11-O19 AV791764;AV825628;BT000453 luminal binding protein
8 4 6 6 RAFL07-11-K19 AY065185 Experimental RAFL07-11-K19 AV791702;AV825605;AY065185 unknown protein
8 4 6 7 RAFL07-11-N17 AY054514 Experimental RAFL07-11-N17 AV791746;AV825621;AY054514 unknown protein
8 4 6 8 RAFL07-11-O16 AY120754 Experimental RAFL07-11-O16 AV791761;AV825626;AY120754 chloride channel (emb|CAA70310.1)
8 4 6 9 RAFL07-11-J16 AY120750 Experimental RAFL07-11-J16 AV791681;AV825596;AY120750 unknown protein
8 4 6 10 RAFL07-11-K15 AY128379 Experimental RAFL07-11-K15 AV791699;AV825603;AY128379 Putative glycosyl transferase
8 4 6 11 RAFL07-11-J07 AY062640 Experimental RAFL07-11-J07 AV791678;AV825594;AY062640 TOM (target of myb1) -like protein
8 4 6 12 RAFL07-11-L06 AV825609 Experimental RAFL07-11-L06 AV791709;AV825609
8 4 6 13 RAFL07-11-N05 AV825617 Experimental RAFL07-11-N05 AV791734;AV825617 putative protein
8 4 6 14 RAFL07-11-J05 AY059835 Experimental RAFL07-11-J05 AV791677;AV825593;AY059835 unknown protein
8 4 7 1 RAFL07-16-L07 AY079159 Experimental RAFL07-16-L07 AV792800;AV825883;AY079159 putative leucyl tRNA synthetase
8 4 7 2 RAFL07-16-O05 AY125522 Experimental RAFL07-16-O05 AV792838;AV825896;AY125522 putative protein
8 4 7 3 RAFL07-16-K04 AY050376 Experimental RAFL07-16-K04 AV792791;AV825881;AY050376 dihydrolipoamide dehydrogenase lpd1
8 4 7 4 RAFL07-16-G03 BP561494 Experimental RAFL07-16-G03 AV792733;BP561494;AY065024 hypothetical protein
8 4 7 5 RAFL07-16-J02 AY045602 Experimental RAFL07-16-J02 AV792777;AV825878;AY045602 putative calmodulin
8 4 7 6 RAFL07-16-M01 AY065017 Experimental RAFL07-16-M01 AV792809;AV825886;AY065017 nucleolar protein-like
8 4 7 7 RAFL07-12-N09 AV825693 Experimental RAFL07-12-N09 AV791977;AV825693 kinesin-like protein
8 4 7 8 RAFL07-12-L09 AY059838 Experimental RAFL07-12-L09 AV791945;AV825679;AY059838 unknown protein
8 4 7 9 RAFL07-12-F09 BT000448 Experimental RAFL07-12-F09 AV791858;AV825657;BT000448 unknown protein
8 4 7 10 RAFL07-12-O08 BP561465 Experimental RAFL07-12-O08 AV791990;BP561465;AY128390
8 4 7 11 RAFL07-12-I08 AY065070 Experimental RAFL07-12-I08 AV791901;AY065070 putative 20S proteasome beta subunit PBC2
8 4 7 12 RAFL07-12-O07 BT002043 Experimental RAFL07-12-O07 AV791989;AV825696;BT002043 pseudogene
8 4 7 13 RAFL07-12-B04 BT000452 Experimental RAFL07-12-B04 AV791804;BT000452 mannan endo-1,4-beta-mannosidase
8 4 7 14 RAFL07-12-M03 AY062440 Experimental RAFL07-12-M03 AV791958;AV825683;AY062440 unknown protein
8 4 8 1 RAFL07-17-O11 AY091776 Experimental RAFL07-17-O11 AV793057;AV825955;AY091776 putative protein
8 4 8 2 RAFL07-17-I11 AY079162 Experimental RAFL07-17-I11 AV792966;AV825930;AY079162 putative endo-1,4-beta glucanase
8 4 8 3 RAFL07-17-K05 BP561504 Experimental RAFL07-17-K05 AV792992;BP561504;AY050432 unknown protein
8 4 8 4 RAFL07-17-A05 AY045620 Experimental RAFL07-17-A05 AV792862;AV825906;AY045620 putative RAS-related protein, RAB11C
8 4 8 5 RAFL07-17-M04 BP561506 Experimental RAFL07-17-M04 AV793021;BP561506;AY050374
8 4 8 6 RAFL07-17-H04 AY045613 Experimental RAFL07-17-H04 AV792948;AV825924;AY045613 putative tropinone reductase
8 4 8 7 RAFL07-17-L03 AY045605 Experimental RAFL07-17-L03 AV793008;AV825942;AY045605 putative protein
8 4 8 8 RAFL07-17-N02 AV825948 Experimental RAFL07-17-N02 AV793036;AV825948 protein kinase, putative
8 4 8 9 RAFL07-16-F21 BP561493 Experimental RAFL07-16-F21 AV792732;BP561493;AY050382 lysine decarboxylase - like protein
8 4 8 10 RAFL07-16-L20 AY050378 Experimental RAFL07-16-L20 AV792806;AV825885;AY050378 long-chain acyl-CoA like synthetase
8 4 8 11 RAFL07-16-M19 AY045616 Experimental RAFL07-16-M19 AV792819;AV825889;AY045616 unknown protein
8 4 8 12 RAFL07-16-K18 BP561498 Experimental RAFL07-16-K18 AV792796;BP561498;AY065023 hypothetical protein
8 4 8 13 RAFL07-16-H17 AY075641 Experimental RAFL07-16-H17 AV792755;AY075641 MAP3K like protein kinase
8 4 8 14 RAFL07-16-K16 AY050455 Experimental RAFL07-16-K16 AV792794;AV825882;AY050455 transcription factor inhibitor I kappa B, putative
8 4 9 1 RAFL08-11-O04 AY063903 Experimental RAFL08-11-O04 AV794202;AV826263;AY063903 P-Protein - like protein
8 4 9 2 RAFL08-11-I04 AY056239 Experimental RAFL08-11-I04 AV794101;AV826232;AY056239 putative protein
8 4 9 3 RAFL08-11-A04 AY056238 Experimental RAFL08-11-A04 AV793963;AV826200;AY056238 unknown protein
8 4 9 4 RAFL08-11-I03 AY050814 Experimental RAFL08-11-I03 AV794100;AV826231;AY050814 unknown protein
8 4 9 5 RAFL08-10-N20 AY063915 Experimental RAFL08-10-N20 AV793934;AY063915 sister-chromatide cohesion like protein
8 4 9 6 RAFL08-10-N18 AY056149 Experimental RAFL08-10-N18 AV793932;AV826188;AY056149 unknown protein
8 4 9 7 RAFL08-10-N15 AY056319 Experimental RAFL08-10-N15 AV793930;AV826187;AY056319 stromal ascorbate peroxidase
8 4 9 8 RAFL08-10-P13 BP561546 Experimental RAFL08-10-P13 AV793955;BP561546;AY050935
8 4 9 9 RAFL08-10-O12 AY056258 Experimental RAFL08-10-O12 AV793941;AV826194;AY056258 putative protein
8 4 9 10 RAFL08-10-O05 AY050918 Experimental RAFL08-10-O05 AV793939;AV826193;AY050918 unknown protein
8 4 9 11 RAFL07-17-K15 AY050461 Experimental RAFL07-17-K15 AV792999;AV825939;AY050461 unknown protein
8 4 9 12 RAFL07-17-C15 AY050377 Experimental RAFL07-17-C15 AV792888;AV825911;AY050377 putative protein
8 4 9 13 RAFL07-17-L13 AY065028 Experimental RAFL07-17-L13 AV793012;AV825944;AY065028
8 4 9 14 RAFL07-17-L12 AY050429 Experimental RAFL07-17-L12 AV793011;AV825943;AY050429 unknown protein
8 4 10 1 RAFL08-11-E19 AY059739 Experimental RAFL08-11-E19 AV794041;AV826215;AY059739 unknown protein
8 4 10 2 RAFL08-11-D18 BT000690 Experimental RAFL08-11-D18 AV794023;AV826211;BT000690 putative jasmonate inducible protein
8 4 10 3 RAFL08-11-L17 AY056325 Experimental RAFL08-11-L17 AV794164;AV826250;AY056325 unknown protein (At1g07840)
8 4 10 4 RAFL08-11-A17 BP561549 Experimental RAFL08-11-A17 AV793973;BP561549;AY064019 receptor protein kinase-like protein
8 4 10 5 RAFL08-11-K16 AY050827 Experimental RAFL08-11-K16 AV794144;AY050827 putative cytochrome P450
8 4 10 6 RAFL08-11-G16 AY074356 Experimental RAFL08-11-G16 AV794074;AV826220;AY074356 unknown protein
8 4 10 7 RAFL08-11-P13 BT000725 Experimental RAFL08-11-P13 AV794226;AV826267;BT000725 unknown protein
8 4 10 8 RAFL08-11-F13 AV826217 Experimental RAFL08-11-F13 AV794054;AV826217 unknown protein
8 4 10 9 RAFL08-11-J12 AY056323 Experimental RAFL08-11-J12 AV794123;AV826237;AY056323 histone acetyltransferase
8 4 10 10 RAFL08-11-A12 BT000701 Experimental RAFL08-11-A12 AV793969;AV826201;BT000701 polyubiquitin (ubq10)
8 4 10 11 RAFL08-11-N11 AY064017 Experimental RAFL08-11-N11 AV794192;AV826260;AY064017 disease resistance protein-like
8 4 10 12 RAFL08-11-L10 AY056251 Experimental RAFL08-11-L10 AV794159;AV826247;AY056251 sec14 cytosolic factor, putative
8 4 10 13 RAFL08-11-N05 AV826259 Experimental RAFL08-11-N05 AV794190;AV826259 putative phospholipase D-gamma
8 4 10 14 RAFL08-11-F05 AY063908 Experimental RAFL08-11-F05 AV794049;AV826216;AY063908 unknown protein
8 4 11 1 RAFL08-17-A06 AY059873 Experimental RAFL08-17-A06 AV795318;AV826523;AY059873 putative endoxyloglucan glycosyltransferase
8 4 11 2 RAFL08-17-C05 AY062537 Experimental RAFL08-17-C05 AV795336;AV826525;AY062537 nodulin-like protein
8 4 11 3 RAFL08-16-M20 AY128395 Experimental RAFL08-16-M20 AV795273;AV826511;AY128395 GTP-binding protein obg -like
8 4 11 4 RAFL08-16-M18 AY059871 Experimental RAFL08-16-M18 AV795271;AV826510;AY059871 unknown protein
8 4 11 5 RAFL08-16-H18 BP561613 Experimental RAFL08-16-H18 AV795204;BP561613;AY062534 Unknown protein (At5g64430; T12B11.2)
8 4 11 6 RAFL08-16-G17 AY062533 Experimental RAFL08-16-G17 AV795191;AV826495;AY062533 ethylene responsive element binding factor 1 (frameshift !)
8 4 11 7 RAFL08-16-P16 AY062664 Experimental RAFL08-16-P16 AV795309;AV826522;AY062664 Unknown protein (At3g25430; MWL2.4)
8 4 11 8 RAFL08-16-H16 BP561612 Experimental RAFL08-16-H16 AV795202;BP561612;AY062532 unknown protein
8 4 11 9 RAFL08-16-K07 AY059863 Experimental RAFL08-16-K07 AV795239;AV826504;AY059863 unknown protein
8 4 11 10 RAFL08-16-O05 AY059862 Experimental RAFL08-16-O05 AV795291;AV826516;AY059862 glucose-1-phosphate adenylyltransferase (APL3)
8 4 11 11 RAFL08-16-N03 AY062680 Experimental RAFL08-16-N03 AV795278;AV826514;AY062680 leucine-rich repeat receptor-like kinase At1g09970
8 4 11 12 RAFL08-16-G03 BP561611 Experimental RAFL08-16-G03 AV795181;BP561611 putative GTP-binding protein
8 4 11 13 RAFL08-16-H02 AY062668 Experimental RAFL08-16-H02 AV795197;AV826496;AY062668 flavonol 3-o-glucosyltransferase, putative
8 4 11 14 RAFL08-16-J01 AY059866 Experimental RAFL08-16-J01 AV795219;AV826502;AY059866 unknown protein
8 4 12 1 RAFL09-07-L03 AY128285 Experimental RAFL09-07-L03 AV796378;AV826833;AY128285 pherophorin - like protein
8 4 12 2 RAFL09-07-N02 AV796407 Experimental RAFL09-07-N02 AV796407;AF419574 putative phosphoprotein phosphatase
8 4 12 3 RAFL09-07-N01 AV826845 Experimental RAFL09-07-N01 AV796406;AV826845;AF419568 40S ribosomal protein S17
8 4 12 4 RAFL09-07-L01 BP561664 Experimental RAFL09-07-L01 AV796377;BP561664;AF424617 cyclin-dependent protein kinase-like protein
8 4 12 5 RAFL08-17-I19 AV826542 Experimental RAFL08-17-I19 AV795425;AV826542 1-aminocyclopropane-1-carboxylate oxidase
8 4 12 6 RAFL08-17-B19 BP561619 Experimental RAFL08-17-B19 AV795333;BP561619 RNA helicase, putative
8 4 12 7 RAFL08-17-J18 AY092987 Experimental RAFL08-17-J18 AV795436;AV826546;AY092987 shaggy-like protien kinase, kappa
8 4 12 8 RAFL08-17-J17 AY062679 Experimental RAFL08-17-J17 AV795435;AV826545;AY062679 dihydroxyacetone kinase, putative
8 4 12 9 RAFL08-17-D17 BP561621 Experimental RAFL08-17-D17 AV795353;BP561621;AY062678
8 4 12 10 RAFL08-17-P14 BP561628 Experimental RAFL08-17-P14 AV795518;BP561628;AY062548 putative protein
8 4 12 11 RAFL08-17-N08 AY092972 Experimental RAFL08-17-N08 AV795492;AV826555;AY092972 unknown protein
8 4 12 12 RAFL08-17-I08 BP561624 Experimental RAFL08-17-I08 AV795418;BP561624;AY120768
8 4 12 13 RAFL08-17-I07 AY062675 Experimental RAFL08-17-I07 AV795417;AV826540;AY062675 cytochrome P450 (Z97337.39)
8 4 12 14 RAFL08-17-E06 AY062674 Experimental RAFL08-17-E06 AV795359;AV826531;AY062674 N-hydroxycinnamoyl/benzoyltransferase - like protein
8 4 13 1 RAFL09-07-J22 AV826827 Experimental RAFL09-07-J22 AV796360;AV826827;AF419605 hnRNP-like protein
8 4 13 2 RAFL09-07-M21 AV826844 Experimental RAFL09-07-M21 AV796404;AV826844
8 4 13 3 RAFL09-07-P20 AV826860 Experimental RAFL09-07-P20 AV796446;AV826860;AF424627 putative protein
8 4 13 4 RAFL09-07-F20 AV826805 Experimental RAFL09-07-F20 AV796298;AV826805;AF419575 unknown protein
8 4 13 5 RAFL09-07-O18 AV826856 Experimental RAFL09-07-O18 AV796432;AV826856;AF424622 putative calmodulin-binding protein
8 4 13 6 RAFL09-07-G18 AV826815 Experimental RAFL09-07-G18 AV796317;AV826815;AF419555 putative protein
8 4 13 7 RAFL09-07-O12 AV826853 Experimental RAFL09-07-O12 AV796428;AV826853;AF419613 salt-stress induced tonoplast intrinsic protein
8 4 13 8 RAFL09-07-M11 AV826840 Experimental RAFL09-07-M11 AV796398;AV826840;AF419600 unknown protein
8 4 13 9 RAFL09-07-K11 BP561663 Experimental RAFL09-07-K11 AV796368;BP561663
8 4 13 10 RAFL09-07-P10 AV826859 Experimental RAFL09-07-P10 AV796439;AV826859;AF419572 MEK kinase MAP3Ka, putative
8 4 13 11 RAFL09-07-F10 AV826804 Experimental RAFL09-07-F10 AV796292;AV826804;AF419564 putative synaptobrevin
8 4 13 12 RAFL09-07-I09 AV826822 Experimental RAFL09-07-I09 AV796343;AV826822;AF419553 unknown protein
8 4 13 13 RAFL09-07-O04 AV826851 Experimental RAFL09-07-O04 AV796421;AV826851;AF419611 ATPase, calcium-transporting
8 4 13 14 RAFL09-07-J04 BP561662 Experimental RAFL09-07-J04 AV796352;BP561662;AF419599 unknown protein
8 4 14 1 RAFL09-11-J03 AV827123 Experimental RAFL09-11-J03 AV797302;AV827123;AF361582 unknown protein
8 4 14 2 RAFL09-11-E03 AV827096 Experimental RAFL09-11-E03 AV797222;AV827096;AF361577 putative protein
8 4 14 3 RAFL09-10-O19 AV827068 Experimental RAFL09-10-O19 AV797140;AV827068;AF361600 putative protein
8 4 14 4 RAFL09-10-P18 AV827073 Experimental RAFL09-10-P18 AV797153;AV827073;AF367345
8 4 14 5 RAFL09-10-O16 AV827067 Experimental RAFL09-10-O16 AV797137;AV827067;AF361594 unknown protein
8 4 14 6 RAFL09-10-O11 AV827066 Experimental RAFL09-10-O11 AV797133;AV827066 putative protein
8 4 14 7 RAFL09-10-P09 AV827071 Experimental RAFL09-10-P09 AV797146;AV827071;AF367335 putative ribosomal protein L8
8 4 14 8 RAFL09-10-O05 AV827065 Experimental RAFL09-10-O05 AV797130;AV827065;AF367333 F23M19.12/F23M19.12
9 1 1 1 RAFL09-12-B16 AY065069 Experimental RAFL09-12-B16 AV797433;AV827174;AY065069
9 1 1 2 RAFL09-12-P15 AY094398 Experimental RAFL09-12-P15 AV797659;AV827252;AY094398 putative ABC transporter
9 1 1 3 RAFL09-12-M15 AV827235 Experimental RAFL09-12-M15 AV797607;AV827235;AF361617 dTDP-glucose 4-6-dehydratase homolog D18
9 1 1 4 RAFL09-12-B15 AY065066 Experimental RAFL09-12-B15 AV797432;AY065066 signal recognition particle receptor-like protein
9 1 1 5 RAFL09-12-E12 AV827187 Experimental RAFL09-12-E12 AV797479;AV827187;AF367326 unknown protein
9 1 1 6 RAFL09-12-L11 AV827231 Experimental RAFL09-12-L11 AV797585;AV827231;AF367315 unknown protein
9 1 1 7 RAFL09-12-C11 AV827175 Experimental RAFL09-12-C11 AV797445;AV827175;AF361631 unknown protein
9 1 1 8 RAFL09-12-N10 BP561699 Experimental RAFL09-12-N10 AV797621;BP561699;AF361636 unknown protein
9 1 1 9 RAFL09-12-F10 AV827195 Experimental RAFL09-12-F10 AV797495;AV827195;AF367302
9 1 1 10 RAFL09-12-M09 AY037176 Experimental RAFL09-12-M09 AV797601;AV827234;AY037176 Vacuolar H+-ATPase subunit H (VHA-H)
9 1 1 11 RAFL09-12-I07 AV827212 Experimental RAFL09-12-I07 AV797538;AV827212;AF367323 amino acid aminotransferase like protein
9 1 1 12 RAFL09-12-O06 AV827245 Experimental RAFL09-12-O06 AV797637;AV827245;AF361616 unknown protein
9 1 1 13 RAFL09-12-L06 AV827227 Experimental RAFL09-12-L06 AV797580;AV827227;AF361627 putative acetone-cyanohydrin lyase
9 1 1 14 RAFL09-12-J06 BP561695 Experimental RAFL09-12-J06 AV797552;BP561695;AY037180 unknown protein
9 1 2 1 RAFL09-16-I06 AV827529 Experimental RAFL09-16-I06 AV798511;AV827529;AF370205 putative protein
9 1 2 2 RAFL09-16-A06 AY035062 Experimental RAFL09-16-A06 AV798376;AV827482;AY035062 unknown protein
9 1 2 3 RAFL09-16-J05 AV827533 Experimental RAFL09-16-J05 AV798526;AV827533;AF370140 unknown protein
9 1 2 4 RAFL09-16-F05 AV827511 Experimental RAFL09-16-F05 AV798456;AV827511;AF360176 protein kinase, putative
9 1 2 5 RAFL09-16-M04 AV827549 Experimental RAFL09-16-M04 AV798580;AV827549;AF360225 cinnamyl-alcohol dehydrogenase ELI3-1
9 1 2 6 RAFL09-16-F04 AV827510 Experimental RAFL09-16-F04 AV798455;AV827510;AF360139 unknown protein
9 1 2 7 RAFL09-16-C01 AV827493 Experimental RAFL09-16-C01 AV798405;AV827493;AF360323 unknown protein
9 1 2 8 RAFL09-15-G24 AY035061 Experimental RAFL09-15-G24 AV798227;AV827437;AY035061 unknown protein
9 1 2 9 RAFL09-15-N23 AV827473 Experimental RAFL09-15-N23 AV798339;AV827473;AF360340 pectinesterase
9 1 2 10 RAFL09-15-H22 AV827441 Experimental RAFL09-15-H22 AV798240;AV827441;AF360265 putative chloroplast 50S ribosomal protein, L6
9 1 2 11 RAFL09-15-L21 AV827464 Experimental RAFL09-15-L21 AV798303;AV827464;AF360221 putative transcription factor BHLH9
9 1 2 12 RAFL09-15-E21 AV827423 Experimental RAFL09-15-E21 AV798187;AV827423;AF360135 putative multispanning membrane protein
9 1 2 13 RAFL09-12-N16 AY094399 Experimental RAFL09-12-N16 AV797626;AY094399 putative bHLH transcription factor (bHLH017)
9 1 2 14 RAFL09-12-F16 AV827197 Experimental RAFL09-12-F16 AV797498;AV827197;AF367318 putative ABC transporter
9 1 3 1 RAFL11-01-A19 AY042797 Experimental RAFL11-01-A19 AV818857;AV832022;AY042797 small nuclear ribonucleoprotein-like protein
9 1 3 2 RAFL11-01-J18 AY059828 Experimental RAFL11-01-J18 AV818968;AV832050;AY059828 homeobox-leucine zipper protein ATHB-12
9 1 3 3 RAFL09-16-M17 AV827553 Experimental RAFL09-16-M17 AV798590;AV827553;AF360328 hypothetical protein
9 1 3 4 RAFL09-16-C17 AV798413 Experimental RAFL09-16-C17 AV798413
9 1 3 5 RAFL09-16-D16 AV827502 Experimental RAFL09-16-D16 AV798429;AV827502;AF370141 unknown protein
9 1 3 6 RAFL09-16-M15 AV798588 Experimental RAFL09-16-M15 AV798588 aminomethyltransferase-like precursor protein
9 1 3 7 RAFL09-16-J15 AV827535 Experimental RAFL09-16-J15 AV798533;AV827535;AF360231 MAP kinase 4
9 1 3 8 RAFL09-16-P14 AV798633 Experimental RAFL09-16-P14 AV798633;AF360180 putative cellulose synthase catalytic subunit
9 1 3 9 RAFL09-16-N10 AV827556 Experimental RAFL09-16-N10 AV798603;AV827556;AF360326 3-phosphoinositide-dependent protein kinase-1 (PDK1)
9 1 3 10 RAFL09-16-H10 AV827525 Experimental RAFL09-16-H10 AV798495;AV827525;AF360311 putative ubiquitin/ribosomal protein CEP52
9 1 3 11 RAFL09-16-B10 AV827489 Experimental RAFL09-16-B10 AV798395;AV827489;AF360344 FtsH like protease
9 1 3 12 RAFL09-16-H09 AV827524 Experimental RAFL09-16-H09 AV798494;AV827524 putative SPL1-related protein
9 1 3 13 RAFL09-16-P08 AV827566 Experimental RAFL09-16-P08 AV798630;AV827566;AF360228 glutathione reductase, cytosolic
9 1 3 14 RAFL09-16-K08 AV827542 Experimental RAFL09-16-K08 AV798547;AV827542;AF360142 unknown protein
9 1 4 1 RAFL11-02-E20 AY054548 Experimental RAFL11-02-E20 AV819091;AV832079;AY054548 MtN3-like protein
9 1 4 2 RAFL11-02-D19 AV832077 Experimental RAFL11-02-D19 AV819080;AV832077 putative proline-rich protein
9 1 4 3 RAFL11-02-I18 AV832089 Experimental RAFL11-02-I18 AV819142;AV832089;AF370462 Unknown protein (MGD8.2)
9 1 4 4 RAFL11-02-K17 AY054547 Experimental RAFL11-02-K17 AV819163;AV832096;AY054547 putative endoxyloglucan glycosyltransferase
9 1 4 5 RAFL11-02-N11 AY054546 Experimental RAFL11-02-N11 AV819197;AV832104;AY054546
9 1 4 6 RAFL11-02-B10 AV832072 Experimental RAFL11-02-B10 AV819054;AV832072;AF370508 polyamine oxidase, putative
9 1 4 7 RAFL11-02-P08 AV832110 Experimental RAFL11-02-P08 AV819219;AV832110
9 1 4 8 RAFL11-02-P06 AV832109 Experimental RAFL11-02-P06 AV819217;AV832109;AF370464
9 1 4 9 RAFL11-02-L06 AV832099 Experimental RAFL11-02-L06 AV819170;AV832099;AF370473 unknown protein
9 1 4 10 RAFL11-02-J06 AY054573 Experimental RAFL11-02-J06 AV819147;AY054573 putative 60S ribosomal protein L6
9 1 4 11 RAFL11-01-E22 AY054544 Experimental RAFL11-01-E22 AV818908;AV832039;AY054544 Unknown protein (At1g34270; F23M19.7)
9 1 4 12 RAFL11-01-N20 AY128369 Experimental RAFL11-01-N20 AV819019;AV832065;AY128369
9 1 4 13 RAFL11-01-C20 AY081288 Experimental RAFL11-01-C20 AV818879;AV832030;AY081288 unknown protein
9 1 4 14 RAFL11-01-K19 AV832054 Experimental RAFL11-01-K19 AV818984;AV832054;AF370504 unknown protein
9 1 5 1 RAFL11-09-L18 BT002064 Experimental RAFL11-09-L18 AV820339;BT002064 unknown protein
9 1 5 2 RAFL11-09-A18 BP562656 Experimental RAFL11-09-A18 AV820207;BP562656;AY093021 unknown protein
9 1 5 3 RAFL11-09-K17 AY136302 Experimental RAFL11-09-K17 AV820325;AV832277;AY136302 putative RNA-binding protein LAH1
9 1 5 4 RAFL11-09-I15 AY136301 Experimental RAFL11-09-I15 AV820301;AY136301 putative protein
9 1 5 5 RAFL11-09-C14 AY093043 Experimental RAFL11-09-C14 AV820228;AV832265;AY093043 hypothetical protein
9 1 5 6 RAFL11-09-O13 AY093042 Experimental RAFL11-09-O13 AV820369;AY093042 unknown protein
9 1 5 7 RAFL11-03-K10 AV832133 Experimental RAFL11-03-K10 AV819312;AV832133
9 1 5 8 RAFL11-03-I10 AV832128 Experimental RAFL11-03-I10 AV819292;AV832128
9 1 5 9 RAFL11-03-H09 AY054581 Experimental RAFL11-03-H09 AV819281;AV832126;AY054581 putative protein
9 1 5 10 RAFL11-03-J07 AY120734 Experimental RAFL11-03-J07 AV819299;AV832130;AY120734 putative protein
9 1 5 11 RAFL11-03-D07 AV832121 Experimental RAFL11-03-D07 AV819255;AV832121 heat shock protein (emb|CAA72514.1)
9 1 5 12 RAFL11-03-C04 AV832118 Experimental RAFL11-03-C04 AV819248;AV832118 putative protein
9 1 5 13 RAFL11-02-P21 AY120747 Experimental RAFL11-02-P21 AV819224;AV832112;AY120747 dnaK-type molecular chaperone hsc70.1
9 1 5 14 RAFL11-02-K20 AY081289 Experimental RAFL11-02-K20 AV819164;AV832097;AY081289 unknown protein
9 1 6 1 RAFL11-11-N07 AV832331 Experimental RAFL11-11-N07 AV820707;AV832331 spindle pole body protein-like
9 1 6 2 RAFL11-11-G07 AV820615 Experimental RAFL11-11-G07 AV820615
9 1 6 3 RAFL11-10-F22 AV832297 Experimental RAFL11-10-F22 AV820452;AV832297 putative protein
9 1 6 4 RAFL11-10-A22 AY093025 Experimental RAFL11-10-A22 AV820395;AY093025 endo-xyloglucan transferase - like protein
9 1 6 5 RAFL11-10-J20 AY136310 Experimental RAFL11-10-J20 AV820493;AV832304;AY136310 putative protein
9 1 6 6 RAFL11-10-F19 AY093050 Experimental RAFL11-10-F19 AV820451;AV832296;AY093050 putative protein
9 1 6 7 RAFL11-10-I18 AY093049 Experimental RAFL11-10-I18 AV820481;AV832302;AY093049 ATP sulfurylase
9 1 6 8 RAFL11-10-L16 AY136308 Experimental RAFL11-10-L16 AV820510;AV832308;AY136308 50S ribosomal protein L12-A
9 1 6 9 RAFL11-10-E06 AV832291 Experimental RAFL11-10-E06 AV820433;AV832291 ribosomal protein L11-like
9 1 6 10 RAFL11-10-F05 AY093048 Experimental RAFL11-10-F05 AV820447;AV832295;AY093048
9 1 6 11 RAFL11-10-F03 AY093023 Experimental RAFL11-10-F03 AV820445;AV832294;AY093023 unknown protein
9 1 6 12 RAFL11-10-G02 AY093022 Experimental RAFL11-10-G02 AV820453;AV832298;AY093022 calcium-dependent protein kinase (CPK29)
9 1 6 13 RAFL11-10-I01 AY072349 Experimental RAFL11-10-I01 AV820473;AV832301;AY072349 putative protein
9 1 6 14 RAFL11-09-I23 AY139980 Experimental RAFL11-09-I23 AV820305;AY139980 putative isoamylase
9 1 7 11 RAFL11-11-A11 BP562665 Experimental RAFL11-11-A11 AV820557;BP562665;AY139982
9 1 7 12 RAFL11-11-A10 AY093053 Experimental RAFL11-11-A10 AV820556;AV832309;AY093053 bZip transcription factor AtbZip61
9 1 7 13 RAFL11-11-F09 AV820605 Experimental RAFL11-11-F09 AV820605 putative aspartic protease
9 1 7 14 RAFL11-11-K08 AV820666 Experimental RAFL11-11-K08 AV820666
9 2 1 1 RAFL09-10-G23 BP561680 Experimental RAFL09-10-G23 AV797013;BP561680;AY058181 unknown protein
9 2 1 2 RAFL09-10-I22 AY058178 Experimental RAFL09-10-I22 AV797045;AV827020;AY058178 rac-GTP binding protein like
9 2 1 3 RAFL09-10-B22 AY128286 Experimental RAFL09-10-B22 AV796927;AV826978;AY128286 unknown protein
9 2 1 4 RAFL09-10-G21 AY058157 Experimental RAFL09-10-G21 AV797011;AV827005;AY058157 membrane protein
9 2 1 5 RAFL09-10-H18 AY058205 Experimental RAFL09-10-H18 AV797026;AV827010;AY058205 kinetochore protein Skp1, putative
9 2 1 6 RAFL09-10-I17 AY058191 Experimental RAFL09-10-I17 AV797040;AV827016;AY058191 unknown protein
9 2 1 7 RAFL09-10-G17 AY069884 Experimental RAFL09-10-G17 AV797008;AV827003;AY069884 putative myrosinase-binding protein
9 2 1 8 RAFL09-10-M16 AY058174 Experimental RAFL09-10-M16 AV797106;AV827048;AY058174 ethylene responsive element binding factor 1 (frameshift !)
9 2 1 9 RAFL09-10-K16 AV797074 Experimental RAFL09-10-K16 AV797074 unknown protein
9 2 1 10 RAFL09-10-D16 AY058160 Experimental RAFL09-10-D16 AV796952;AY058160
9 2 1 11 RAFL09-10-B11 BP561679 Experimental RAFL09-10-B11 AV796920;BP561679;AY058203 putative metal ion transporter (NRAMP)
9 2 1 12 RAFL09-10-H10 AY127017 Experimental RAFL09-10-H10 AV797021;AV827008;AY127017 receptor-like protein kinase
9 2 1 13 RAFL09-10-A10 AY069883 Experimental RAFL09-10-A10 AV796904;AV826972;AY069883 AtZW10
9 2 1 14 RAFL09-10-M09 AV827045 Experimental RAFL09-10-M09 AV797100;AV827045 ubiquitin isopeptidase T, 5' partial, putative
9 2 2 1 RAFL09-14-A10 AY053419 Experimental RAFL09-14-A10 AV797844;AV827321;AY053419 endomembrane protein, putative
9 2 2 2 RAFL09-14-G09 AV827353 Experimental RAFL09-14-G09 AV797943;AV827353;AF372961 epoxide hydrolase-like protein
9 2 2 3 RAFL09-14-H08 AV827357 Experimental RAFL09-14-H08 AV797961;AV827357;AF372956 unknown protein
9 2 2 4 RAFL09-14-E08 AV827344 Experimental RAFL09-14-E08 AV797910;AV827344;AF372941 diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase-like protein
9 2 2 5 RAFL09-14-K07 AV827367 Experimental RAFL09-14-K07 AV798008;AV827367;AF372934 CSN complex subunit 7i (CSN7) / FUS5
9 2 2 6 RAFL09-14-N06 AY053403 Experimental RAFL09-14-N06 AV798063;AV827387;AY053403 heat shock like protein
9 2 2 7 RAFL09-14-N02 BP561724 Experimental RAFL09-14-N02 AV798059;BP561724;AY053421 unknown protein
9 2 2 8 RAFL09-14-B02 AY053415 Experimental RAFL09-14-B02 AV797854;AV827324;AY053415 putative myo-inositol 1-phosphate synthase
9 2 2 9 RAFL09-14-I01 BP561719 Experimental RAFL09-14-I01 AV797972;BP561719;AF372953 unknown protein
9 2 2 10 RAFL09-14-E01 AY053409 Experimental RAFL09-14-E01 AV797904;AV827343;AY053409 beta-xylosidase - like protein
9 2 2 11 RAFL09-14-C01 AY053407 Experimental RAFL09-14-C01 AV797869;AV827329;AY053407 unknown protein
9 2 2 12 RAFL09-14-A01 AV827320 Experimental RAFL09-14-A01 AV797837;AV827320;AF372925 DNA-binding like protein
9 2 2 13 RAFL09-10-K24 AY069891 Experimental RAFL09-10-K24 AV797077;AV827032;AY069891 3-dehydroquinate synthase-like protein
9 2 2 14 RAFL09-10-M23 AY069886 Experimental RAFL09-10-M23 AV797109;AV827050;AY069886 putative chloroplast nucleoid DNA-binding protein
9 2 3 1 RAFL09-17-O17 AV827655 Experimental RAFL09-17-O17 AV798894;AV827655;AF360222 unknown protein
9 2 3 2 RAFL09-17-J17 AV827623 Experimental RAFL09-17-J17 AV798803;AV827623;AF360136 putative kinase (At1g49160)
9 2 3 3 RAFL09-14-K24 AV827371 Experimental RAFL09-14-K24 AV798019;AV827371;AF372975 putative protein
9 2 3 4 RAFL09-14-E24 AV827347 Experimental RAFL09-14-E24 AV797922;AV827347;AF372967 putative GDP-mannose pyrophosphorylase
9 2 3 5 RAFL09-14-L23 AY053414 Experimental RAFL09-14-L23 AV798038;AV827377;AY053414 alpha-glucosidase 1
9 2 3 6 RAFL09-14-F23 AV827350 Experimental RAFL09-14-F23 AV797937;AV827350;AF372943 SOF1 protein like protein
9 2 3 7 RAFL09-14-H22 AV827360 Experimental RAFL09-14-H22 AV797971;AV827360;AF372938 Ca2+ antiporter like protein
9 2 3 8 RAFL09-14-J21 BP561721 Experimental RAFL09-14-J21 AV797999;BP561721;AF372923 unknown protein (At1g69340)
9 2 3 9 RAFL09-14-E16 BP561715 Experimental RAFL09-14-E16 AV797915;BP561715;AF372972 putative transmembrane protein
9 2 3 10 RAFL09-14-C16 AV827333 Experimental RAFL09-14-C16 AV797881;AV827333
9 2 3 11 RAFL09-14-H15 AY094408 Experimental RAFL09-14-H15 AV797967;AV827359;AY094408 dynamin-like protein (pir||S59558)
9 2 3 12 RAFL09-14-D14 AV827338 Experimental RAFL09-14-D14 AV797896;AV827338;AF372944 adenylate translocator (brittle-1) - like protein
9 2 3 13 RAFL09-14-L13 AV827375 Experimental RAFL09-14-L13 AV798029;AV827375;AF372939 At1g63420/F2K11_19
9 2 3 14 RAFL09-14-M12 AV827382 Experimental RAFL09-14-M12 AV798049;AV827382;AF372921 putative protein
9 2 4 1 RAFL09-18-E10 AV827683 Experimental RAFL09-18-E10 AV798987;AV827683;AF360345 unknown protein
9 2 4 2 RAFL09-18-D09 AV827681 Experimental RAFL09-18-D09 AV798969;AV827681;AF360271 cytochrome P450 like protein
9 2 4 3 RAFL09-18-H08 AV799041 Experimental RAFL09-18-H08 AV799041 unknown protein
9 2 4 4 RAFL09-18-A08 AV827663 Experimental RAFL09-18-A08 AV798919;AV827663;AF360177 unknown protein
9 2 4 5 RAFL09-17-K24 AV827630 Experimental RAFL09-17-K24 AV798824;AV827630;AF360325 unknown protein
9 2 4 6 RAFL09-17-I24 AY035063 Experimental RAFL09-17-I24 AV798789;AY035063 unknown protein
9 2 4 7 RAFL09-17-N23 BP561751 Experimental RAFL09-17-N23 AV798882;BP561751;AY035043 fructose bisphosphate aldolase like protein
9 2 4 8 RAFL09-17-G23 AV827600 Experimental RAFL09-17-G23 AV798757;AV827600;AF360268 putative coated vesicle membrane protein
9 2 4 9 RAFL09-17-M22 AV827642 Experimental RAFL09-17-M22 AV798861;AV827642;AF360226 G2p (AtG2)
9 2 4 10 RAFL09-17-C22 AV827579 Experimental RAFL09-17-C22 AV798690;AV827579;AF360140 pectate lyase like protein
9 2 4 11 RAFL09-17-G19 AV798753 Experimental RAFL09-17-G19 AV798753 unknown protein
9 2 4 12 RAFL09-17-D19 AV827584 Experimental RAFL09-17-D19 AV798703;AV827584;AF360307 calmodulin-like protein
9 2 4 13 RAFL09-17-O18 AV827656 Experimental RAFL09-17-O18 AV798895;AV827656;AF360341
9 2 4 14 RAFL09-17-C18 AV827578 Experimental RAFL09-17-C18 AV798688;AV827578;AF370133 unknown protein
9 2 5 1 RAFL11-06-L09 BT002396 Experimental RAFL11-06-L09 AV819727;AV832227;BT002396 putative nematode-resistance protein
9 2 5 2 RAFL11-06-J07 AY054582 Experimental RAFL11-06-J07 AV819709;AY054582 unknown protein
9 2 5 3 RAFL11-06-I06 AY042804 Experimental RAFL11-06-I06 AV819698;AV832219;AY042804 putative RNA-binding protein
9 2 5 4 RAFL11-06-F06 AY042800 Experimental RAFL11-06-F06 AV819672;AV832212;AY042800 P-Protein - like protein
9 2 5 5 RAFL11-06-I05 AV832218 Experimental RAFL11-06-I05 AV819697;AV832218;AF370465 disease resistance protein RTM1
9 2 5 6 RAFL11-06-E04 BP562648 Experimental RAFL11-06-E04 AV819664;BP562648;AY065102 unknown protein
9 2 5 7 RAFL09-18-G23 AV827699 Experimental RAFL09-18-G23 AV799033;AV827699;AF360329 unknown protein
9 2 5 8 RAFL09-18-C22 AY035065 Experimental RAFL09-18-C22 AV798961;AV827678;AY035065 high affinity nitrate transporter - like protein
9 2 5 9 RAFL09-18-C21 AV827677 Experimental RAFL09-18-C21 AV798960;AV827677 acyl-(acyl carrier protein) thioesterase, putative
9 2 5 10 RAFL09-18-G19 AV827698 Experimental RAFL09-18-G19 AV799030;AV827698;AF360273 AALP protein
9 2 5 11 RAFL09-18-C18 AV827676 Experimental RAFL09-18-C18 AV798958;AV827676;AF360232 putative ethylene responsive element binding factor 4 protein
9 2 5 12 RAFL09-18-F16 AY035076 Experimental RAFL09-18-F16 AV799009;AV827691;AY035076 protein kinase, putative
9 2 5 13 RAFL09-18-B11 AV827670 Experimental RAFL09-18-B11 AV798937;AV827670 unknown protein
9 2 5 14 RAFL09-18-G10 AV827696 Experimental RAFL09-18-G10 AV799022;AV827696 putative bHLH transcription factor (bHLH046)
9 2 6 1 RAFL11-07-N23 AV832259 Experimental RAFL11-07-N23 AV819894;AV832259;AF370509 protein kinase, putative
9 2 6 2 RAFL11-07-L23 AY081294 Experimental RAFL11-07-L23 AV819882;AY081294
9 2 6 3 RAFL11-07-C13 BT002429 Experimental RAFL11-07-C13 AV819787;AV832243;BT002429 putative RING zinc finger protein
9 2 6 4 RAFL11-07-A12 AV832237 Experimental RAFL11-07-A12 AV819766;AV832237;AF370460 ribosomal protein S20 - like
9 2 6 5 RAFL11-07-P10 AV832261 Experimental RAFL11-07-P10 AV819905;AV832261
9 2 6 6 RAFL11-07-F10 AY065108 Experimental RAFL11-07-F10 AV819820;AV832250;AY065108 selenium-binding protein (Z97335.13)
9 2 6 7 RAFL11-07-C09 AY081291 Experimental RAFL11-07-C09 AV819784;AV832241;AY081291 putative protein
9 2 6 8 RAFL11-07-J08 AV819858 Experimental RAFL11-07-J08 AV819858
9 2 6 9 RAFL11-06-I22 AY128372 Experimental RAFL11-06-I22 AV819706;AV832222;AY128372 hypothetical protein
9 2 6 10 RAFL11-06-C21 AV832207 Experimental RAFL11-06-C21 AV819650;AV832207;AF370483
9 2 6 11 RAFL11-06-L19 BP562651 Experimental RAFL11-06-L19 AV819733;BP562651
9 2 6 12 RAFL11-06-N18 AV832233 Experimental RAFL11-06-N18 AV819748;AV832233 ER-type Ca2+-pump protein
9 2 6 13 RAFL11-06-H17 AV832217 Experimental RAFL11-06-H17 AV819692;AV832217;AF370475 unknown protein
9 2 6 14 RAFL11-06-D15 AY054585 Experimental RAFL11-06-D15 AV819658;AV832209;AY054585 putative bHLH transcription factor (bHLH105)
9 3 1 1 RAFL09-12-B14 AV827173 Experimental RAFL09-12-B14 AV797431;AV827173;AF361628
9 3 1 2 RAFL09-12-K13 AV827222 Experimental RAFL09-12-K13 AV797569;AV827222;AF361638 unknown protein
9 3 1 3 RAFL09-12-E13 AV827188 Experimental RAFL09-12-E13 AV797480;AV827188;AF361619 unknown protein
9 3 1 4 RAFL09-12-B13 AY065068 Experimental RAFL09-12-B13 AV797430;AV827172;AY065068 receptor kinase like protein
9 3 1 5 RAFL09-12-I09 AY094396 Experimental RAFL09-12-I09 AV797540;AV827213;AY094396 putative heat shock transcription factor
9 3 1 6 RAFL09-12-F09 AV827194 Experimental RAFL09-12-F09 AV797494;AV827194;AF367312 receptor-like protein kinase
9 3 1 7 RAFL09-12-D09 AV827180 Experimental RAFL09-12-D09 AV797459;AV827180;AF361633 putative chloroplast protein import component
9 3 1 8 RAFL09-12-L08 AY037181 Experimental RAFL09-12-L08 AV797582;AV827229;AY037181 DNA repair protein RAD23 homolog
9 3 1 9 RAFL09-12-E08 AV827185 Experimental RAFL09-12-E08 AV797476;AV827185;AF367306 unknown protein
9 3 1 10 RAFL09-12-M07 AY037175 Experimental RAFL09-12-M07 AV797599;AV827233;AY037175 unknown protein
9 3 1 11 RAFL09-12-D05 AV827178 Experimental RAFL09-12-D05 AV797455;AV827178;AF367324 putative protein
9 3 1 12 RAFL09-12-A05 AV827160 Experimental RAFL09-12-A05 AV797407;AV827160;AF361611 unknown protein
9 3 1 13 RAFL09-12-M04 BP561698 Experimental RAFL09-12-M04 AV797597;BP561698;AY037184
9 3 1 14 RAFL09-12-E04 AY037182 Experimental RAFL09-12-E04 AV797473;AV827184;AY037182 unknown protein
9 3 2 1 RAFL09-16-A04 AV827481 Experimental RAFL09-16-A04 AV798374;AV827481 putative membrane transporter
9 3 2 2 RAFL09-16-B03 AV827485 Experimental RAFL09-16-B03 AV798388;AV827485
9 3 2 3 RAFL09-16-I02 AV827527 Experimental RAFL09-16-I02 AV798509;AV827527 nodulin-like protein
9 3 2 4 RAFL09-16-G02 AV827517 Experimental RAFL09-16-G02 AV798473;AV827517;AF360266 unknown protein (At1g23440)
9 3 2 5 RAFL09-16-M01 AV827548 Experimental RAFL09-16-M01 AV798578;AV827548;AF360223 limonene cyclase, putative
9 3 2 6 RAFL09-16-G01 AV827516 Experimental RAFL09-16-G01 AV798472;AV827516;AF360137 unknown protein
9 3 2 7 RAFL09-15-M20 AV827468 Experimental RAFL09-15-M20 AV798319;AV827468;AF360322 unknown protein
9 3 2 8 RAFL09-15-D20 AV827418 Experimental RAFL09-15-D20 AV798172;AV827418;AF360305 putative cold acclimation protein
9 3 2 9 RAFL09-15-P19 AV798368 Experimental RAFL09-15-P19 AV798368;AF360338 Hypothetical protein
9 3 2 10 RAFL09-15-L19 AV827463 Experimental RAFL09-15-L19 AV798302;AV827463;AF360263 unknown protein
9 3 2 11 RAFL09-15-H19 AV827440 Experimental RAFL09-15-H19 AV798237;AV827440;AF360219 lipase-like protein
9 3 2 12 RAFL09-15-E19 AV827422 Experimental RAFL09-15-E19 AV798186;AV827422;AF360134 cdc2-like protein kinase
9 3 2 13 RAFL09-12-O14 AY094397 Experimental RAFL09-12-O14 AV797642;AV827246;AY094397 hypothetical protein
9 3 2 14 RAFL09-12-G14 AV827204 Experimental RAFL09-12-G14 AV797512;AV827204;AF361613 unknown protein
9 3 3 1 RAFL11-01-K15 AV832053 Experimental RAFL11-01-K15 AV818981;AV832053;AF370522 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
9 3 3 2 RAFL11-01-C15 AV818875 Experimental RAFL11-01-C15 AV818875 putative protein
9 3 3 3 RAFL09-16-F14 AV827513 Experimental RAFL09-16-F14 AV798463;AV827513
9 3 3 4 RAFL09-16-K13 AV827543 Experimental RAFL09-16-K13 AV798550;AV827543;AF360312 putative DNA-binding protein protein RAV2
9 3 3 5 RAFL09-16-N12 AY035044 Experimental RAFL09-16-N12 AV798605;AV827557;AY035044 unknown protein
9 3 3 6 RAFL09-16-E12 AV827507 Experimental RAFL09-16-E12 AV798443;AV827507;AF360272
9 3 3 7 RAFL09-16-K11 BP561739 Experimental RAFL09-16-K11 AV798549;BP561739;AF360229 unknown protein
9 3 3 8 RAFL09-16-E11 AV827506 Experimental RAFL09-16-E11 AV798442;AV827506;AF360178 unknown protein
9 3 3 9 RAFL09-16-E08 AV827505 Experimental RAFL09-16-E08 AV798440;AV827505;AF370206 unknown protein
9 3 3 10 RAFL09-16-C08 AV827495 Experimental RAFL09-16-C08 AV798407;AV827495;AF360309 nucleotide-binding protein
9 3 3 11 RAFL09-16-A08 AV827483 Experimental RAFL09-16-A08 AV798378;AV827483;AF360342 unknown protein
9 3 3 12 RAFL09-16-O07 AV827559 Experimental RAFL09-16-O07 AV798617;AV827559;AF360269 nucleotide pyrophosphatase -like protein
9 3 3 13 RAFL09-16-K07 AV798546 Experimental RAFL09-16-K07 AV798546;AF360227
9 3 3 14 RAFL09-16-G07 AY091151 Experimental RAFL09-16-G07 AV798477;AV827518;AY091151
9 3 4 1 RAFL11-02-A15 AY054575 Experimental RAFL11-02-A15 AV819044;AV832071;AY054575 putative transcription factor
9 3 4 2 RAFL11-02-D14 AY054574 Experimental RAFL11-02-D14 AV819077;AV832076;AY054574 G-box binding bZip transcription factor GBF1 / AtbZip41
9 3 4 3 RAFL11-02-O13 BT001981 Experimental RAFL11-02-O13 AV819211;AV832108;BT001981 unknown protein
9 3 4 4 RAFL11-02-L12 AY120746 Experimental RAFL11-02-L12 AV819174;AV832101;AY120746 putative protein
9 3 4 5 RAFL11-02-L04 BP562636 Experimental RAFL11-02-L04 AV819168;BP562636;AF370500 unknown protein
9 3 4 6 RAFL11-02-O03 AV832107 Experimental RAFL11-02-O03 AV819207;AV832107
9 3 4 7 RAFL11-02-L02 AY065101 Experimental RAFL11-02-L02 AV819167;AV832098;AY065101 putative protein
9 3 4 8 RAFL11-02-J01 AY042802 Experimental RAFL11-02-J01 AV819145;AV832090;AY042802 putative auxin-regulated protein
9 3 4 9 RAFL11-01-K24 AV832055 Experimental RAFL11-01-K24 AV818985;AV832055;AF370494 2-oxoglutarate/malate translocator precursor -like protein
9 3 4 10 RAFL11-01-E23 AY042811 Experimental RAFL11-01-E23 AV818909;AV832040;AY042811 unknown protein
9 3 4 11 RAFL11-01-D18 AV832034 Experimental RAFL11-01-D18 AV818892;AV832034;AF370505 unknown protein
9 3 4 12 RAFL11-01-J17 AV832049 Experimental RAFL11-01-J17 AV818967;AV832049;AF370513 receptor-like serine/threonine kinase, putative
9 3 4 13 RAFL11-01-G16 BT002374 Experimental RAFL11-01-G16 AV818931;BP562634;BT002374 mitochondrial Lon protease homolog 1 precursor (sp|O64948)
9 3 4 14 RAFL11-01-D16 AV832033 Experimental RAFL11-01-D16 AV818891;AV832033;AF370501 unknown protein
9 3 5 1 RAFL11-09-A12 AV820206 Experimental RAFL11-09-A12 AV820206 aspartate aminotransferase Asp2
9 3 5 2 RAFL11-09-C11 AV832263 Experimental RAFL11-09-C11 AV820226;AV832263 60S ribosomal protein L7
9 3 5 3 RAFL11-09-K10 AV832276 Experimental RAFL11-09-K10 AV820321;AV832276 nitrate reductase (At1g37130)
9 3 5 4 RAFL11-09-H07 AY072361 Experimental RAFL11-09-H07 AV820287;AY072361 glycine-rich RNA-binding protein AtGRP2 - like
9 3 5 5 RAFL11-09-O05 AV820366 Experimental RAFL11-09-O05 AV820366 putative 4-hydroxyphenylpyruvate dioxygenase (HPD)
9 3 5 6 RAFL11-09-L03 AV820331 Experimental RAFL11-09-L03 AV820331 unknown protein
9 3 5 7 RAFL11-03-A03 AY120733 Experimental RAFL11-03-A03 AV819227;AV832114;AY120733 unknown protein
9 3 5 8 RAFL11-03-C02 BP562638 Experimental RAFL11-03-C02 AV819247;BP562638 lipoamide dehydrogenase precursor
9 3 5 9 RAFL11-03-A02 BT002025 Experimental RAFL11-03-A02 AV819226;AV832113;BT002025 unknown
9 3 5 10 RAFL11-02-N24 BT002014 Experimental RAFL11-02-N24 AV819206;AV832106;BT002014 indole-3-acetate beta-glucosyltransferase like protein
9 3 5 11 RAFL11-02-H23 AY054578 Experimental RAFL11-02-H23 AV819132;AV832086;AY054578 unknown protein
9 3 5 12 RAFL11-02-D23 AV832078 Experimental RAFL11-02-D23 AV819082;AV832078 Putative 40S ribosomal protein S15A
9 3 5 13 RAFL11-02-G16 BT001992 Experimental RAFL11-02-G16 AV819116;AV832085;BT001992 unknown
9 3 5 14 RAFL11-02-J15 AV832091 Experimental RAFL11-02-J15 AV819151;AV832091;AF370471 putative ribosomal protein S13
9 3 6 1 RAFL11-11-F02 AY136311 Experimental RAFL11-11-F02 AV820599;AY136311 hypothetical protein
9 3 6 2 RAFL11-10-C24 AY093027 Experimental RAFL11-10-C24 AV820416;AV832287;AY093027 hypothetical protein
9 3 6 3 RAFL11-10-L14 AV832307 Experimental RAFL11-10-L14 AV820509;AV832307 unknown protein
9 3 6 4 RAFL11-10-E14 AV832292 Experimental RAFL11-10-E14 AV820438;AV832292
9 3 6 5 RAFL11-10-G12 AV832299 Experimental RAFL11-10-G12 AV820458;AV832299 unknown protein
9 3 6 6 RAFL11-10-G11 BT002448 Experimental RAFL11-10-G11 AV820457;BT002448
9 3 6 7 RAFL11-10-B10 AY136306 Experimental RAFL11-10-B10 AV820399;AV832285;AY136306 unknown protein
9 3 6 8 RAFL11-10-A07 AV832283 Experimental RAFL11-10-A07 AV820387;AV832283 putative RNA-binding protein LAH1
9 3 6 9 RAFL11-09-L22 BT002446 Experimental RAFL11-09-L22 AV820341;BT002446 putative steroid binding protein
9 3 6 10 RAFL11-09-G22 AY072359 Experimental RAFL11-09-G22 AV820283;AV832273;AY072359 unknown protein
9 3 6 11 RAFL11-09-C22 AY136304 Experimental RAFL11-09-C22 AV820233;AV832267;AY136304 putative wound induced protein
9 3 6 12 RAFL11-09-J21 AY136303 Experimental RAFL11-09-J21 AV820314;AV832274;AY136303 vacuolar sorting receptor-like protein
9 3 6 13 RAFL11-09-D20 AY072357 Experimental RAFL11-09-D20 AV820245;AV832269;AY072357 putative endochitinase
9 3 6 14 RAFL11-09-N19 AV820361 Experimental RAFL11-09-N19 AV820361 putative protein
9 3 7 11 RAFL11-11-E06 AY136324 Experimental RAFL11-11-E06 AV820591;AV832313;AY136324 putative 40S ribosomal protein SA (laminin receptor-like protein)
9 3 7 12 RAFL11-11-J05 AV832323 Experimental RAFL11-11-J05 AV820652;AV832323 conglutin gamma - like protein
9 3 7 13 RAFL11-11-M04 AV820689 Experimental RAFL11-11-M04 AV820689
9 3 7 14 RAFL11-11-F03 AV832314 Experimental RAFL11-11-F03 AV820600;AV832314 S18.A ribosomal protein
9 4 1 1 RAFL09-10-D20 AY058187 Experimental RAFL09-10-D20 AV796956;AY058187 putative glutathione peroxidase
9 4 1 2 RAFL09-10-H19 AY058176 Experimental RAFL09-10-H19 AV797027;AV827011;AY058176
9 4 1 3 RAFL09-10-M18 AV827049 Experimental RAFL09-10-M18 AV797107;AV827049;AF462828 S-adenosyl-L-homocysteinas, putative
9 4 1 4 RAFL09-10-J18 AY058161 Experimental RAFL09-10-J18 AV797059;AV827023;AY058161 auxin-responsive GH3 homolog (CF4)
9 4 1 5 RAFL09-10-N14 AY058197 Experimental RAFL09-10-N14 AV797121;AV827058;AY058197 pectate lyase
9 4 1 6 RAFL09-10-B14 AY058192 Experimental RAFL09-10-B14 AV796923;AV826977;AY058192 calcium-binding protein - like
9 4 1 7 RAFL09-10-M12 AY058183 Experimental RAFL09-10-M12 AV797103;AV827046;AY058183
9 4 1 8 RAFL09-10-I12 BP561682 Experimental RAFL09-10-I12 AV797037;BP561682;AY058172 putative protein
9 4 1 9 RAFL09-10-A12 AY058163 Experimental RAFL09-10-A12 AV796905;AV826973;AY058163 unknown protein
9 4 1 10 RAFL09-10-F11 AV826996 Experimental RAFL09-10-F11 AV796987;AV826996 cobalamin biosynthesis protein
9 4 1 11 RAFL09-10-N07 AY058195 Experimental RAFL09-10-N07 AV797115;AV827054;AY058195 uracil transporter - like protein
9 4 1 12 RAFL09-10-J07 AY069890 Experimental RAFL09-10-J07 AV797050;AV827022;AY069890 unknown protein
9 4 1 13 RAFL09-10-C07 AY058184 Experimental RAFL09-10-C07 AV796931;AV826981;AY058184 putative RING zinc finger protein
9 4 1 14 RAFL09-10-N06 AY069881 Experimental RAFL09-10-N06 AV797114;AV827053;AY069881 putative protein
9 4 2 1 RAFL09-14-J06 AV797991 Experimental RAFL09-14-J06 AV797991;AF372974 putative aspartic protease
9 4 2 2 RAFL09-14-K05 AV827366 Experimental RAFL09-14-K05 AV798006;AV827366;AF372966 putative protein
9 4 2 3 RAFL09-14-K04 AV827365 Experimental RAFL09-14-K04 AV798005;AV827365;AF372958 putative protein
9 4 2 4 RAFL09-14-C04 BP561714 Experimental RAFL09-14-C04 AV797872;BP561714;AF372947 putative protein
9 4 2 5 RAFL09-14-M03 AV827380 Experimental RAFL09-14-M03 AV798042;AV827380;AF372932 putative protein
9 4 2 6 RAFL09-14-C03 AY053404 Experimental RAFL09-14-C03 AV797871;AY053404 phytochrome-associated protein PAP2
9 4 2 7 RAFL09-13-E24 AV827273 Experimental RAFL09-13-E24 AV797723;AV827273;AF372978 putative protein
9 4 2 8 RAFL09-13-I23 AV827295 Experimental RAFL09-13-I23 AV797764;AV827295;AF372962 hypothetical protein
9 4 2 9 RAFL09-13-M21 AV827306 Experimental RAFL09-13-M21 AV797799;AV827306;AF372960 unknown protein
9 4 2 10 RAFL09-13-M20 AY053411 Experimental RAFL09-13-M20 AV797798;AV827305;AY053411 unknown protein (At1g31070)
9 4 2 11 RAFL09-13-O19 AV797821 Experimental RAFL09-13-O19 AV797821;AF372937
9 4 2 12 RAFL09-13-F19 AV827281 Experimental RAFL09-13-F19 AV797735;AV827281;AF372920 unknown protein
9 4 2 13 RAFL09-10-A21 AV826974 Experimental RAFL09-10-A21 AV796911;AV826974 phospholipase D
9 4 2 14 RAFL09-10-J20 AY069887 Experimental RAFL09-10-J20 AV797061;AV827024;AY069887 putative protein
9 4 3 1 RAFL09-17-I15 AV827614 Experimental RAFL09-17-I15 AV798784;AV827614;AF360220 putative ubiquinol-cytochrome c reductase
9 4 3 2 RAFL09-17-D15 AV798699 Experimental RAFL09-17-D15 AV798699
9 4 3 3 RAFL09-14-G20 BP561718 Experimental RAFL09-14-G20 AV797950;BP561718;AF372971 ribonucleoside-diphosphate reductase small chain
9 4 3 4 RAFL09-14-J18 AV827364 Experimental RAFL09-14-J18 AV797997;AV827364;AF372964 glucose 6 phosphate/phosphate translocator-like protein
9 4 3 5 RAFL09-14-D18 AV827340 Experimental RAFL09-14-D18 AV797899;AV827340;AF372955 unknown protein
9 4 3 6 RAFL09-14-F17 AV827349 Experimental RAFL09-14-F17 AV797933;AV827349;AF372948 lipase, putative
9 4 3 7 RAFL09-14-M16 AV827384 Experimental RAFL09-14-M16 AV798053;AV827384;AF372940 endo-beta-1,4-glucanase, putative
9 4 3 8 RAFL09-14-K16 AY053406 Experimental RAFL09-14-K16 AV798014;AV827370;AY053406 putative protein
9 4 3 9 RAFL09-14-E12 AY053418 Experimental RAFL09-14-E12 AV797912;AV827345;AY053418 transformer-SR ribonucleoprotein, putative
9 4 3 10 RAFL09-14-B12 AY053416 Experimental RAFL09-14-B12 AV797861;AV827327;AY053416 unknown protein
9 4 3 11 RAFL09-14-K11 AV827368 Experimental RAFL09-14-K11 AV798010;AV827368;AF372952 unknown protein
9 4 3 12 RAFL09-14-D11 AV827337 Experimental RAFL09-14-D11 AV797893;AV827337;AF372949 putative alpha-L-arabinofuranosidase
9 4 3 13 RAFL09-14-A11 BP561713 Experimental RAFL09-14-A11 AV797845;BP561713;AF372931 putative protein (At1g54870)
9 4 3 14 RAFL09-14-D10 AY053405 Experimental RAFL09-14-D10 AV797892;AV827336;AY053405 coatomer zeta subunit like protein
9 4 4 1 RAFL09-18-C05 AV827674 Experimental RAFL09-18-C05 AV798949;AV827674;AF360343 unknown protein
9 4 4 2 RAFL09-18-D04 AV827679 Experimental RAFL09-18-D04 AV798966;AV827679;AF360270 unknown protein
9 4 4 3 RAFL09-18-A03 AY045776 Experimental RAFL09-18-A03 AV798916;AV827662;AY045776 putative beta-fructofuranosidase 1
9 4 4 4 RAFL09-18-A01 AV827661 Experimental RAFL09-18-A01 AV798915;AV827661;AF360141 unknown protein
9 4 4 5 RAFL09-17-N21 AV827649 Experimental RAFL09-17-N21 AV798880;AV827649;AF360324 serine/threonine-specific protein kinase MHK
9 4 4 6 RAFL09-17-I21 AV827617 Experimental RAFL09-17-I21 AV798788;AV827617;AF360308 unknown protein
9 4 4 7 RAFL09-17-E21 AV798721 Experimental RAFL09-17-E21 AV798721 putative pectinacetylesterase protein
9 4 4 8 RAFL09-17-J20 AV827624 Experimental RAFL09-17-J20 AV798805;AV827624;AF360267 unknown protein
9 4 4 9 RAFL09-17-O19 AV827657 Experimental RAFL09-17-O19 AV798896;AV827657;AF360224 unknown protein
9 4 4 10 RAFL09-17-L19 AV827635 Experimental RAFL09-17-L19 AV798841;AV827635;AF360138 putative protein kinase
9 4 4 11 RAFL09-17-H17 AY045781 Experimental RAFL09-17-H17 AV798769;AV827606;AY045781
9 4 4 12 RAFL09-17-A17 BP561741 Experimental RAFL09-17-A17 AV798653;BP561741;AF360306 unknown protein
9 4 4 13 RAFL09-17-I16 AV827615 Experimental RAFL09-17-I16 AV798785;AV827615;AF360339 putative leucine rich protein
9 4 4 14 RAFL09-17-E16 AV827591 Experimental RAFL09-17-E16 AV798718;AV827591;AF360264 unknown protein
9 4 5 1 RAFL11-06-N03 AV832230 Experimental RAFL11-06-N03 AV819740;AV832230;AF370514 Unknown protein (K9P8.9)
9 4 5 2 RAFL11-06-E02 AV819663 Experimental RAFL11-06-E02 AV819663;AF370461 embryo-specific protein 3 (ATS3)
9 4 5 3 RAFL11-06-B01 AV832203 Experimental RAFL11-06-B01 AV819627;AV832203;AF370486 nucleotide pyrophosphatase - like protein
9 4 5 4 RAFL11-05-N23 AV832198 Experimental RAFL11-05-N23 AV819603;AV832198 hypothetical protein
9 4 5 5 RAFL11-05-N22 AY054583 Experimental RAFL11-05-N22 AV819602;AV832197;AY054583 33 kDa polypeptide of oxygen-evolving complex (OEC) in photosystem II (emb|CAA75629.1)
9 4 5 6 RAFL11-05-N21 AV832196 Experimental RAFL11-05-N21 AV819601;AV832196;AF370497 Unknown protein (A_IG002N01.8)
9 4 5 7 RAFL09-18-C16 AV827675 Experimental RAFL09-18-C16 AV798956;AV827675;AF360327 putative metal-binding protein
9 4 5 8 RAFL09-18-B15 AY035064 Experimental RAFL09-18-B15 AV798940;AV827672;AY035064 unknown protein
9 4 5 9 RAFL09-18-C14 AY039914 Experimental RAFL09-18-C14 AV798954;AY039914 nitrate reductase (At1g37130)
9 4 5 10 RAFL09-18-A14 AV827665 Experimental RAFL09-18-A14 AV798925;AV827665;AF370134 unknown protein
9 4 5 11 RAFL09-18-D13 AV798973 Experimental RAFL09-18-D13 AV798973;AF360230 unknown protein
9 4 5 12 RAFL09-18-E12 AV827684 Experimental RAFL09-18-E12 AV798989;AV827684;AF360179 unknown protein
9 4 5 13 RAFL09-18-H06 AY035072 Experimental RAFL09-18-H06 AV799039;AV827702;AY035072
9 4 5 14 RAFL09-18-G05 AV827695 Experimental RAFL09-18-G05 AV799019;AV827695;AF360310 putative protein
9 4 6 1 RAFL11-07-N15 BT002069 Experimental RAFL11-07-N15 AV819890;AV832258;BT002069 putative cytochrome P450
9 4 6 2 RAFL11-07-L13 AV819877 Experimental RAFL11-07-L13 AV819877 Unknown protein (F24O1.10)
9 4 6 3 RAFL11-07-F06 AV832249 Experimental RAFL11-07-F06 AV819817;AV832249 60S ribosomal protein L18A
9 4 6 4 RAFL11-07-H05 BP562653 Experimental RAFL11-07-H05 AV819836;BP562653
9 4 6 5 RAFL11-07-J02 AY054587 Experimental RAFL11-07-J02 AV819853;AV832253;AY054587 unknown protein
9 4 6 6 RAFL11-07-C02 AY054553 Experimental RAFL11-07-C02 AV819780;AV832240;AY054553 putative protein
9 4 6 7 RAFL11-07-D01 AY054552 Experimental RAFL11-07-D01 AV819793;AV832244;AY054552 ribulose bisphosphate carboxylase small chain 3b precursor (RuBisCO small subunit 3b) (sp|P10798)
9 4 6 8 RAFL11-06-F23 AY054586 Experimental RAFL11-06-F23 AV819679;AV832214;AY054586 expansin precursor - like protein
9 4 6 9 RAFL11-06-K14 BP562650 Experimental RAFL11-06-K14 AV819720;BP562650;AF370481
9 4 6 10 RAFL11-06-M12 BT000467 Experimental RAFL11-06-M12 AV819736;BT000467 eukaryotic initiation factor 4, eIF4-like protein
9 4 6 11 RAFL11-06-C12 AV832206 Experimental RAFL11-06-C12 AV819644;AV832206;AF370507 unknown protein
9 4 6 12 RAFL11-06-K11 BT000457 Experimental RAFL11-06-K11 AV819718;AV832226;BT000457
9 4 6 13 RAFL11-06-O10 AV832234 Experimental RAFL11-06-O10 AV819753;AV832234;AF370468 unknown protein
9 4 6 14 RAFL11-06-I10 AY062638 Experimental RAFL11-06-I10 AV819701;AV832220;AY062638 NAM-like protein (No Apical Meristem)
9 4 7 11 RAFL11-07-B22 AY081293 Experimental RAFL11-07-B22 AV819779;AY081293 splicing factor, putative
9 4 7 12 RAFL11-07-G20 BT001983 Experimental RAFL11-07-G20 AV819833;BP562652;BT001983
9 4 7 13 RAFL11-07-D18 AY054590 Experimental RAFL11-07-D18 AV819804;AV832247;AY054590 isp4 like protein
9 4 7 14 RAFL11-07-B16 AV832238 Experimental RAFL11-07-B16 AV819776;AV832238 unknown protein
10 1 1 1 RAFL09-13-H17 AY139757 Experimental RAFL09-13-H17 AV797749;AV827289;AY139757
10 1 1 2 RAFL09-13-C17 AV827264 Experimental RAFL09-13-C17 AV797702;AV827264 subtilisin proteinase like protein
10 1 1 3 RAFL09-13-M16 AV827304 Experimental RAFL09-13-M16 AV797797;AV827304;AF367259 putative protein
10 1 1 4 RAFL09-13-C16 AY094405 Experimental RAFL09-13-C16 AV797701;AV827263;AY094405 unknown protein
10 1 1 5 RAFL09-13-G12 AV827284 Experimental RAFL09-13-G12 AV797741;AV827284;AF361831 unknown protein
10 1 1 6 RAFL09-13-O11 BP561710 Experimental RAFL09-13-O11 AV797816;BP561710 En/Spm-like transposon protein
10 1 1 7 RAFL09-13-B11 BP561703 Experimental RAFL09-13-B11 AV797686;BP561703;AF361825
10 1 1 8 RAFL09-13-D10 AV827266 Experimental RAFL09-13-D10 AV797710;AV827266;AF367279 unknown protein
10 1 1 9 RAFL09-13-L09 AV827300 Experimental RAFL09-13-L09 AV797782;AV827300;AF367272 nitrate reductase (At1g37130)
10 1 1 10 RAFL09-13-B09 AV827259 Experimental RAFL09-13-B09 AV797684;AV827259;AF367255 pyruvate kinase - like protein
10 1 1 11 RAFL09-13-K05 BP561708 Experimental RAFL09-13-K05 AV797776;BP561708;AF367294 RNA/ssDNA-binding protein - like
10 1 1 12 RAFL09-13-G05 AV827283 Experimental RAFL09-13-G05 AV797738;AV827283;AF367290 CBL-interacting protein kinase 3 (CIPK3)
10 1 1 13 RAFL09-13-B05 AV827258 Experimental RAFL09-13-B05 AV797680;AV827258;AF361821 myrosinase TGG2
10 1 1 14 RAFL09-13-I04 AY094401 Experimental RAFL09-13-I04 AV797757;AV827291;AY094401 pectinesterase like protein
10 1 2 1 RAFL09-17-C05 BT000711 Experimental RAFL09-17-C05 AV798678;BT000711 60S ribosomal protein - like
10 1 2 2 RAFL09-17-N04 BP561750 Experimental RAFL09-17-N04 AV798867;BP561750;AY035058 calmodulin-binding heat-shock protein -like
10 1 2 3 RAFL09-17-O03 AY039913 Experimental RAFL09-17-O03 AV798884;AV827650;AY039913 p48 protein
10 1 2 4 RAFL09-17-G03 AV827596 Experimental RAFL09-17-G03 AV798747;AV827596;AF360257 casein kinase I
10 1 2 5 RAFL09-17-L02 AV827631 Experimental RAFL09-17-L02 AV798826;AV827631;AF360210 unknown protein, 5' partial
10 1 2 6 RAFL09-17-H02 AV827601 Experimental RAFL09-17-H02 AV798759;AV827601;AF360127 putative protein
10 1 2 7 RAFL09-16-F23 AV827515 Experimental RAFL09-16-F23 AV798470;AV827515;AF360158 putative protein
10 1 2 8 RAFL09-16-J22 AY035055 Experimental RAFL09-16-J22 AV798538;AY035055 cysteine proteinase like protein
10 1 2 9 RAFL09-16-B22 AY045779 Experimental RAFL09-16-B22 AV798404;AV827492;AY045779 unknown protein
10 1 2 10 RAFL09-16-O21 AV827563 Experimental RAFL09-16-O21 AV798625;AV827563;AF360254 putative protein
10 1 2 11 RAFL09-16-H21 AV827526 Experimental RAFL09-16-H21 AV798505;AV827526;AF360206 phosphoinositide specific phospholipase C (AtPLC2)
10 1 2 12 RAFL09-16-C21 BP561736 Experimental RAFL09-16-C21 AV798416;BP561736;AF360124 ribulose bisphosphate carboxylase small chain 3b precursor (RuBisCO small subunit 3b) (sp|P10798)
10 1 2 13 RAFL09-13-P18 AV827318 Experimental RAFL09-13-P18 AV797833;AV827318;AF361833 putative protein
10 1 2 14 RAFL09-13-E18 AV827272 Experimental RAFL09-13-E18 AV797722;AV827272;AF361808
10 1 3 1 RAFL11-03-E20 AV832125 Experimental RAFL11-03-E20 AV832125 nodulin - like protein
10 1 3 2 RAFL11-03-C19 AV819253 Experimental RAFL11-03-C19 AV819253;AF370492 ATP sulfurylase, putative
10 1 3 3 RAFL09-17-O14 AV827653 Experimental RAFL09-17-O14 AV798891;AV827653;AF360321 putative protein
10 1 3 4 RAFL09-17-E14 AV827590 Experimental RAFL09-17-E14 AV798717;AV827590;AF370144 C3HC4 type Zinc RING finger like protein
10 1 3 5 RAFL09-17-P13 AY035042 Experimental RAFL09-17-P13 AV798907;AV827660;AY035042 male sterility 2-like protein (emb|CAA68191.1)
10 1 3 6 RAFL09-17-L13 AV827634 Experimental RAFL09-17-L13 AV798835;AV827634;AF360262 putative flavonol glucosyltransferase
10 1 3 7 RAFL09-17-D13 AV827583 Experimental RAFL09-17-D13 AV798698;AV827583;AF360218 nonphototropic hypocotyl 1 (NPH1)
10 1 3 8 RAFL09-17-I12 AV827613 Experimental RAFL09-17-I12 AV798783;AV827613;AF360133 putative phosphotyrosyl phosphatase activator protein
10 1 3 9 RAFL09-17-K09 AV827628 Experimental RAFL09-17-K09 AV798815;AV827628;AF360318 putative peptidyl-prolyl cis-trans isomerase
10 1 3 10 RAFL09-17-I09 AY035059 Experimental RAFL09-17-I09 AV798780;AV827611;AY035059 protease like protein
10 1 3 11 RAFL09-17-B09 AV827573 Experimental RAFL09-17-B09 AV798663;AV827573;AF360337 hypothetical protein
10 1 3 12 RAFL09-17-I08 AY035091 Experimental RAFL09-17-I08 AV798779;AV827610;AY035091 unknown protein
10 1 3 13 RAFL09-17-C08 AV827577 Experimental RAFL09-17-C08 AV798681;AV827577;AF360214 putative protein
10 1 3 14 RAFL09-17-N07 AV827646 Experimental RAFL09-17-N07 AV798869;AV827646;AF360130 unknown protein (At1g55680)
10 1 4 1 RAFL11-05-G05 AY054567 Experimental RAFL11-05-G05 AV819520;AV832184;AY054567 50S ribosomal protein L12-A
10 1 4 2 RAFL11-05-O04 AY054539 Experimental RAFL11-05-O04 AV819604;AV832199;AY054539 transcription factor EREBP like protein
10 1 4 3 RAFL11-05-A04 BP562642 Experimental RAFL11-05-A04 AV819454;BP562642;AF386927 unknown protein
10 1 4 4 RAFL11-05-M03 AV819583 Experimental RAFL11-05-M03 AV819583 reversibly glycosylated polypeptide-2 (AtRGP)
10 1 4 5 RAFL11-04-E16 AV832150 Experimental RAFL11-04-E16 AV819383;AV832150;AF370476 unknown protein
10 1 4 6 RAFL11-04-K15 AV832165 Experimental RAFL11-04-K15 AV819422;AV832165
10 1 4 7 RAFL11-04-A13 AV832143 Experimental RAFL11-04-A13 AV819355;AV832143 unknown protein
10 1 4 8 RAFL11-04-H11 BT002418 Experimental RAFL11-04-H11 AV819401;AV832157;BT002418
10 1 4 9 RAFL11-04-M09 AY059831 Experimental RAFL11-04-M09 AV819432;AV832171;AY059831 hypothetical protein
10 1 4 10 RAFL11-04-E09 AY059827 Experimental RAFL11-04-E09 AV819380;AY059827 acyl-(acyl carrier protein) thioesterase, putative
10 1 4 11 RAFL11-04-D03 AV832147 Experimental RAFL11-04-D03 AV819374;AV832147;AF370515
10 1 4 12 RAFL11-04-A02 AV832142 Experimental RAFL11-04-A02 AV819354;AV832142;AF386922 Putative 40S ribosomal protein S15A
10 1 4 13 RAFL11-04-F01 AY120739 Experimental RAFL11-04-F01 AV819387;AV832153;AY120739 unknown protein
10 1 4 14 RAFL11-03-L20 BP562640 Experimental RAFL11-03-L20 AV819323;BP562640 predicted GPI-anchored protein
10 1 5 1 RAFL11-12-L02 AV832357 Experimental RAFL11-12-L02 AV820861;AV832357
10 1 5 2 RAFL11-11-M23 AY093032 Experimental RAFL11-11-M23 AV820702;AV832330;AY093032 pEARLI 1-like protein
10 1 5 3 RAFL11-11-B22 AY093015 Experimental RAFL11-11-B22 AV820569;AV832310;AY093015 hypothetical protein
10 1 5 4 RAFL11-11-N21 AY093030 Experimental RAFL11-11-N21 AV820717;AV832332;AY093030 unknown protein
10 1 5 5 RAFL11-11-N20 BT002065 Experimental RAFL11-11-N20 AV820716;BT002065 hypothetical protein
10 1 5 6 RAFL11-11-G19 AV832317 Experimental RAFL11-11-G19 AV820621;AV832317 transport inhibitor response 1, putative
10 1 5 7 RAFL11-05-A21 AV832174 Experimental RAFL11-05-A21 AV819463;AV832174 beta-N-acetylhexosaminidase -like protein
10 1 5 8 RAFL11-05-H20 AY081287 Experimental RAFL11-05-H20 AV819537;AV832188;AY081287 eukaryotic protein synthesis initiation factor 4A
10 1 5 9 RAFL11-05-K19 AY054570 Experimental RAFL11-05-K19 AV819574;AV832191;AY054570 unknown protein
10 1 5 10 RAFL11-05-D19 AY062637 Experimental RAFL11-05-D19 AV819499;AY062637 putative replication factor C subunit
10 1 5 11 RAFL11-05-E17 AV832182 Experimental RAFL11-05-E17 AV819507;AV832182;AF370482 actin depolymerizing factor 2 (ADF2)
10 1 5 12 RAFL11-05-P16 BT001986 Experimental RAFL11-05-P16 AV819617;BT001986 putative protein
10 1 5 13 RAFL11-05-M07 AY120743 Experimental RAFL11-05-M07 AV819584;AV832192;AY120743 putative protein
10 1 5 14 RAFL11-05-F06 AV832183 Experimental RAFL11-05-F06 AV819510;AV832183
10 1 6 2 RAFL11-13-C20 AY093019 Experimental RAFL11-13-C20 AV820944;AV832368;AY093019 putative protein
10 1 6 3 RAFL11-13-K08 AV821032 Experimental RAFL11-13-K08 AV821032 unknown protein
10 1 6 4 RAFL11-13-A04 AY136320 Experimental RAFL11-13-A04 AV820915;AY136320 60S ribosomal protein - like
10 1 6 5 RAFL11-13-M02 BP562671 Experimental RAFL11-13-M02 AV821049;BP562671
10 1 6 6 RAFL11-13-I02 AV832375 Experimental RAFL11-13-I02 AV821005;AV832375 calmodulin (cam2)
10 1 6 7 RAFL11-13-G01 AV832370 Experimental RAFL11-13-G01 AV820976;AV832370 unknown protein
10 1 6 8 RAFL11-12-O22 BT002067 Experimental RAFL11-12-O22 AV820900;AV832364;BT002067 putative CONSTANS-like B-box zinc finger protein
10 1 6 9 RAFL11-12-M17 AY136319 Experimental RAFL11-12-M17 AV820876;AV832361;AY136319 ribosomal protein, putative
10 1 6 10 RAFL11-12-B15 AY139976 Experimental RAFL11-12-B15 AV820758;AV832340;AY139976 unknown protein
10 1 6 11 RAFL11-12-L14 AY136293 Experimental RAFL11-12-L14 AV820867;AV832359;AY136293 unknown protein
10 1 6 12 RAFL11-12-D13 AY139975 Experimental RAFL11-12-D13 AV820779;AV832345;AY139975 Unknown protein (YUP8H12.25)
10 1 6 13 RAFL11-12-P10 BP562670 Experimental RAFL11-12-P10 AV820904;BP562670 ribosomal protein L35a-like
10 1 6 14 RAFL11-12-G10 AY136318 Experimental RAFL11-12-G10 AV820812;AV832350;AY136318 putative WRKY-type DNA binding protein
10 2 1 1 RAFL09-11-A18 AY045631 Experimental RAFL09-11-A18 AV797170;AV827077;AY045631 unknown protein
10 2 1 2 RAFL09-11-M17 AY065032 Experimental RAFL09-11-M17 AV797356;AV827144;AY065032 DNA photolyase - like protein
10 2 1 3 RAFL09-11-E17 AV827099 Experimental RAFL09-11-E17 AV797234;AV827099;AF361579 nifU-like protein
10 2 1 4 RAFL09-11-B17 AY126994 Experimental RAFL09-11-B17 AV797184;AY126994 hypothetical protein, 5' partial
10 2 1 5 RAFL09-11-F13 AV827103 Experimental RAFL09-11-F13 AV797247;AV827103;AF361608 lipase, putative
10 2 1 6 RAFL09-11-C13 AV827087 Experimental RAFL09-11-C13 AV797198;AV827087;AF367350 unknown protein
10 2 1 7 RAFL09-11-N12 AY045627 Experimental RAFL09-11-N12 AV797370;AV827150;AY045627 putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase
10 2 1 8 RAFL09-11-I12 AY125495 Experimental RAFL09-11-I12 AV797291;AV827119;AY125495 endoxyloglucan transferase (gb|AAD45127.1)
10 2 1 9 RAFL09-11-P11 AV827159 Experimental RAFL09-11-P11 AV797397;AV827159;AF361585 beta tubulin 1, putative
10 2 1 10 RAFL09-11-C11 AV827086 Experimental RAFL09-11-C11 AV797197;AV827086;AF361575 unknown protein
10 2 1 11 RAFL09-11-N08 AY065039 Experimental RAFL09-11-N08 AV797367;AV827148;AY065039 mucin -like protein
10 2 1 12 RAFL09-11-F08 AV827101 Experimental RAFL09-11-F08 AV797243;AV827101;AF367349
10 2 1 13 RAFL09-11-P07 AV827157 Experimental RAFL09-11-P07 AV797394;AV827157;AF361597 receptor like protein kinase
10 2 1 14 RAFL09-11-J07 AY065034 Experimental RAFL09-11-J07 AV797304;AV827124;AY065034 unknown protein
10 2 2 1 RAFL09-15-C08 AV827412 Experimental RAFL09-15-C08 AV798146;AV827412;AF370204 putative protein
10 2 2 2 RAFL09-15-L07 AY035057 Experimental RAFL09-15-L07 AV798291;AV827461;AY035057 uroporphyrinogen decarboxylase like protein
10 2 2 3 RAFL09-15-G07 AV827433 Experimental RAFL09-15-G07 AV798215;AV827433 ubiquitin extension protein (UBQ5)
10 2 2 4 RAFL09-15-C07 AV798145 Experimental RAFL09-15-C07 AV798145;AF360256 uridylyl transferases-like
10 2 2 5 RAFL09-15-P06 AV827475 Experimental RAFL09-15-P06 AV798359;AV827475;AF360209 unknown protein
10 2 2 6 RAFL09-15-K06 AV827453 Experimental RAFL09-15-K06 AV798273;AV827453;AF360126 malate synthase -like protein
10 2 2 7 RAFL09-15-I02 AV827442 Experimental RAFL09-15-I02 AV798244;AV827442;AF360157 ABA-regulated gene (ATEM6)
10 2 2 8 RAFL09-15-N01 AY035054 Experimental RAFL09-15-N01 AV798323;AV827470;AY035054 unknown protein
10 2 2 9 RAFL09-15-H01 AV827438 Experimental RAFL09-15-H01 AV798228;AV827438;AF360335 unknown protein
10 2 2 10 RAFL09-15-E01 BT000790 Experimental RAFL09-15-E01 AV798174;AV827419;BT000790 unknown protein
10 2 2 11 RAFL09-15-A01 AV827400 Experimental RAFL09-15-A01 AV798111;AV827400;AF360205 unknown protein
10 2 2 12 RAFL09-14-N22 AV827390 Experimental RAFL09-14-N22 AV798076;AV827390;AF360123 putative protein
10 2 2 13 RAFL09-11-B19 AV827082 Experimental RAFL09-11-B19 AV797186;AV827082;AF367357 putative protein
10 2 2 14 RAFL09-11-L18 AV827139 Experimental RAFL09-11-L18 AV797343;AV827139;AF367354 methionyl-tRNA synthetase (AtcpMetRS)
10 2 3 1 RAFL09-18-J09 AV827716 Experimental RAFL09-18-J09 AV799075;AV827716;AF370496 unknown protein
10 2 3 2 RAFL09-18-O08 AY054525 Experimental RAFL09-18-O08 AV799153;AV827738;AY054525 ABC transporter - like protein
10 2 3 3 RAFL09-15-M18 AY035071 Experimental RAFL09-15-M18 AV798317;AV827467;AY035071 UDP-glucose pyrophosphorylase like protein
10 2 3 4 RAFL09-15-F18 AV827429 Experimental RAFL09-15-F18 AV798203;AV827429;AF360304 elongation factor 1B alpha-subunit
10 2 3 5 RAFL09-15-A18 BT000675 Experimental RAFL09-15-A18 AV798123;AV827406;BT000675 unknown protein
10 2 3 6 RAFL09-15-L17 AV798300 Experimental RAFL09-15-L17 AV798300;AF360261 unknown protein
10 2 3 7 RAFL09-15-E17 AV798185 Experimental RAFL09-15-E17 AV798185;AF360217
10 2 3 8 RAFL09-15-N16 AV798334 Experimental RAFL09-15-N16 AV798334;AF360132 putative protein
10 2 3 9 RAFL09-15-A15 AV798120 Experimental RAFL09-15-A15 AV798120;AF360317 caffeoyl-CoA O-methyltransferase like protein
10 2 3 10 RAFL09-15-O14 BP561734 Experimental RAFL09-15-O14 AV798349;BP561734;AF360302 actin depolymerizing factor 5 (ADF5)
10 2 3 11 RAFL09-15-P13 AY035041 Experimental RAFL09-15-P13 AV798363;AV827477;AY035041 putative RNA-binding domain
10 2 3 12 RAFL09-15-N12 AV798331 Experimental RAFL09-15-N12 AV798331;AF370131 senescence-specific cysteine protease
10 2 3 13 RAFL09-15-I12 AV827446 Experimental RAFL09-15-I12 AV798251;AV827446;AF360213 putative 3-methyladenine DNA glycosylase
10 2 3 14 RAFL09-15-B12 AV827409 Experimental RAFL09-15-B12 AV798134;AV827409;AF360129 unknown protein
10 2 4 1 RAFL11-01-A06 AY054561 Experimental RAFL11-01-A06 AV818849;AV832019;AY054561 Unknown protein (At3g29180; MUO22.2)
10 2 4 2 RAFL11-01-M05 AV818995 Experimental RAFL11-01-M05 AV818995 putative protein
10 2 4 3 RAFL11-01-B05 AY054559 Experimental RAFL11-01-B05 AV818862;AV832025;AY054559 unknown protein
10 2 4 4 RAFL11-01-B04 AY059825 Experimental RAFL11-01-B04 AV818861;AV832024;AY059825 putative endo-1,4-beta-glucanase
10 2 4 5 RAFL09-18-N20 BP561757 Experimental RAFL09-18-N20 AV799148;BP561757;AY054532 ethylene response sensor (ERS)
10 2 4 6 RAFL09-18-I20 AY059829 Experimental RAFL09-18-I20 AV799066;AV827713;AY059829 C-terminal binding protein (ANGUSTIFOLIA)
10 2 4 7 RAFL09-18-M19 AV827732 Experimental RAFL09-18-M19 AV799126;AV827732 unknown protein
10 2 4 8 RAFL09-18-O18 AY042818 Experimental RAFL09-18-O18 AV799162;AV827743;AY042818 unknown protein
10 2 4 9 RAFL09-18-I18 AY042816 Experimental RAFL09-18-I18 AV799065;AV827712;AY042816 Cdk-activating kinase 1At (cak1At)
10 2 4 10 RAFL09-18-I17 AY042815 Experimental RAFL09-18-I17 AV799064;AV827711;AY042815 RNA helicase like protein
10 2 4 11 RAFL09-18-L12 AY054555 Experimental RAFL09-18-L12 AV799108;AV827722;AY054555 similar to eyes absent protein
10 2 4 12 RAFL09-18-O11 BT002385 Experimental RAFL09-18-O11 AV799156;AV827739;BT002385 putative protein
10 2 4 13 RAFL09-18-P10 AV827745 Experimental RAFL09-18-P10 AV799171;AV827745
10 2 4 14 RAFL09-18-H10 AV827704 Experimental RAFL09-18-H10 AV799043;AV827704;AF370503 Glucose-1-phosphate adenylyltransferase (ApL1/adg2)
10 2 5 7 RAFL11-01-E14 AY120728 Experimental RAFL11-01-E14 AV818905;AV832038;AY120728
10 2 5 8 RAFL11-01-G13 AY042807 Experimental RAFL11-01-G13 AV818929;AV832046;AY042807 unknown protein
10 2 5 9 RAFL11-01-B13 BP562631 Experimental RAFL11-01-B13 AV818865;BP562631;AY042806 MutT domain protein-like
10 2 5 10 RAFL11-01-M12 AV832058 Experimental RAFL11-01-M12 AV819002;AV832058 disease resistance protein-like
10 2 5 11 RAFL11-01-G12 AY054563 Experimental RAFL11-01-G12 AV818928;AV832045;AY054563 unknown protein
10 2 5 12 RAFL11-01-F11 AY054536 Experimental RAFL11-01-F11 AV818917;AV832042;AY054536 putative protein
10 2 5 13 RAFL11-01-E06 BT000426 Experimental RAFL11-01-E06 AV818901;BP562632;BT000426 putative protein
10 2 5 14 RAFL11-01-C06 AY128363 Experimental RAFL11-01-C06 AV818870;AV832027;AY128363
10 2 7 11 RAFL11-09-L02 BT002071 Experimental RAFL11-09-L02 AV820330;BT002071 splicing factor, putative
10 2 7 12 RAFL11-09-N01 AY093041 Experimental RAFL11-09-N01 AV820352;AY093041 unknown protein
10 2 7 13 RAFL11-09-G01 AV820274 Experimental RAFL11-09-G01 AV820274 putative myrosinase-binding protein
10 3 1 1 RAFL09-13-N14 AV827308 Experimental RAFL09-13-N14 AV797807;AV827308;AF361827 unknown protein
10 3 1 2 RAFL09-13-P13 BP561712 Experimental RAFL09-13-P13 AV797830;BP561712;AY094404
10 3 1 3 RAFL09-13-F13 BP561705 Experimental RAFL09-13-F13 AV797731;BP561705;AF367267 putative B' regulatory subunit of protein phosphatase 2A
10 3 1 4 RAFL09-13-A13 AV827256 Experimental RAFL09-13-A13 AV797673;AV827256;AF361801 GDP dissociation inhibitor
10 3 1 5 RAFL09-13-G08 BP561707 Experimental RAFL09-13-G08 AV797739;BP561707;AF367291 unknown protein
10 3 1 6 RAFL09-13-P07 AV827314 Experimental RAFL09-13-P07 AV797826;AV827314;AF367289 caffeic acid O-methyltransferase - like protein
10 3 1 7 RAFL09-13-B07 BP561701 Experimental RAFL09-13-B07 AV797682;BP561701;AY125494 hypothetical protein
10 3 1 8 RAFL09-13-J06 AY065065 Experimental RAFL09-13-J06 AV797766;AV827296;AY065065 cytochrome P450
10 3 1 9 RAFL09-13-H06 AV827288 Experimental RAFL09-13-H06 AV797748;AV827288;AF367265 putative protein
10 3 1 10 RAFL09-13-C06 AV827261 Experimental RAFL09-13-C06 AV797695;AV827261;AF361805 putative protein
10 3 1 11 RAFL09-13-N02 AY094400 Experimental RAFL09-13-N02 AV797802;AV827307;AY094400
10 3 1 12 RAFL09-13-M01 AV827302 Experimental RAFL09-13-M01 AV797788;AV827302;AF361814 unknown protein (At1g09870)
10 3 1 13 RAFL09-13-G01 AV827282 Experimental RAFL09-13-G01 AV797736;AV827282;AF361826 unknown protein
10 3 1 14 RAFL09-13-E01 AV827269 Experimental RAFL09-13-E01 AV797714;AV827269;AF367281 amino acid permease
10 3 2 1 RAFL09-17-C02 AV798675 Experimental RAFL09-17-C02 AV798675;AF360160 unknown
10 3 2 2 RAFL09-17-I01 AY039918 Experimental RAFL09-17-I01 AV798775;AV827608;AY039918 unknown protein
10 3 2 3 RAFL09-17-C01 AV798674 Experimental RAFL09-17-C01 AV798674;AF360336
10 3 2 4 RAFL09-16-J24 AV798540 Experimental RAFL09-16-J24 AV798540;AF360255 unknown protein
10 3 2 5 RAFL09-16-F24 BP561737 Experimental RAFL09-16-F24 AV798471;BP561737;AF360208 IPP transferase - like protein
10 3 2 6 RAFL09-16-K23 AV798558 Experimental RAFL09-16-K23 AV798558;AF360125 putative signal recognition particle receptor (alpha subunit)
10 3 2 7 RAFL09-16-O20 AV827562 Experimental RAFL09-16-O20 AV798624;AV827562;AF370203 19S proteosome subunit 9 like protein
10 3 2 8 RAFL09-16-J20 AY035053 Experimental RAFL09-16-J20 AV798536;AV827536;AY035053 receptor protein kinase like protein
10 3 2 9 RAFL09-16-E20 AV827508 Experimental RAFL09-16-E20 AV798448;AV827508;AF360294 homeobox protein (GLABRA2)
10 3 2 10 RAFL09-16-A20 AV798386 Experimental RAFL09-16-A20 AV798386 phytoene dehydrogenase precursor (phytoene desaturase)
10 3 2 11 RAFL09-16-C18 AV827499 Experimental RAFL09-16-C18 AV798414;AV827499;AF360204 unknown protein
10 3 2 12 RAFL09-16-P17 AY035074 Experimental RAFL09-16-P17 AV798635;AV827567;AY035074 polygalacturonase like protein
10 3 2 13 RAFL09-13-G15 AV827285 Experimental RAFL09-13-G15 AV797743;AV827285;AF361835 GTP cyclohydrolase II / 3,4-dihydroxy-2-butanone-4-phoshate synthase - like protein
10 3 2 14 RAFL09-13-C15 AV827262 Experimental RAFL09-13-C15 AV797700;AV827262;AF361811
10 3 3 1 RAFL11-03-C13 AV832119 Experimental RAFL11-03-C13 AV819251;AV832119;AF370512 cytochrome P450-like protein (At1g16400)
10 3 3 2 RAFL11-03-N11 BT000424 Experimental RAFL11-03-N11 AV819337;AV832140;BT000424 small Ras-like GTP-binding protein
10 3 3 3 RAFL09-17-G12 AV827597 Experimental RAFL09-17-G12 AV798751;AV827597;AF360320 ferredoxin--nitrite reductase
10 3 3 4 RAFL09-17-A12 AY035060 Experimental RAFL09-17-A12 AV798649;AY035060 unknown protein
10 3 3 5 RAFL09-17-I11 AV798782 Experimental RAFL09-17-I11 AV798782;AF370139 cyclic nucleotide-regulated ion channel (emb|CAA76178.1)
10 3 3 6 RAFL09-17-B11 AV798665 Experimental RAFL09-17-B11 AV798665;AF370132 putative protein
10 3 3 7 RAFL09-17-J10 AV827622 Experimental RAFL09-17-J10 AV798799;AV827622;AF360216 putative 26S proteasome regulatory subunit S2
10 3 3 8 RAFL09-17-H10 AV827603 Experimental RAFL09-17-H10 AV798764;AV827603;AF360131 unknown protein
10 3 3 9 RAFL09-17-F07 AV827593 Experimental RAFL09-17-F07 AV798730;AV827593;AF360316 tonneau 2 (TON2)
10 3 3 10 RAFL09-17-D07 BP561742 Experimental RAFL09-17-D07 AV798695;BP561742;AF360301 unknown protein
10 3 3 11 RAFL09-17-O06 AY035040 Experimental RAFL09-17-O06 AV798886;AV827651;AY035040 putative NADH-ubiquinone oxireductase
10 3 3 12 RAFL09-17-I06 AV827609 Experimental RAFL09-17-I06 AV798777;AV827609;AF360259 similar to axi 1 protein from Nicotiana tabacum
10 3 3 13 RAFL09-17-N05 AV827645 Experimental RAFL09-17-N05 AV798868;AV827645;AF360212 unknown protein
10 3 3 14 RAFL09-17-J05 AY045775 Experimental RAFL09-17-J05 AV798794;AV827620;AY045775 receptor like protein kinase
10 3 4 1 RAFL11-04-I23 AY120742 Experimental RAFL11-04-I23 AV819409;AV832160;AY120742 putative phosphatidylinositol-4-phosphate 5-kinase
10 3 4 2 RAFL11-04-D23 BT000475 Experimental RAFL11-04-D23 AV819377;AV832148;BT000475
10 3 4 3 RAFL11-04-I22 AY054566 Experimental RAFL11-04-I22 AV819408;AV832159;AY054566 putative trypsin inhibitor (At1g73260)
10 3 4 4 RAFL11-04-E20 AY065100 Experimental RAFL11-04-E20 AV819385;AV832151;AY065100 anther development protein, ATA20
10 3 4 5 RAFL11-04-B08 AY120741 Experimental RAFL11-04-B08 AV819363;AV832145;AY120741 isoflavone reductase - like protein
10 3 4 6 RAFL11-04-C07 BP562641 Experimental RAFL11-04-C07 AV819368;BP562641;AY059834 pectinesterase - like protein
10 3 4 7 RAFL11-04-L06 AY128365 Experimental RAFL11-04-L06 AV819426;AV832167;AY128365 putative WD-40 repeat protein
10 3 4 8 RAFL11-04-B05 AY042813 Experimental RAFL11-04-B05 AV819362;AV832144;AY042813 unknown protein
10 3 4 9 RAFL11-04-J04 AY081286 Experimental RAFL11-04-J04 AV819411;AY081286
10 3 4 10 RAFL11-04-H04 AY042803 Experimental RAFL11-04-H04 AV819400;AV832156;AY042803 60S ribosomal protein L18A
10 3 4 11 RAFL11-03-I17 AV832129 Experimental RAFL11-03-I17 AV819296;AV832129;AF370474 chlorophyll a/b-binding protein CP29
10 3 4 12 RAFL11-03-A17 AV832115 Experimental RAFL11-03-A17 AV819233;AV832115;AF370489 putative tRNA adenylyltransferase
10 3 4 13 RAFL11-03-L16 AY054540 Experimental RAFL11-03-L16 AV819321;AV832137;AY054540 oleosin isoform
10 3 4 14 RAFL11-03-A15 AV819232 Experimental RAFL11-03-A15 AV819232 unknown protein
10 3 5 1 RAFL11-11-P16 AY072352 Experimental RAFL11-11-P16 AV820734;AV832335;AY072352 blue copper-binding protein, 15K (lamin)
10 3 5 2 RAFL11-11-H16 AV832321 Experimental RAFL11-11-H16 AV820632;AV832321 cytochrome P450-like protein
10 3 5 3 RAFL11-11-I15 AV832322 Experimental RAFL11-11-I15 AV820645;AV832322 putative protein
10 3 5 4 RAFL11-11-P13 BP562666 Experimental RAFL11-11-P13 AV820733;BP562666;AY093034 ferrodoxin precursor
10 3 5 5 RAFL11-11-N12 AV820709 Experimental RAFL11-11-N12 AV820709
10 3 5 6 RAFL11-11-F12 AY136315 Experimental RAFL11-11-F12 AV820607;AV832315;AY136315 unknown protein
10 3 5 7 RAFL11-05-H15 BT001984 Experimental RAFL11-05-H15 AV819535;AV832187;BT001984 unknown protein
10 3 5 8 RAFL11-05-E14 AV832181 Experimental RAFL11-05-E14 AV819505;AV832181 putative pectinacetylesterase
10 3 5 9 RAFL11-05-F10 BP562645 Experimental RAFL11-05-F10 AV819512;BP562645 Similar to auxin-independent growth promoter (axi 1)
10 3 5 10 RAFL11-05-O09 BT001982 Experimental RAFL11-05-O09 AV819607;BT001982 unknown protein
10 3 5 11 RAFL11-05-B09 AV832176 Experimental RAFL11-05-B09 AV819468;AV832176 UTP-glucose glucosyltransferase - like protein
10 3 5 12 RAFL11-05-O08 AY081284 Experimental RAFL11-05-O08 AV819606;AV832200;AY081284 putative protein
10 3 5 13 RAFL11-05-E03 BT000425 Experimental RAFL11-05-E03 AV819503;AV832179;BT000425 Lil3 protein
10 3 5 14 RAFL11-04-F24 AV832154 Experimental RAFL11-04-F24 AV819393;AV832154;AF370466 unknown protein
10 3 6 1 RAFL11-13-L10 BT002449 Experimental RAFL11-13-L10 AV821043;BT002449 unknown protein
10 3 6 2 RAFL11-13-G09 AY093039 Experimental RAFL11-13-G09 AV820979;AV832372;AY093039 unknown protein
10 3 6 3 RAFL11-12-A22 AV832336 Experimental RAFL11-12-A22 AV820746;AV832336 hypothetical protein
10 3 6 4 RAFL11-12-B21 BP562668 Experimental RAFL11-12-B21 AV820761;BP562668 putative protein
10 3 6 5 RAFL11-12-P19 AV820910 Experimental RAFL11-12-P19 AV820910 hypothetical protein
10 3 6 6 RAFL11-12-B19 AV832341 Experimental RAFL11-12-B19 AV820760;AV832341 PROLIFERA
10 3 6 7 RAFL11-12-O18 AY139977 Experimental RAFL11-12-O18 AV820897;AV832362;AY139977 putative protein
10 3 6 8 RAFL11-12-E18 AY136295 Experimental RAFL11-12-E18 AV820793;AV832346;AY136295 bZIP DNA-binding protein AtbZip17
10 3 6 9 RAFL11-12-P09 AY136290 Experimental RAFL11-12-P09 AV820903;AY136290 ribosomal protein L17 -like protein
10 3 6 10 RAFL11-12-G09 AV832349 Experimental RAFL11-12-G09 AV820811;AV832349 pectinesterase like protein
10 3 6 11 RAFL11-12-D09 AY136316 Experimental RAFL11-12-D09 AV820776;AV832344;AY136316 cysteine proteinase like protein
10 3 6 12 RAFL11-12-G05 AY093033 Experimental RAFL11-12-G05 AV820807;AV832348;AY093033 unknown protein
10 3 6 13 RAFL11-12-L04 AV832358 Experimental RAFL11-12-L04 AV820862;AV832358
10 3 6 14 RAFL11-12-G04 AY136289 Experimental RAFL11-12-G04 AV820806;AY136289 mitochondrial F1-ATPase, gamma subunit (ATP3_ARATH)
10 3 7 11 RAFL11-13-N18 AY093040 Experimental RAFL11-13-N18 AV821064;AV832379;AY093040 glycine rich protein - like
10 3 7 12 RAFL11-13-M15 BT002068 Experimental RAFL11-13-M15 AV821053;BT002068 40S ribosomal protein S17
10 3 7 13 RAFL11-13-H13 AV820998 Experimental RAFL11-13-H13 AV820998 unknown protein
10 3 7 14 RAFL11-13-F11 AY072354 Experimental RAFL11-13-F11 AV820969;AV832369;AY072354 unknown protein
10 4 1 1 RAFL09-11-D15 AV827094 Experimental RAFL09-11-D15 AV797215;AV827094;AF361596
10 4 1 2 RAFL09-11-M14 AV827142 Experimental RAFL09-11-M14 AV797354;AV827142;AF367337 unknown protein
10 4 1 3 RAFL09-11-G14 AV827107 Experimental RAFL09-11-G14 AV797257;AV827107;AF361587 transporter like protein
10 4 1 4 RAFL09-11-B14 AV827080 Experimental RAFL09-11-B14 AV797182;AV827080;AF367331 elongation factor, putative
10 4 1 5 RAFL09-11-N10 AV827149 Experimental RAFL09-11-N10 AV797369;AV827149;AF361609 unknown protein
10 4 1 6 RAFL09-11-K10 AV827133 Experimental RAFL09-11-K10 AV797321;AV827133;AF367351 unknown protein
10 4 1 7 RAFL09-11-E10 AV827098 Experimental RAFL09-11-E10 AV797229;AV827098;AF367343 putative translation initiation factor IF2
10 4 1 8 RAFL09-11-J09 AV827125 Experimental RAFL09-11-J09 AV797305;AV827125;AF367336 unknown protein
10 4 1 9 RAFL09-11-F09 AV827102 Experimental RAFL09-11-F09 AV797244;AV827102;AF361583 unknown protein
10 4 1 10 RAFL09-11-B09 AV827079 Experimental RAFL09-11-B09 AV797178;AV827079;AF361576 unknown protein
10 4 1 11 RAFL09-11-H05 AV827109 Experimental RAFL09-11-H05 AV797266;AV827109;AF361606 unknown protein
10 4 1 12 RAFL09-11-C05 AY094389 Experimental RAFL09-11-C05 AV797191;AV827083;AY094389 putative protein
10 4 1 13 RAFL09-11-D04 AY045628 Experimental RAFL09-11-D04 AV797209;AV827092;AY045628 unknown protein
10 4 1 14 RAFL09-11-K03 AV827130 Experimental RAFL09-11-K03 AV797316;AV827130 starch branching enzyme class II (sbe2-1)
10 4 2 1 RAFL09-15-A06 AV827402 Experimental RAFL09-15-A06 AV798114;AV827402;AF360159 ubiquitin-like protein
10 4 2 2 RAFL09-15-O05 AY035056 Experimental RAFL09-15-O05 AV798341;AY035056 oxidase like protein
10 4 2 3 RAFL09-15-L05 AY035038 Experimental RAFL09-15-L05 AV798289;AV827460;AY035038 unknown protein
10 4 2 4 RAFL09-15-A05 AY035090 Experimental RAFL09-15-A05 AV798113;AV827401;AY035090 serine protease like protein
10 4 2 5 RAFL09-15-I04 AV827443 Experimental RAFL09-15-I04 AV798246;AV827443;AF360207 pyrophosphate-dependent phosphofructo-1-kinase-like protein
10 4 2 6 RAFL09-15-J03 AV798257 Experimental RAFL09-15-J03 AV798257 unknown protein
10 4 2 7 RAFL09-14-O21 AV827396 Experimental RAFL09-14-O21 AV798092;AV827396;AF360156 unknown protein
10 4 2 8 RAFL09-14-O16 AY035052 Experimental RAFL09-14-O16 AV798088;AV827395;AY035052 putative serine carboxypeptidase I
10 4 2 9 RAFL09-14-P14 BP561726 Experimental RAFL09-14-P14 AV798103;BP561726;AY039912 putative protein
10 4 2 10 RAFL09-14-O11 BP561725 Experimental RAFL09-14-O11 AV798084;BP561725 ribosomal protein L35 - like
10 4 2 11 RAFL09-14-N09 AY035084 Experimental RAFL09-14-N09 AV798065;AV827388;AY035084 unknown protein
10 4 2 12 RAFL09-14-O03 AY035073 Experimental RAFL09-14-O03 AV798078;AV827392;AY035073 abscisic acid insensitive protein (ABI1)
10 4 2 13 RAFL09-11-M16 AV827143 Experimental RAFL09-11-M16 AV797355;AV827143;AF361603 unknown protein
10 4 2 14 RAFL09-11-C16 AV827088 Experimental RAFL09-11-C16 AV797201;AV827088;AF367348 putative protein
10 4 3 1 RAFL09-18-M02 AY042808 Experimental RAFL09-18-M02 AV799116;AV827727;AY042808 protein kinase, putative
10 4 3 2 RAFL09-18-I01 AY092971 Experimental RAFL09-18-I01 AV799056;AV827707;AY092971 NADH dehydrogenase
10 4 3 3 RAFL09-15-K16 AV827457 Experimental RAFL09-15-K16 AV798280;AV827457;AF360319 multiubiquitin chain binding protein (MBP1)
10 4 3 4 RAFL09-15-E16 AV827421 Experimental RAFL09-15-E16 AV798184;AV827421;AF360303 putative protein
10 4 3 5 RAFL09-15-A16 AV827405 Experimental RAFL09-15-A16 AV798121;AV827405 AX110P like protein
10 4 3 6 RAFL09-15-L15 AV827462 Experimental RAFL09-15-L15 AV798298;AV827462;AF360260 tubulin beta-6 chain (sp|P29514)
10 4 3 7 RAFL09-15-I15 AV827447 Experimental RAFL09-15-I15 AV798252;AV827447;AF360215 pyruvate dehydrogenase E1 alpha subunit
10 4 3 8 RAFL09-15-F15 AY035075 Experimental RAFL09-15-F15 AV798200;AV827427;AY035075 H+-transporting ATPase type 2, plasma membrane
10 4 3 9 RAFL09-15-D11 AV827416 Experimental RAFL09-15-D11 AV798166;AV827416;AF360161 unknown protein
10 4 3 10 RAFL09-15-A10 AV827404 Experimental RAFL09-15-A10 AV798117;AV827404;AF360300 putative diacylglycerol kinase
10 4 3 11 RAFL09-15-G09 AY035039 Experimental RAFL09-15-G09 AV798216;AV827434;AY035039 unknown protein
10 4 3 12 RAFL09-15-D09 AV798164 Experimental RAFL09-15-D09 AV798164;AF360258 translocase like protein
10 4 3 13 RAFL09-15-J08 AV827449 Experimental RAFL09-15-J08 AV798261;AV827449;AF360211 putative histone H1 protein
10 4 3 14 RAFL09-15-H08 AV827439 Experimental RAFL09-15-H08 AV798231;AV827439;AF360128 unknown protein
10 4 4 1 RAFL11-01-A01 AV832018 Experimental RAFL11-01-A01 AV818847;AV832018 ferredoxin-NADP+ reductase like protein
10 4 4 2 RAFL09-18-K24 AY054534 Experimental RAFL09-18-K24 AV799100;AV827720;AY054534 putative cytochrome P450
10 4 4 3 RAFL09-18-L23 AV827726 Experimental RAFL09-18-L23 AV799115;AV827726;AF370506 putative WD-40 repeat protein
10 4 4 4 RAFL09-18-M22 AY120737 Experimental RAFL09-18-M22 AV799128;AV827733;AY120737 MAP kinase (ATMPK6)
10 4 4 5 RAFL09-18-O15 AV827741 Experimental RAFL09-18-O15 AV799159;AV827741;AF370469 putative ribosomal protein S4
10 4 4 6 RAFL09-18-K15 AV827718 Experimental RAFL09-18-K15 AV799093;AV827718;AF370490 putative T-complex protein 1, theta subunit (TCP-1-Theta)
10 4 4 7 RAFL09-18-H15 BP561755 Experimental RAFL09-18-H15 AV799048;BP561755 unknown protein
10 4 4 8 RAFL09-18-N14 AY054528 Experimental RAFL09-18-N14 AV799142;AV827736;AY054528 putative protein
10 4 4 9 RAFL09-18-O13 AV827740 Experimental RAFL09-18-O13 AV799158;AV827740;AF370517 Putative Poly-A Binding Protein (F14J22.3)
10 4 4 10 RAFL09-18-P12 AY054527 Experimental RAFL09-18-P12 AV799173;AV827747;AY054527 unknown protein
10 4 4 11 RAFL09-18-J08 AY054524 Experimental RAFL09-18-J08 AV799074;AV827715;AY054524 ADP-ribosylation factor-like protein
10 4 4 12 RAFL09-18-O06 AY054565 Experimental RAFL09-18-O06 AV799151;AV827737;AY054565 Unknown protein
10 4 4 13 RAFL09-18-M05 AY054535 Experimental RAFL09-18-M05 AV799117;AV827728;AY054535 WD-repeat protein-like
10 4 4 14 RAFL09-18-I05 AV827708 Experimental RAFL09-18-I05 AV799057;AV827708 putative protein
10 4 5 7 RAFL11-01-P10 AV819031 Experimental RAFL11-01-P10 AV819031 unknown protein
10 4 5 8 RAFL11-01-K10 AY081285 Experimental RAFL11-01-K10 AV818977;AY081285 unknown protein
10 4 5 9 RAFL11-01-C09 AV832028 Experimental RAFL11-01-C09 AV818872;AV832028 porin-like protein
10 4 5 10 RAFL11-01-N08 BT002003 Experimental RAFL11-01-N08 AV819014;AV832062;BT002003 putative protein
10 4 5 11 RAFL11-01-N07 AV832061 Experimental RAFL11-01-N07 AV819013;AV832061;AF370487 nucleosome assembly protein
10 4 5 12 RAFL11-01-F07 AY059826 Experimental RAFL11-01-F07 AV818913;AV832041;AY059826 putative UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide)-pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
10 4 5 13 RAFL11-01-B02 AY128375 Experimental RAFL11-01-B02 AV818860;AV832023;AY128375 putative calmodulin-like protein
10 4 5 14 RAFL11-01-D01 AV832031 Experimental RAFL11-01-D01 AV818882;AV832031;AF370485 eukaryotic translation initiation factor 3 delta subunit
11 1 1 1 RAFL09-12-E16 AV827189 Experimental RAFL09-12-E16 AV797482;AV827189;AF361630 zinc finger protein ZFP4
11 1 1 2 RAFL09-12-A16 BP561689 Experimental RAFL09-12-A16 AV797416;BP561689
11 1 1 3 RAFL09-12-O15 AV827247 Experimental RAFL09-12-O15 AV797643;AV827247;AF361626 unknown protein
11 1 1 4 RAFL09-12-G15 AV827205 Experimental RAFL09-12-G15 AV797513;AV827205;AF367301 tubulin alpha-5 chain-like protein
11 1 1 5 RAFL09-12-G12 AY048202 Experimental RAFL09-12-G12 AV797510;AV827203;AY048202 unknown protein
11 1 1 6 RAFL09-12-B12 AV827171 Experimental RAFL09-12-B12 AV797429;AV827171;AF361610 putative ribosomal protein L8
11 1 1 7 RAFL09-12-E11 BP561690 Experimental RAFL09-12-E11 AV797478;BP561690;AY037185 unknown protein
11 1 1 8 RAFL09-12-A11 AV827161 Experimental RAFL09-12-A11 AV797412;AV827161;AF361637 putative protein
11 1 1 9 RAFL09-12-G10 AV827202 Experimental RAFL09-12-G10 AV797509;AV827202;AF361618 Ribosomal protein L7Ae -like
11 1 1 10 RAFL09-12-D10 AV827181 Experimental RAFL09-12-D10 AV797460;AV827181;AF367295 putative protein
11 1 1 11 RAFL09-12-L07 AY094395 Experimental RAFL09-12-L07 AV797581;AV827228;AY094395 predicted protein of unknown function
11 1 1 12 RAFL09-12-D07 AV827179 Experimental RAFL09-12-D07 AV797457;AV827179;AF367316 MEI2-like protein (MEI2)
11 1 1 13 RAFL09-12-N06 AV827241 Experimental RAFL09-12-N06 AV797618;AV827241;AF361629 unknown protein
11 1 1 14 RAFL09-12-K06 AV827221 Experimental RAFL09-12-K06 AV797563;AV827221;AF361640 unknown protein
11 1 2 1 RAFL09-16-N06 AV827555 Experimental RAFL09-16-N06 AV798600;AV827555;AF360170 putative sugar transporter protein
11 1 2 2 RAFL09-16-C06 AV827494 Experimental RAFL09-16-C06 AV798406;AV827494;AF360150 unknown protein
11 1 2 3 RAFL09-16-K05 AY035050 Experimental RAFL09-16-K05 AV798544;AV827541;AY035050 putative RNA-binding protein
11 1 2 4 RAFL09-16-I05 AV827528 Experimental RAFL09-16-I05 AV798510;AV827528;AF360288 putative protein
11 1 2 5 RAFL09-16-B05 AV827487 Experimental RAFL09-16-B05 AV798390;AV827487;AF370129 unknown protein
11 1 2 6 RAFL09-16-K04 AY035083 Experimental RAFL09-16-K04 AV798543;AV827540;AY035083 unknown protein
11 1 2 7 RAFL09-16-E01 AV827504 Experimental RAFL09-16-E01 AV798434;AV827504;AF370208 unknown protein
11 1 2 8 RAFL09-15-K24 AV827458 Experimental RAFL09-15-K24 AV798286;AV827458;AF360149 DNA binding protein - like
11 1 2 9 RAFL09-15-F24 BP561729 Experimental RAFL09-15-F24 AV798208;BP561729
11 1 2 10 RAFL09-15-C23 AY035037 Experimental RAFL09-15-C23 AV798157;AV827413;AY035037 unknown protein
11 1 2 11 RAFL09-15-M21 AV827469 Experimental RAFL09-15-M21 AV798320;AV827469;AF360244 UDP-glucose pyrophosphorylase
11 1 2 12 RAFL09-15-F21 AV827430 Experimental RAFL09-15-F21 AV798205;AV827430;AF360194 unknown protein
11 1 2 13 RAFL09-12-O16 AV827248 Experimental RAFL09-12-O16 AV797644;AV827248;AF367327 beta-galactosidase precursor - like protein
11 1 2 14 RAFL09-12-J16 AV797555 Experimental RAFL09-12-J16 AV797555;AF361612 unknown protein
11 1 3 1 RAFL11-01-D19 AY042809 Experimental RAFL11-01-D19 AV818893;AV832035;AY042809
11 1 3 2 RAFL11-01-P18 AV832069 Experimental RAFL11-01-P18 AV819036;AV832069;AF370499 RNA lariat debranching enzyme like protein
11 1 3 3 RAFL09-16-N17 AV827558 Experimental RAFL09-16-N17 AV798609;AV827558 ERD6 protein
11 1 3 4 RAFL09-16-L17 AV827547 Experimental RAFL09-16-L17 AV798571;AV827547;AF370202 putative peptide transporter
11 1 3 5 RAFL09-16-O16 AV827561 Experimental RAFL09-16-O16 AV798622;AV827561 pyruvate dehydrogenase E1 alpha subunit
11 1 3 6 RAFL09-16-C16 AV827498 Experimental RAFL09-16-C16 AV798412;AV827498;AF360293 unknown protein
11 1 3 7 RAFL09-16-K15 AV827544 Experimental RAFL09-16-K15 AV798552;AV827544;AF360251 photosystem I subunit III precursor, putative
11 1 3 8 RAFL09-16-C15 AV827497 Experimental RAFL09-16-C15 AV798411;AV827497;AF360203 unknown protein
11 1 3 9 RAFL09-16-O10 AV827560 Experimental RAFL09-16-O10 AV798619;AV827560;AF360171 tubulin alpha-6 chain like protein
11 1 3 10 RAFL09-16-L10 AV827545 Experimental RAFL09-16-L10 AV798565;AV827545;AF360152 unknown protein
11 1 3 11 RAFL09-16-D10 AY039917 Experimental RAFL09-16-D10 AV798426;AV827501;AY039917 putative wall-associated kinase 1
11 1 3 12 RAFL09-16-I09 AY039911 Experimental RAFL09-16-I09 AV798513;AV827530;AY039911 sucrose-phosphate synthase-like protein
11 1 3 13 RAFL09-16-G09 AV827519 Experimental RAFL09-16-G09 AV798479;AV827519;AF360248 kinase like protein
11 1 3 14 RAFL09-16-M08 AV827551 Experimental RAFL09-16-M08 AV798583;AV827551;AF360200 unknown protein (At1g70160)
11 1 4 1 RAFL11-02-J20 AY054576 Experimental RAFL11-02-J20 AV819155;AV832092;AY054576 putative protein
11 1 4 2 RAFL11-02-P19 AV832111 Experimental RAFL11-02-P19 AV819222;AV832111 unknown protein
11 1 4 3 RAFL11-02-M18 BP562637 Experimental RAFL11-02-M18 AV819190;BP562637 unknown protein
11 1 4 4 RAFL11-02-F18 AY128371 Experimental RAFL11-02-F18 AV819105;AV832082;AY128371 protein kinase-like protein
11 1 4 5 RAFL11-02-D12 AV832075 Experimental RAFL11-02-D12 AV819076;AV832075 H+-transporting ATP synthase beta chain (mitochondrial) -like protein
11 1 4 6 RAFL11-02-I11 BP562635 Experimental RAFL11-02-I11 AV819138;BP562635;AY120731 glucosyltransferase-like protein
11 1 4 7 RAFL11-02-L09 AV832100 Experimental RAFL11-02-L09 AV819171;AV832100;AF370518 putative membrane transporter
11 1 4 8 RAFL11-02-I08 AV832088 Experimental RAFL11-02-I08 AV819137;AV832088;AF386924 thioredoxin like protein
11 1 4 9 RAFL11-02-M06 AY054545 Experimental RAFL11-02-M06 AV819183;AV832103;AY054545 Unknown protein (At5g66860; MUD21.12)
11 1 4 10 RAFL11-02-K06 AV832094 Experimental RAFL11-02-K06 AV819159;AV832094;AF370472 Unknown protein (K15C23.2)
11 1 4 11 RAFL11-01-C23 AV818881 Experimental RAFL11-01-C23 AV818881
11 1 4 12 RAFL11-01-J21 AY054543 Experimental RAFL11-01-J21 AV818969;AV832051;AY054543
11 1 4 13 RAFL11-01-L20 AV818992 Experimental RAFL11-01-L20 AV818992 photosystem I subunit PSI-E (psaE)
11 1 4 14 RAFL11-01-O19 AY042798 Experimental RAFL11-01-O19 AV819028;AV832067;AY042798 disease resistance response protein, putative
11 1 5 1 RAFL11-09-H19 BP562659 Experimental RAFL11-09-H19 AV820295;BP562659;AY093044 serine carboxypeptidase
11 1 5 2 RAFL11-09-B18 BP562658 Experimental RAFL11-09-B18 AV820217;BP562658 unknown protein
11 1 5 3 RAFL11-09-O17 AV832281 Experimental RAFL11-09-O17 AV820372;AV832281 extensin-like protein
11 1 5 4 RAFL11-09-B17 AY139979 Experimental RAFL11-09-B17 AV820216;AV832262;AY139979 unknown protein
11 1 5 5 RAFL11-09-O14 AV820370 Experimental RAFL11-09-O14 AV820370 putative protein
11 1 5 6 RAFL11-09-B14 BP562657 Experimental RAFL11-09-B14 AV820215;BP562657
11 1 5 7 RAFL11-03-L10 AV819320 Experimental RAFL11-03-L10 AV819320 putative protein
11 1 5 8 RAFL11-03-J10 AV832132 Experimental RAFL11-03-J10 AV819302;AV832132 unknown protein
11 1 5 9 RAFL11-03-L09 AY054551 Experimental RAFL11-03-L09 AV819319;AV832136;AY054551 pyruvate kinase
11 1 5 10 RAFL11-03-J08 AY042793 Experimental RAFL11-03-J08 AV819300;AV832131;AY042793 unknown protein
11 1 5 11 RAFL11-03-E07 AV832124 Experimental RAFL11-03-E07 AV819263;AV832124
11 1 5 12 RAFL11-03-E04 AY054550 Experimental RAFL11-03-E04 AV819262;AV832123;AY054550 unknown protein
11 1 5 13 RAFL11-02-C23 AY054577 Experimental RAFL11-02-C23 AV819070;AV832073;AY054577 lipase like protein
11 1 5 14 RAFL11-02-N21 AV832105 Experimental RAFL11-02-N21 AV819203;AV832105 1-D-deoxyxylulose 5-phosphate synthase - like protein
11 1 6 1 RAFL11-11-F08 AY136314 Experimental RAFL11-11-F08 AV820604;AY136314 putative protein
11 1 6 2 RAFL11-11-M07 AY136313 Experimental RAFL11-11-M07 AV820691;AY136313
11 1 6 3 RAFL11-10-I22 AY093026 Experimental RAFL11-10-I22 AV820483;AV832303;AY093026 hypothetical protein
11 1 6 4 RAFL11-10-D22 AY072351 Experimental RAFL11-10-D22 AV820429;AV832290;AY072351 enoyl CoA hydratase-like protein
11 1 6 5 RAFL11-10-D21 AY093051 Experimental RAFL11-10-D21 AV820428;AV832289;AY093051 CBL-interacting protein kinase 21 (CIPK21)
11 1 6 6 RAFL11-10-H19 AY093024 Experimental RAFL11-10-H19 AV820471;AV832300;AY093024 hypothetical protein
11 1 6 7 RAFL11-10-L18 BP562662 Experimental RAFL11-10-L18 AV820512;BP562662;AY072350 60S ribosomal protein L24
11 1 6 8 RAFL11-10-P17 BP562664 Experimental RAFL11-10-P17 AV820548;BP562664;AY136309 unknown protein
11 1 6 9 RAFL11-10-O06 BP562663 Experimental RAFL11-10-O06 AV820534;BP562663 sterol delta7 reductase
11 1 6 10 RAFL11-10-O05 BT002447 Experimental RAFL11-10-O05 AV820533;BT002447 putative protein
11 1 6 11 RAFL11-10-K03 AY136305 Experimental RAFL11-10-K03 AV820495;AV832305;AY136305 unknown protein
11 1 6 12 RAFL11-10-J02 AV820486 Experimental RAFL11-10-J02 AV820486
11 1 6 13 RAFL11-10-F02 AV832293 Experimental RAFL11-10-F02 AV820444;AV832293
11 1 6 14 RAFL11-09-D24 AY093047 Experimental RAFL11-09-D24 AV820248;AV832270;AY093047 transport protein sec61 alpha subunit, putative
11 1 7 11 RAFL11-11-P11 AY093054 Experimental RAFL11-11-P11 AV820732;AV832334;AY093054 ABC transporter, putative
11 1 7 12 RAFL11-11-M10 AV820694 Experimental RAFL11-11-M10 AV820694
11 1 7 13 RAFL11-11-H09 AV832319 Experimental RAFL11-11-H09 AV820629;AV832319
11 1 7 14 RAFL11-11-E09 BT002070 Experimental RAFL11-11-E09 AV820594;BT002070 Lhca2 protein
11 2 1 1 RAFL09-10-L23 AY058182 Experimental RAFL09-10-L23 AV797092;AV827041;AY058182 myrosinase precursor
11 2 1 2 RAFL09-10-E23 AY058179 Experimental RAFL09-10-E23 AV796976;AV826993;AY058179 putative homeodomain transcription factor
11 2 1 3 RAFL09-10-E22 AY069877 Experimental RAFL09-10-E22 AV796975;AV826992;AY069877 unknown protein
11 2 1 4 RAFL09-10-A22 AY058162 Experimental RAFL09-10-A22 AV796912;AV826975;AY058162 unknown protein
11 2 1 5 RAFL09-10-I18 AY058204 Experimental RAFL09-10-I18 AV797041;AV827017;AY058204 peptide transporter like protein
11 2 1 6 RAFL09-10-F18 AY069889 Experimental RAFL09-10-F18 AV796991;AV826998;AY069889 putative protein
11 2 1 7 RAFL09-10-H17 AV827009 Experimental RAFL09-10-H17 AV797025;AV827009;AF462829 unknown protein
11 2 1 8 RAFL09-10-N16 AY058175 Experimental RAFL09-10-N16 AV797122;AV827059;AY058175 methyltransferase, putative
11 2 1 9 RAFL09-10-L16 AY058164 Experimental RAFL09-10-L16 AV797088;AV827038;AY058164 putative protein
11 2 1 10 RAFL09-10-J16 BP561683 Experimental RAFL09-10-J16 AV797057;BP561683;AY128292
11 2 1 11 RAFL09-10-D11 AV826987 Experimental RAFL09-10-D11 AV796948;AV826987
11 2 1 12 RAFL09-10-L10 AY069888 Experimental RAFL09-10-L10 AV797083;AV827036;AY069888 putative protein
11 2 1 13 RAFL09-10-B10 AY094461 Experimental RAFL09-10-B10 AV796919;AV826976;AY094461 putative protein
11 2 1 14 RAFL09-10-N09 AY058171 Experimental RAFL09-10-N09 AV797117;AV827056;AY058171 putative protein
11 2 2 1 RAFL09-14-C10 AV827331 Experimental RAFL09-14-C10 AV797875;AV827331;AF372973 putative UDP-glucose glucosyltransferase
11 2 2 2 RAFL09-14-J09 AY094407 Experimental RAFL09-14-J09 AV797993;AY094407 receptor-like protein kinase 5 precursor (RLK5)
11 2 2 3 RAFL09-14-D09 AY065061 Experimental RAFL09-14-D09 AV797891;AV827335;AY065061 unknown protein
11 2 2 4 RAFL09-14-F08 AY125493 Experimental RAFL09-14-F08 AV797926;AV827348;AY125493 plasma membrane proton ATPase-like
11 2 2 5 RAFL09-14-C08 AV827330 Experimental RAFL09-14-C08 AV797874;AV827330 unknown protein
11 2 2 6 RAFL09-14-G07 AV827352 Experimental RAFL09-14-G07 AV797942;AV827352;AF372922 phosphoenolpyruvate carboxykinase (ATP) -like protein
11 2 2 7 RAFL09-14-B03 AV827325 Experimental RAFL09-14-B03 AV797855;AV827325 unknown protein
11 2 2 8 RAFL09-14-M02 AV827379 Experimental RAFL09-14-M02 AV798041;AV827379 putative jasmonate inducible protein
11 2 2 9 RAFL09-14-L01 AV827372 Experimental RAFL09-14-L01 AV798020;AV827372;AF372954
11 2 2 10 RAFL09-14-G01 AV827351 Experimental RAFL09-14-G01 AV797939;AV827351;AF372945 26S proteasome AAA-ATPase subunit RPT4a (gb|AAF22524.1)
11 2 2 11 RAFL09-14-D01 AV827334 Experimental RAFL09-14-D01 AV797888;AV827334 unknown protein
11 2 2 12 RAFL09-14-B01 AV827323 Experimental RAFL09-14-B01 AV797853;AV827323;AF372927 protein kinase-like
11 2 2 13 RAFL09-10-M24 AV827051 Experimental RAFL09-10-M24 AV797110;AV827051;AF462830 potassium-dependent sodium-calcium exchanger - like protein
11 2 2 14 RAFL09-10-G24 AY058193 Experimental RAFL09-10-G24 AV797014;AV827006;AY058193 putative expansin
11 2 3 1 RAFL09-17-B18 AV827575 Experimental RAFL09-17-B18 AV798670;AV827575;AF360245 unknown protein
11 2 3 2 RAFL09-17-N17 AY035082 Experimental RAFL09-17-N17 AV798877;AV827648;AY035082 unknown protein
11 2 3 3 RAFL09-14-L24 AV827378 Experimental RAFL09-14-L24 AV798039;AV827378;AF372976 unknown protein
11 2 3 4 RAFL09-14-G24 AY065063 Experimental RAFL09-14-G24 AV797953;AV827355;AY065063 unknown protein
11 2 3 5 RAFL09-14-D24 AV827342 Experimental RAFL09-14-D24 AV797903;AV827342;AF372957 mitochondrial carrier like protein
11 2 3 6 RAFL09-14-K23 AV798018 Experimental RAFL09-14-K23 AV798018;AF372946 histidine transport protein (PTR2-B)
11 2 3 7 RAFL09-14-I22 BP561720 Experimental RAFL09-14-I22 AV797987;BP561720;AF372936 unknown protein
11 2 3 8 RAFL09-14-M21 BP561722 Experimental RAFL09-14-M21 AV798057;BP561722 isp4 like protein
11 2 3 9 RAFL09-14-J16 AV827362 Experimental RAFL09-14-J16 AV797995;AV827362;AF372970 glucose-6-phosphate isomerase, cytosolic (GPI) (phosphoglucose isomerase) (PGI) (phosphohexose isomerase) (PHI) (sp|P34795)
11 2 3 10 RAFL09-14-D16 AV827339 Experimental RAFL09-14-D16 AV797898;AV827339;AF372965 Nitrilase 4 (sp|P46011)
11 2 3 11 RAFL09-14-K15 AV827369 Experimental RAFL09-14-K15 AV798013;AV827369 putative protein
11 2 3 12 RAFL09-14-E14 AV827346 Experimental RAFL09-14-E14 AV797913;AV827346;AF372942 unknown protein (At1g20560)
11 2 3 13 RAFL09-14-M13 AY126993 Experimental RAFL09-14-M13 AV798050;AV827383;AY126993 hypothetical protein
11 2 3 14 RAFL09-14-G13 BP561716 Experimental RAFL09-14-G13 AV797946;BP561716;AF372929 CIA2
11 2 4 1 RAFL09-18-F10 AV827690 Experimental RAFL09-18-F10 AV799006;AV827690;AF360298 pumilio like protein
11 2 4 2 RAFL09-18-F09 AV827689 Experimental RAFL09-18-F09 AV799005;AV827689;AF360292 isp4 like protein
11 2 4 3 RAFL09-18-B09 AV827669 Experimental RAFL09-18-B09 AV798936;AV827669;AF360249 aminopeptidase-like protein
11 2 4 4 RAFL09-18-C08 BP561754 Experimental RAFL09-18-C08 AV798951;BP561754;AY091139
11 2 4 5 RAFL09-17-M24 AY035115 Experimental RAFL09-17-M24 AV798863;AV827643;AY035115 unknown protein
11 2 4 6 RAFL09-17-J24 AV827626 Experimental RAFL09-17-J24 AV798809;AV827626;AF360151 aminoalcoholphosphotransferase, putative, 3' partial
11 2 4 7 RAFL09-17-E24 AY035051 Experimental RAFL09-17-E24 AV798724;AV827592;AY035051 unknown protein
11 2 4 8 RAFL09-17-K23 BP561748 Experimental RAFL09-17-K23 AV798823;BP561748;AF360289 unknown protein
11 2 4 9 RAFL09-17-E23 BP561743 Experimental RAFL09-17-E23 AV798723;BP561743;AF360246 unknown protein
11 2 4 10 RAFL09-17-G22 BP561745 Experimental RAFL09-17-G22 AV798756;BP561745;AF360197 monodehydroascorbate reductase (NADH) - like protein
11 2 4 11 RAFL09-17-J19 BP561746 Experimental RAFL09-17-J19 AV798804;BP561746;AF370209 growth factor like protein
11 2 4 12 RAFL09-17-F19 BP561744 Experimental RAFL09-17-F19 AV798740;BP561744;AF370201 unknown protein
11 2 4 13 RAFL09-17-B19 AV827576 Experimental RAFL09-17-B19 AV798671;AV827576;AF360353 mitogen-activated protein kinase homologue
11 2 4 14 RAFL09-17-E18 AV798719 Experimental RAFL09-17-E18 AV798719
11 2 5 1 RAFL11-06-B10 AV832205 Experimental RAFL11-06-B10 AV819633;AV832205;AF386923
11 2 5 2 RAFL11-06-P07 AV819759 Experimental RAFL11-06-P07 AV819759 unknown protein
11 2 5 3 RAFL11-06-D07 AV832208 Experimental RAFL11-06-D07 AV819655;AV832208;AF370520 helicase like protein
11 2 5 4 RAFL11-06-H06 AY042801 Experimental RAFL11-06-H06 AV819689;AV832215;AY042801 unknown protein
11 2 5 5 RAFL11-06-N05 AV832231 Experimental RAFL11-06-N05 AV819741;AV832231;AF370491
11 2 5 6 RAFL11-06-F04 AV832211 Experimental RAFL11-06-F04 AV819671;AV832211;AF370463 S18.A ribosomal protein
11 2 5 7 RAFL09-18-G24 AV827700 Experimental RAFL09-18-G24 AV799034;AV827700;AF360175 ATP synthase delta' chain, mitochondrial precursor (sp|Q96252)
11 2 5 8 RAFL09-18-F23 AY035070 Experimental RAFL09-18-F23 AV799015;AV827694;AY035070 putative protein kinase
11 2 5 9 RAFL09-18-F21 AV827693 Experimental RAFL09-18-F21 AV799013;AV827693;AF370143 putative cysteinyl-tRNA synthetase
11 2 5 10 RAFL09-18-A20 AV827667 Experimental RAFL09-18-A20 AV798929;AV827667;AF370138 unknown protein (At1g55270)
11 2 5 11 RAFL09-18-A19 AV827666 Experimental RAFL09-18-A19 AV798928;AV827666;AF360252 putative heat-shock protein
11 2 5 12 RAFL09-18-F17 AV827692 Experimental RAFL09-18-F17 AV799010;AV827692;AF370127 GTP-binding protein rab11 - like
11 2 5 13 RAFL09-18-C11 AV798952 Experimental RAFL09-18-C11 AV798952;AF360172 TATC-like protein
11 2 5 14 RAFL09-18-A11 AV827664 Experimental RAFL09-18-A11 AV798922;AV827664;AF360153 oxoglutarate/malate translocator-like protein
11 2 6 1 RAFL11-07-N24 AY120749 Experimental RAFL11-07-N24 AV819895;AV832260;AY120749 putative lipase
11 2 6 2 RAFL11-07-M23 AY054592 Experimental RAFL11-07-M23 AV819885;AY054592 ubiquinol--cytochrome-c reductase-like protein
11 2 6 3 RAFL11-07-D13 BT002440 Experimental RAFL11-07-D13 AV819800;AV832246;BT002440 putative cinnamyl-alcohol dehydrogenase
11 2 6 4 RAFL11-07-C12 AV832242 Experimental RAFL11-07-C12 AV819786;AV832242 putative 30S ribosomal protein S13
11 2 6 5 RAFL11-07-D11 AY042805 Experimental RAFL11-07-D11 AV819799;AV832245;AY042805 unknown protein
11 2 6 6 RAFL11-07-J10 AY054589 Experimental RAFL11-07-J10 AV819860;AV832256;AY054589 beta-galactosidase (emb|CAB64740.1)
11 2 6 7 RAFL11-07-J09 AY081292 Experimental RAFL11-07-J09 AV819859;AV832255;AY081292 proline transporter 2
11 2 6 8 RAFL11-07-P08 AV819903 Experimental RAFL11-07-P08 AV819903 phosphate-induced (phi-1) protein, putative
11 2 6 9 RAFL11-06-D23 BT000473 Experimental RAFL11-06-D23 AV819662;AV832210;BT000473 unknown
11 2 6 10 RAFL11-06-F22 AV832213 Experimental RAFL11-06-F22 AV819678;AV832213;AF370477 unknown protein
11 2 6 11 RAFL11-06-J20 AV832225 Experimental RAFL11-06-J20 AV819714;AV832225
11 2 6 12 RAFL11-06-J19 AV832224 Experimental RAFL11-06-J19 AV819713;AV832224;AF370484 60S ribosomal protein L7
11 2 6 13 RAFL11-06-L17 AV832229 Experimental RAFL11-06-L17 AV819731;AV832229 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
11 2 6 14 RAFL11-06-L16 AY042789 Experimental RAFL11-06-L16 AV819730;AV832228;AY042789 unknown protein
11 3 1 1 RAFL09-12-C14 AV827176 Experimental RAFL09-12-C14 AV797447;AV827176;AF361634 calcium-dependent protein kinase - like protein
11 3 1 2 RAFL09-12-L13 BP561697 Experimental RAFL09-12-L13 AV797587;BP561697;AY037179 disease resistance protein RPP13-like protein
11 3 1 3 RAFL09-12-F13 AV827196 Experimental RAFL09-12-F13 AV797496;AV827196;AF367303 unknown protein
11 3 1 4 RAFL09-12-D13 AY048198 Experimental RAFL09-12-D13 AV797463;AV827182;AY048198 pyruvate kinase
11 3 1 5 RAFL09-12-L09 AV827230 Experimental RAFL09-12-L09 AV797583;AV827230;AF367319 unknown protein
11 3 1 6 RAFL09-12-H09 AV827209 Experimental RAFL09-12-H09 AV797525;AV827209;AF367313 putative protein
11 3 1 7 RAFL09-12-E09 AV827186 Experimental RAFL09-12-E09 AV797477;AV827186;AF361632 putative protein
11 3 1 8 RAFL09-12-P08 AV827251 Experimental RAFL09-12-P08 AV797654;AV827251;AF361639 putative protein
11 3 1 9 RAFL09-12-J08 AV827216 Experimental RAFL09-12-J08 AV797553;AV827216;AF361622 putative riboflavin synthase alpha chain
11 3 1 10 RAFL09-12-B08 AY037177 Experimental RAFL09-12-B08 AV797426;AV827170;AY037177 homeobox like protein
11 3 1 11 RAFL09-12-I05 BP561693 Experimental RAFL09-12-I05 AV797537;BP561693 lipophosphoglycan biosynthetic protein - like
11 3 1 12 RAFL09-12-B05 AV827168 Experimental RAFL09-12-B05 AV797423;AV827168;AF367314 60S ribosomal protein - like
11 3 1 13 RAFL09-12-O04 AV827243 Experimental RAFL09-12-O04 AV797635;AV827243;AF367309 unknown protein
11 3 1 14 RAFL09-12-L04 AV827226 Experimental RAFL09-12-L04 AV797579;AV827226;AF361797 zinc finger protein, putative
11 3 2 1 RAFL09-16-B04 AV827486 Experimental RAFL09-16-B04 AV798389;AV827486;AF360169 actin depolymerizing factor 3 - like protein
11 3 2 2 RAFL09-16-P03 AY050994 Experimental RAFL09-16-P03 AV798627;AV827564;AY050994 unknown protein
11 3 2 3 RAFL09-16-K02 AV798542 Experimental RAFL09-16-K02 AV798542;AF360295
11 3 2 4 RAFL09-16-H02 AV827523 Experimental RAFL09-16-H02 AV798490;AV827523;AF360286 unknown protein
11 3 2 5 RAFL09-16-F02 AY035088 Experimental RAFL09-16-F02 AV798453;AV827509;AY035088 putative casein kinase II catalytic (alpha) subunit
11 3 2 6 RAFL09-16-K01 AV827539 Experimental RAFL09-16-K01 AV798541;AV827539;AF360195
11 3 2 7 RAFL09-15-B21 AV827411 Experimental RAFL09-15-B21 AV798140;AV827411;AF370207 unknown protein
11 3 2 8 RAFL09-15-H20 BP561731 Experimental RAFL09-15-H20 AV798238;BP561731;AF360147 putative protein
11 3 2 9 RAFL09-15-A20 AY035048 Experimental RAFL09-15-A20 AV798125;AV827407;AY035048 putative shaggy kinase iota protein
11 3 2 10 RAFL09-15-O19 AV798353 Experimental RAFL09-15-O19 AV798353 hypothetical protein
11 3 2 11 RAFL09-15-I19 AY125492 Experimental RAFL09-15-I19 AV798255;AV827448;AY125492
11 3 2 12 RAFL09-15-G19 AV827435 Experimental RAFL09-15-G19 AV798223;AV827435;AF360193 Unknown protein
11 3 2 13 RAFL09-12-A15 AV827162 Experimental RAFL09-12-A15 AV797415;AV827162;AF367321 unknown protein
11 3 2 14 RAFL09-12-K14 AV827223 Experimental RAFL09-12-K14 AV797570;AV827223;AF367311 selenium-binding protein (Z97335.13)
11 3 3 1 RAFL11-01-C16 AY128370 Experimental RAFL11-01-C16 AV818876;AV832029;AY128370 exonuclease - like protein
11 3 3 2 RAFL11-01-G15 AV818930 Experimental RAFL11-01-G15 AV818930 40S ribosomal protein S7-like
11 3 3 3 RAFL09-16-M14 AV827552 Experimental RAFL09-16-M14 AV798587;AV827552;AF360173 putative protein
11 3 3 4 RAFL09-16-B14 AV827490 Experimental RAFL09-16-B14 AV798399;AV827490;AF360154
11 3 3 5 RAFL09-16-B13 BP561735 Experimental RAFL09-16-B13 AV798398;BP561735
11 3 3 6 RAFL09-16-L12 AV827546 Experimental RAFL09-16-L12 AV798567;AV827546;AF370136 similar to flavin-containing monooxygenase (sp|P36366); similar to ESTs gb|R30018, gb|H36886, gb|N37822, and gb|T88100
11 3 3 7 RAFL09-16-C12 AV827496 Experimental RAFL09-16-C12 AV798408;AV827496;AF370130 selenium-binding protein (Z97335.13)
11 3 3 8 RAFL09-16-I11 AV827531 Experimental RAFL09-16-I11 AV798514;AV827531;AF360201 putative protein
11 3 3 9 RAFL09-16-F08 AV827512 Experimental RAFL09-16-F08 AV798459;AV827512;AF370210 NAD dependent epimerase, putative
11 3 3 10 RAFL09-16-D08 AY035068 Experimental RAFL09-16-D08 AV798424;AV827500;AY035068 unknown protein
11 3 3 11 RAFL09-16-B08 AV827488 Experimental RAFL09-16-B08 AV798393;AV827488;AF360296 Hydroxylase/Oxygenase (CTF2B)
11 3 3 12 RAFL09-16-P07 AV827565 Experimental RAFL09-16-P07 AV798629;AV827565;AF360290
11 3 3 13 RAFL09-16-M07 AY035089 Experimental RAFL09-16-M07 AV798582;AV827550;AY035089 ReMembR-H2 protein JR700 (gb|AAF32325.1)
11 3 3 14 RAFL09-16-J07 AV827534 Experimental RAFL09-16-J07 AV798528;AV827534;AF360198 ubiquitin carboxyl-terminal hydrolase
11 3 4 1 RAFL11-02-D15 AV819078 Experimental RAFL11-02-D15 AV819078
11 3 4 2 RAFL11-02-K14 AV819161 Experimental RAFL11-02-K14 AV819161
11 3 4 3 RAFL11-02-A14 AV832070 Experimental RAFL11-02-A14 AV819043;AV832070 zinc finger protein OBP4 - like
11 3 4 4 RAFL11-02-K13 AV832095 Experimental RAFL11-02-K13 AV819160;AV832095;AF370498 cinnamyl-alcohol dehydrogenase CAD1
11 3 4 5 RAFL11-02-M05 AY042790 Experimental RAFL11-02-M05 AV819182;AV832102;AY042790 photosystem I subunit PSI-E (psaE)
11 3 4 6 RAFL11-02-B04 BT002407 Experimental RAFL11-02-B04 AV819052;BT002407
11 3 4 7 RAFL11-02-K03 AV832093 Experimental RAFL11-02-K03 AV819157;AV832093;AF370523 unknown protein
11 3 4 8 RAFL11-02-I02 AY120730 Experimental RAFL11-02-I02 AV819134;AV832087;AY120730 unknown protein
11 3 4 9 RAFL11-02-D01 AY054572 Experimental RAFL11-02-D01 AV819071;AV832074;AY054572
11 3 4 10 RAFL11-01-D24 AY042787 Experimental RAFL11-01-D24 AV818896;AV832036;AY042787 feebly like protein
11 3 4 11 RAFL11-01-H18 AY128368 Experimental RAFL11-01-H18 AV818945;AV832048;AY128368 unknown protein
11 3 4 12 RAFL11-01-N17 AY054571 Experimental RAFL11-01-N17 AV819018;AV832064;AY054571 homeodomain - like protein
11 3 4 13 RAFL11-01-N16 AY120748 Experimental RAFL11-01-N16 AV819017;AV832063;AY120748 unknown protein
11 3 4 14 RAFL11-01-F16 AV832044 Experimental RAFL11-01-F16 AV818921;AV832044;AF386921 metallothionein-like protein
11 3 5 1 RAFL11-09-C12 AV832264 Experimental RAFL11-09-C12 AV820227;AV832264 metallothionein-like protein
11 3 5 2 RAFL11-09-M11 AV832279 Experimental RAFL11-09-M11 AV820346;AV832279 aquaporin (plasma membrane intrinsic protein 2C)
11 3 5 3 RAFL11-09-P10 AV832282 Experimental RAFL11-09-P10 AV820380;AV832282 mucin-like protein
11 3 5 4 RAFL11-09-K08 AY139981 Experimental RAFL11-09-K08 AV820319;AV832275;AY139981 eukaryotic protein synthesis initiation factor 4A
11 3 5 5 RAFL11-09-D07 AV832268 Experimental RAFL11-09-D07 AV820238;AV832268 putative protein
11 3 5 6 RAFL11-09-M04 AY072356 Experimental RAFL11-09-M04 AV820342;AV832278;AY072356 unknown protein
11 3 5 7 RAFL11-03-O03 AY054580 Experimental RAFL11-03-O03 AV819343;AV832141;AY054580 unknown protein
11 3 5 8 RAFL11-03-M02 BT002462 Experimental RAFL11-03-M02 AV819324;AV832138;BT002462 NAM / CUC2 -like protein
11 3 5 9 RAFL11-03-B02 AY054579 Experimental RAFL11-03-B02 AV819238;AV832116;AY054579 unknown protein
11 3 5 10 RAFL11-03-I01 AY054549 Experimental RAFL11-03-I01 AV819284;AV832127;AY054549 Unknown protein (At5g47590; MNJ7.18)
11 3 5 11 RAFL11-02-F24 BT000427 Experimental RAFL11-02-F24 AV819108;AV832084;BT000427
11 3 5 12 RAFL11-02-F23 AY120732 Experimental RAFL11-02-F23 AV819107;AV832083;AY120732
11 3 5 13 RAFL11-02-F17 AY042794 Experimental RAFL11-02-F17 AV819104;AV832081;AY042794 AtAGP4
11 3 5 14 RAFL11-02-F16 AV832080 Experimental RAFL11-02-F16 AV819103;AV832080;AF370479 D-ribulose-5-phosphate 3-epimerase like protein
11 3 6 1 RAFL11-11-G02 AY093028 Experimental RAFL11-11-G02 AV820612;AV832316;AY093028 hypothetical protein
11 3 6 2 RAFL11-10-D24 BP562661 Experimental RAFL11-10-D24 AV820431;BP562661 putative protein
11 3 6 3 RAFL11-10-C16 AV832286 Experimental RAFL11-10-C16 AV820413;AV832286 unknown protein
11 3 6 4 RAFL11-10-G14 BT002066 Experimental RAFL11-10-G14 AV820459;BT002066 late embryogenesis abundant protein, putative
11 3 6 5 RAFL11-10-A14 AY136322 Experimental RAFL11-10-A14 AV820391;AV832284;AY136322 unknown protein
11 3 6 6 RAFL11-10-H11 AV820467 Experimental RAFL11-10-H11 AV820467
11 3 6 7 RAFL11-10-D10 AY136307 Experimental RAFL11-10-D10 AV820421;AV832288;AY136307 bZip protein AtbZIP1
11 3 6 8 RAFL11-10-K08 AY136321 Experimental RAFL11-10-K08 AV820497;AV832306;AY136321 ribosomal protein L27, putative
11 3 6 9 RAFL11-09-N22 AY072360 Experimental RAFL11-09-N22 AV820362;AV832280;AY072360 putative protein
11 3 6 10 RAFL11-09-I22 BP562660 Experimental RAFL11-09-I22 AV820304;BP562660 putative protein
11 3 6 11 RAFL11-09-F22 AY093046 Experimental RAFL11-09-F22 AV820271;AV832272;AY093046 putative GTP-binding protein
11 3 6 12 RAFL11-09-M21 AY072358 Experimental RAFL11-09-M21 AV820350;AY072358 uridylate kinase like protein
11 3 6 13 RAFL11-09-E21 AY093045 Experimental RAFL11-09-E21 AV820259;AV832271;AY093045 arabinogalactan-protein AGP21
11 3 6 14 RAFL11-09-C20 AV832266 Experimental RAFL11-09-C20 AV820231;AV832266 putative homeodomain transcription factor
11 3 7 11 RAFL11-11-H06 AY136312 Experimental RAFL11-11-H06 AV820627;AV832318;AY136312 ferredoxin-NADP+ reductase like protein
11 3 7 12 RAFL11-11-C06 AY093052 Experimental RAFL11-11-C06 AV820571;AV832311;AY093052 villin 3
11 3 7 13 RAFL11-11-N04 AY072362 Experimental RAFL11-11-N04 AV820706;AY072362 unknown protein
11 3 7 14 RAFL11-11-M03 AY136323 Experimental RAFL11-11-M03 AV820688;AV832328;AY136323 Lil3 protein
11 4 1 1 RAFL09-10-I20 AV827019 Experimental RAFL09-10-I20 AV797043;AV827019 auxin transport protein
11 4 1 2 RAFL09-10-L19 AY058177 Experimental RAFL09-10-L19 AV797090;AV827039;AY058177 putative prolylcarboxypeptidase
11 4 1 3 RAFL09-10-C19 AY058166 Experimental RAFL09-10-C19 AV796938;AV826985;AY058166
11 4 1 4 RAFL09-10-K18 AY058156 Experimental RAFL09-10-K18 AV797075;AV827030;AY058156 unknown protein
11 4 1 5 RAFL09-10-M15 AY058198 Experimental RAFL09-10-M15 AV797105;AV827047;AY058198 unknown protein (At1g72990)
11 4 1 6 RAFL09-10-F14 AV826997 Experimental RAFL09-10-F14 AV796989;AV826997 putative tetracycline resistance efflux protein
11 4 1 7 RAFL09-10-C13 AY058185 Experimental RAFL09-10-C13 AV796934;AV826984;AY058185 putative protein
11 4 1 8 RAFL09-10-L12 AY058173 Experimental RAFL09-10-L12 AV797085;AV827037;AY058173 unknown protein (At1g31800)
11 4 1 9 RAFL09-10-C12 AY069879 Experimental RAFL09-10-C12 AV796933;AV826983;AY069879 beta-amylase-like proten
11 4 1 10 RAFL09-10-N11 AY069874 Experimental RAFL09-10-N11 AV797119;AV827057;AY069874 putative protein
11 4 1 11 RAFL09-10-I08 AY058196 Experimental RAFL09-10-I08 AV797034;AV827015;AY058196 DNA repair protein RAD23 homolog
11 4 1 12 RAFL09-10-M07 AY069885 Experimental RAFL09-10-M07 AV797099;AV827044;AY069885 hypothetical protein
11 4 1 13 RAFL09-10-G07 AY058189 Experimental RAFL09-10-G07 AV797001;AY058189 protein kinase like protein
11 4 1 14 RAFL09-10-B07 AY069882 Experimental RAFL09-10-B07 AV796917;AY069882 unknown protein
11 4 2 1 RAFL09-14-L06 AV827374 Experimental RAFL09-14-L06 AV798024;AV827374;AF372977 26S proteasome subunit 4
11 4 2 2 RAFL09-14-H06 AV827356 Experimental RAFL09-14-H06 AV797959;AV827356;AF372963 drought-induced protein Di19-like protein
11 4 2 3 RAFL09-14-N04 AV827386 Experimental RAFL09-14-N04 AV798061;AV827386;AF372950 auxin transporter splice variant b, putative
11 4 2 4 RAFL09-14-E04 AY053410 Experimental RAFL09-14-E04 AV797907;AY053410
11 4 2 5 RAFL09-14-N03 AV827385 Experimental RAFL09-14-N03 AV798060;AV827385;AF372930
11 4 2 6 RAFL09-14-L03 AY094406 Experimental RAFL09-14-L03 AV798022;AV827373;AY094406
11 4 2 7 RAFL09-13-G24 AV827286 Experimental RAFL09-13-G24 AV797746;AV827286 unknown protein
11 4 2 8 RAFL09-13-N23 AY053417 Experimental RAFL09-13-N23 AV797811;AV827310;AY053417
11 4 2 9 RAFL09-13-L22 AV797786 Experimental RAFL09-13-L22 AV797786 hypothetical protein
11 4 2 10 RAFL09-13-P20 AY053412 Experimental RAFL09-13-P20 AV797834;AV827319;AY053412 glycolate oxidase like protein
11 4 2 11 RAFL09-13-J20 AV827298 Experimental RAFL09-13-J20 AV797772;AV827298;AF372933 putative eukaryotic initiation factor 5A (eIF-5A)
11 4 2 12 RAFL09-13-J19 AV827297 Experimental RAFL09-13-J19 AV797771;AV827297;AF372924 unknown protein (At1g69210)
11 4 2 13 RAFL09-10-F21 AY058200 Experimental RAFL09-10-F21 AV796994;AV826999;AY058200
11 4 2 14 RAFL09-10-L20 AV827040 Experimental RAFL09-10-L20 AV797091;AV827040 hypothetical protein
11 4 3 1 RAFL09-17-O15 AY035087 Experimental RAFL09-17-O15 AV798892;AY035087 dnaJ protein homolog atj3
11 4 3 2 RAFL09-17-H15 AY035081 Experimental RAFL09-17-H15 AV798767;AV827605;AY035081 Argonaute (AGO1)-like protein
11 4 3 3 RAFL09-14-D21 AY094409 Experimental RAFL09-14-D21 AV797901;AV827341;AY094409 putative protein (fragment)
11 4 3 4 RAFL09-14-G19 BP561717 Experimental RAFL09-14-G19 AV797949;BP561717;AF372969 putative protein kinase
11 4 3 5 RAFL09-14-G18 AV827354 Experimental RAFL09-14-G18 AV797948;AV827354;AF372959 nitrate transporter
11 4 3 6 RAFL09-14-J17 AY053413 Experimental RAFL09-14-J17 AV797996;AV827363;AY053413 type 1 membrane protein, putative
11 4 3 7 RAFL09-14-B17 AV827328 Experimental RAFL09-14-B17 AV797864;AV827328;AF372935 unknown protein
11 4 3 8 RAFL09-14-L16 AV827376 Experimental RAFL09-14-L16 AV798032;AV827376;AF372928 putative protein
11 4 3 9 RAFL09-14-H12 AY053420 Experimental RAFL09-14-H12 AV797964;AV827358;AY053420 unknown protein
11 4 3 10 RAFL09-14-C12 AV827332 Experimental RAFL09-14-C12 AV797877;AV827332;AF372968 putative anthocyanin 5-aromatic acyltransferase
11 4 3 11 RAFL09-14-A12 AV827322 Experimental RAFL09-14-A12 AV797846;AV827322;AF372951 unknown protein (At1g78070)
11 4 3 12 RAFL09-14-J11 AY053408 Experimental RAFL09-14-J11 AV797994;AV827361;AY053408 unknown protein
11 4 3 13 RAFL09-14-B11 AV827326 Experimental RAFL09-14-B11 AV797860;AV827326 putative transport protein
11 4 3 14 RAFL09-14-M10 AV827381 Experimental RAFL09-14-M10 AV798048;AV827381;AF372926 monogalactosyldiacylglycerol synthase
11 4 4 1 RAFL09-18-D05 AV827680 Experimental RAFL09-18-D05 AV798967;AV827680;AF360297 unknown protein
11 4 4 2 RAFL09-18-F04 AV827688 Experimental RAFL09-18-F04 AV799002;AV827688;AF360291 expansin-like protein
11 4 4 3 RAFL09-18-B03 AV827668 Experimental RAFL09-18-B03 AV798934;AV827668;AF360247 sulfite oxidase (SOX)
11 4 4 4 RAFL09-18-F02 AV827687 Experimental RAFL09-18-F02 AV799000;AV827687;AF360199 GASA4
11 4 4 5 RAFL09-17-O21 AY035114 Experimental RAFL09-17-O21 AV798898;AV827658;AY035114 RNA helicase (emb|CAA09212.1)
11 4 4 6 RAFL09-17-J21 AY050995 Experimental RAFL09-17-J21 AV798806;AV827625;AY050995 H+-transporting ATP synthase beta chain (mitochondrial) -like protein
11 4 4 7 RAFL09-17-H21 AY035049 Experimental RAFL09-17-H21 AV798771;AV827607;AY035049 serine/threonine-protein kinase-like protein
11 4 4 8 RAFL09-17-K20 AV827629 Experimental RAFL09-17-K20 AV798821;AV827629;AF360287 putative protein
11 4 4 9 RAFL09-17-G20 AV827599 Experimental RAFL09-17-G20 AV798754;AV827599;AF370128 unknown protein
11 4 4 10 RAFL09-17-M19 AV827641 Experimental RAFL09-17-M19 AV798858;AV827641;AF360196 phytoene dehydrogenase precursor (phytoene desaturase)
11 4 4 11 RAFL09-17-I17 AV827616 Experimental RAFL09-17-I17 AV798786;AV827616;AF360168 putative carrier protein
11 4 4 12 RAFL09-17-G17 AV827598 Experimental RAFL09-17-G17 AV798752;AV827598;AF360148 unknown protein
11 4 4 13 RAFL09-17-M16 AV827640 Experimental RAFL09-17-M16 AV798855;AV827640;AF360352 seryl-tRNA synthetase
11 4 4 14 RAFL09-17-F16 AV827595 Experimental RAFL09-17-F16 AV798737;AV827595;AF360284 Putative 40S ribosomal protein S15A
11 4 5 1 RAFL11-06-P03 BT000446 Experimental RAFL11-06-P03 AV819758;AV832235;BT000446 P-Protein - like protein
11 4 5 2 RAFL11-06-J02 BT000435 Experimental RAFL11-06-J02 AV819708;AV832223;BT000435 putative protein
11 4 5 3 RAFL11-06-B02 AY054591 Experimental RAFL11-06-B02 AV819628;AV832204;AY054591 unknown protein
11 4 5 4 RAFL11-05-D24 AV819501 Experimental RAFL11-05-D24 AV819501 putative protein
11 4 5 5 RAFL11-05-H23 AV819539 Experimental RAFL11-05-H23 AV819539 monosaccharide transporter STP3
11 4 5 6 RAFL11-05-P21 AY081290 Experimental RAFL11-05-P21 AV819619;AV832202;AY081290 unknown protein
11 4 5 7 RAFL09-18-D16 AV827682 Experimental RAFL09-18-D16 AV798976;AV827682;AF360174 putative protein
11 4 5 8 RAFL09-18-E15 AV827686 Experimental RAFL09-18-E15 AV798992;AV827686;AF360155 peptide transport - like protein
11 4 5 9 RAFL09-18-E14 AV827685 Experimental RAFL09-18-E14 AV798991;AV827685;AF360299 unknown protein
11 4 5 10 RAFL09-18-B14 AV798939 Experimental RAFL09-18-B14 AV798939 unknown protein
11 4 5 11 RAFL09-18-G13 AV827697 Experimental RAFL09-18-G13 AV799025;AV827697;AF360250 putative 4-coumarate:CoA ligase
11 4 5 12 RAFL09-18-B13 AV827671 Experimental RAFL09-18-B13 AV798938;AV827671;AF360202 glycine-rich protein 2 (GRP2)
11 4 5 13 RAFL09-18-H07 AY035116 Experimental RAFL09-18-H07 AV799040;AV827703;AY035116 Strong similarity to glycoprotein EP1
11 4 5 14 RAFL09-18-H05 BT000687 Experimental RAFL09-18-H05 AV799038;AV827701;BT000687 translation elongation factor EF-Tu precursor, chloroplast
11 4 6 1 RAFL11-07-O15 AV819899 Experimental RAFL11-07-O15 AV819899 recombination signal sequence recognition protein, putative
11 4 6 2 RAFL11-07-D14 AV819801 Experimental RAFL11-07-D14 AV819801 putative protein
11 4 6 3 RAFL11-07-L07 AY054554 Experimental RAFL11-07-L07 AV819873;AV832257;AY054554 Unknown protein (MXE10.5)
11 4 6 4 RAFL11-07-J05 AY065189 Experimental RAFL11-07-J05 AV819855;AV832254;AY065189 putative lectin
11 4 6 5 RAFL11-07-N02 BP562655 Experimental RAFL11-07-N02 AV819887;BP562655;AY054588
11 4 6 6 RAFL11-07-F02 AV832248 Experimental RAFL11-07-F02 AV819816;AV832248;AF386926 3-methylcrotonyl-CoA carboxylase non-biotinylated subunit (MCCB)
11 4 6 7 RAFL11-07-L01 BP562654 Experimental RAFL11-07-L01 AV819871;BP562654;AY065107 putative bHLH transcription factor (bHLH121)
11 4 6 8 RAFL11-06-C24 BP562647 Experimental RAFL11-06-C24 AV819653;BP562647;AF386925 actin depolymerizing factor 2 (ADF2)
11 4 6 9 RAFL11-06-N14 AY120735 Experimental RAFL11-06-N14 AV819745;AV832232;AY120735 1,4-benzoquinone reductase-like; Trp repressor binding protein-like
11 4 6 10 RAFL11-06-H13 AY054584 Experimental RAFL11-06-H13 AV819691;AV832216;AY054584
11 4 6 11 RAFL11-06-I12 AV832221 Experimental RAFL11-06-I12 AV819703;AV832221;AF370493 SKP1-like protein
11 4 6 12 RAFL11-06-P11 AY042814 Experimental RAFL11-06-P11 AV819760;AV832236;AY042814 adenylate translocator
11 4 6 13 RAFL11-06-I11 BP562649 Experimental RAFL11-06-I11 AV819702;BP562649;AY042812
11 4 6 14 RAFL11-06-N10 AV819742 Experimental RAFL11-06-N10 AV819742 unknown protein
11 4 7 11 RAFL11-07-H22 AV832252 Experimental RAFL11-07-H22 AV819842;AV832252;AF386928 putative endoxyloglucan glycosyltransferase
11 4 7 12 RAFL11-07-B21 AY065103 Experimental RAFL11-07-B21 AV819778;AV832239;AY065103 ribosomal protein, putative
11 4 7 13 RAFL11-07-B20 BT002376 Experimental RAFL11-07-B20 AV819777;BT002376 hypothetical protein, 5' partial
11 4 7 14 RAFL11-07-G17 AY042792 Experimental RAFL11-07-G17 AV819831;AV832251;AY042792 translin-like protein
12 1 1 1 RAFL09-13-N17 AV827309 Experimental RAFL09-13-N17 AV797809;AV827309;AF361819
12 1 1 2 RAFL09-13-F17 AV827280 Experimental RAFL09-13-F17 AV797734;AV827280
12 1 1 3 RAFL09-13-O16 AV827311 Experimental RAFL09-13-O16 AV797820;AV827311;AF367261 PRLI-interacting factor L
12 1 1 4 RAFL09-13-D16 AV827268 Experimental RAFL09-13-D16 AV797712;AV827268;AF361800
12 1 1 5 RAFL09-13-P12 AV827316 Experimental RAFL09-13-P12 AV797829;AV827316;AF361834
12 1 1 6 RAFL09-13-A12 AV827255 Experimental RAFL09-13-A12 AV797672;AV827255;AF361813 putative protein
12 1 1 7 RAFL09-13-F11 AV827278 Experimental RAFL09-13-F11 AV797730;AV827278;AF361822 elongation factor 1-alpha
12 1 1 8 RAFL09-13-I10 AV827294 Experimental RAFL09-13-I10 AV797761;AV827294;AF367280
12 1 1 9 RAFL09-13-B10 BP561702 Experimental RAFL09-13-B10 AV797685;BP561702;AF367263 IAA18 early auxin-induced protein
12 1 1 10 RAFL09-13-F09 BP561704 Experimental RAFL09-13-F09 AV797729;BP561704;AF367253 MAP kinase like protein
12 1 1 11 RAFL09-13-P05 AY094402 Experimental RAFL09-13-P05 AV797824;AV827313;AY094402 phytochelatin synthetase - like predicted GPI-anchored protein
12 1 1 12 RAFL09-13-I05 AV827292 Experimental RAFL09-13-I05 AV797758;AV827292;AF367288 NADPH-ferrihemoprotein reductase (ATR2)
12 1 1 13 RAFL09-13-F05 AV827277 Experimental RAFL09-13-F05 AV797727;AV827277;AF361824 Peter Pan - like protein
12 1 1 14 RAFL09-13-P04 AV827312 Experimental RAFL09-13-P04 AV797823;AV827312;AF367278
12 1 2 1 RAFL09-17-H05 AY035110 Experimental RAFL09-17-H05 AV798760;AV827602;AY035110 putative receptor-like protein kinase, ERECTA
12 1 2 2 RAFL09-17-P04 AV827659 Experimental RAFL09-17-P04 AV798900;AV827659 putative beta-1,4-N-acetylglucosaminyltransferase
12 1 2 3 RAFL09-17-A04 AY039916 Experimental RAFL09-17-A04 AV798642;AV827568;AY039916 unknown protein
12 1 2 4 RAFL09-17-N03 AV827644 Experimental RAFL09-17-N03 AV798866;AV827644 hypothetical protein
12 1 2 5 RAFL09-17-M02 AV827636 Experimental RAFL09-17-M02 AV798845;AV827636 putative protein
12 1 2 6 RAFL09-17-J02 AV827619 Experimental RAFL09-17-J02 AV798791;AV827619;AF360186 amino acid transporter-like protein
12 1 2 7 RAFL09-16-J23 AV827538 Experimental RAFL09-16-J23 AV798539;AV827538 DnaJ-like protein
12 1 2 8 RAFL09-16-C23 BT000769 Experimental RAFL09-16-C23 AV798418;BT000769
12 1 2 9 RAFL09-16-G22 AV827522 Experimental RAFL09-16-G22 AV798487;AV827522 acetolactate synthase-like protein
12 1 2 10 RAFL09-16-P21 BP561740 Experimental RAFL09-16-P21 AV798638;BP561740;AY091152
12 1 2 11 RAFL09-16-J21 AY035086 Experimental RAFL09-16-J21 AV798537;AV827537;AY035086 alanine aminotransferase (ALAAT2)
12 1 2 12 RAFL09-16-G21 AV827521 Experimental RAFL09-16-G21 AV798486;AV827521;AF360183 fasciclin-like arabinogalactan protein FLA11
12 1 2 13 RAFL09-13-C19 AV797703 Experimental RAFL09-13-C19 AV797703;AF367292 teosinte branched1 like protein
12 1 2 14 RAFL09-13-H18 AV827290 Experimental RAFL09-13-H18 AV797750;AV827290;AF361809 unknown protein
12 1 3 1 RAFL11-03-K20 AY042810 Experimental RAFL11-03-K20 AV819314;AV832134;AY042810 unknown protein
12 1 3 2 RAFL11-03-L19 AY042799 Experimental RAFL11-03-L19 AV819322;AY042799 putative chloroplast RNA binding protein precursor
12 1 3 3 RAFL09-17-A15 AY035113 Experimental RAFL09-17-A15 AV798651;AY035113 nodulin-like protein
12 1 3 4 RAFL09-17-M14 AV827639 Experimental RAFL09-17-M14 AV798854;AV827639;AF360146 60S ribosomal protein L10A
12 1 3 5 RAFL09-17-B14 AY035047 Experimental RAFL09-17-B14 AV798667;AV827574;AY035047
12 1 3 6 RAFL09-17-N13 AV827647 Experimental RAFL09-17-N13 AV798873;AV827647;AF360283 DNA-damage-inducible like protein P
12 1 3 7 RAFL09-17-F13 AV827594 Experimental RAFL09-17-F13 AV798735;AV827594;AF360242 MAP protein kinase like protein
12 1 3 8 RAFL09-17-L12 AV827633 Experimental RAFL09-17-L12 AV798834;AV827633;AF360192 putative adenosine-5'-phosphosulfate reductase
12 1 3 9 RAFL09-17-O09 AV827652 Experimental RAFL09-17-O09 AV798889;AV827652;AF360164 ADP-ribosylation factor 1 like protein
12 1 3 10 RAFL09-17-J09 AV827621 Experimental RAFL09-17-J09 AV798798;AV827621
12 1 3 11 RAFL09-17-D09 AV827581 Experimental RAFL09-17-D09 AV798696;AV827581;AF370142
12 1 3 12 RAFL09-17-A09 AV827571 Experimental RAFL09-17-A09 AV798647;AV827571;AF360279 acetyl-CoA carboxylase
12 1 3 13 RAFL09-17-E08 AV827588 Experimental RAFL09-17-E08 AV798712;AV827588;AF360239 putative ER lumen protein retaining receptor
12 1 3 14 RAFL09-17-A08 AV827570 Experimental RAFL09-17-A08 AV798646;AV827570;AF360188 putative dioxygenase
12 1 4 1 RAFL11-05-A06 AV832173 Experimental RAFL11-05-A06 AV819456;AV832173 unknown protein
12 1 4 2 RAFL11-05-B05 BP562644 Experimental RAFL11-05-B05 AV819465;BP562644;AY128378 hypothetical protein
12 1 4 3 RAFL11-05-B04 AV832175 Experimental RAFL11-05-B04 AV819464;AV832175 putative ribonuclease, RNS2
12 1 4 4 RAFL11-05-N03 AV832193 Experimental RAFL11-05-N03 AV819591;AV832193 putative ribosomal protein L13
12 1 4 5 RAFL11-04-F18 AV819391 Experimental RAFL11-04-F18 AV819391 unknown protein
12 1 4 6 RAFL11-04-L15 BT000472 Experimental RAFL11-04-L15 AV819430;AV832169;BT000472 unknown
12 1 4 7 RAFL11-04-L14 AY065105 Experimental RAFL11-04-L14 AV819429;AV832168;AY065105
12 1 4 8 RAFL11-04-K11 AY059832 Experimental RAFL11-04-K11 AV819421;AV832164;AY059832 berberine bridge enzyme-like protein
12 1 4 9 RAFL11-04-J10 AV819414 Experimental RAFL11-04-J10 AV819414 putative pectinesterase
12 1 4 10 RAFL11-04-L09 AV819428 Experimental RAFL11-04-L09 AV819428 unknown protein
12 1 4 11 RAFL11-04-H03 AY120740 Experimental RAFL11-04-H03 AV819399;AV832155;AY120740 proteasome regulatory subunit S3 like protein
12 1 4 12 RAFL11-04-J02 AV832161 Experimental RAFL11-04-J02 AV819410;AV832161;AF370519
12 1 4 13 RAFL11-04-K01 AV832163 Experimental RAFL11-04-K01 AV819418;AV832163;AF370467 putative protein
12 1 4 14 RAFL11-03-K23 AV832135 Experimental RAFL11-03-K23 AV819315;AV832135
12 1 5 1 RAFL11-12-B03 AY136288 Experimental RAFL11-12-B03 AV820748;AV832337;AY136288 selenium-binding protein (Z97335.13)
12 1 5 2 RAFL11-12-C02 AV820762 Experimental RAFL11-12-C02 AV820762
12 1 5 3 RAFL11-11-M22 AY093031 Experimental RAFL11-11-M22 AV820701;AV832329;AY093031 unknown protein
12 1 5 4 RAFL11-11-P21 BP562667 Experimental RAFL11-11-P21 AV820736;BP562667 somatic embryogenesis receptor-like kinase 3 (SERK3)
12 1 5 5 RAFL11-11-L21 AV832327 Experimental RAFL11-11-L21 AV820686;AV832327 putative protein
12 1 5 6 RAFL11-11-K20 BT002445 Experimental RAFL11-11-K20 AV820674;BT002445 unknown protein
12 1 5 7 RAFL11-05-B21 AV819474 Experimental RAFL11-05-B21 AV819474 ribosomal protein L17 -like protein
12 1 5 8 RAFL11-05-J20 AY128367 Experimental RAFL11-05-J20 AV819556;AV832190;AY128367 hypothetical protein
12 1 5 9 RAFL11-05-P19 AY065106 Experimental RAFL11-05-P19 AV819618;AY065106 putative protein
12 1 5 10 RAFL11-05-I19 AY054542 Experimental RAFL11-05-I19 AV819550;AV832189;AY054542 vegetative storage protein-like
12 1 5 11 RAFL11-05-N18 AY120745 Experimental RAFL11-05-N18 AV819598;AV832195;AY120745 putative electron transfer flavoprotein ubiquinone oxidoreductase
12 1 5 12 RAFL11-05-D17 BT002378 Experimental RAFL11-05-D17 AV819498;BT002378
12 1 5 13 RAFL11-05-N07 AV832194 Experimental RAFL11-05-N07 AV819593;AV832194
12 1 5 14 RAFL11-05-D07 AY054541 Experimental RAFL11-05-D07 AV819493;AV832178;AY054541 unknown protein
12 1 6 2 RAFL11-13-N22 AY093020 Experimental RAFL11-13-N22 AV821066;AV832380;AY093020 hypothetical protein
12 1 6 3 RAFL11-13-M08 AY093038 Experimental RAFL11-13-M08 AV821050;AY093038 putative protein
12 1 6 4 RAFL11-13-G06 AY093037 Experimental RAFL11-13-G06 AV820977;AV832371;AY093037 ribitol dehydrogenase-like
12 1 6 5 RAFL11-13-H03 AY093018 Experimental RAFL11-13-H03 AV820990;AV832374;AY093018 unknown protein
12 1 6 6 RAFL11-13-L02 AY136298 Experimental RAFL11-13-L02 AV821040;AV832378;AY136298 putative RNA-binding protein
12 1 6 7 RAFL11-13-L01 AY093036 Experimental RAFL11-13-L01 AV821039;AV832377;AY093036 mitochondrial ribosomal protein S14
12 1 6 8 RAFL11-12-J24 AY136297 Experimental RAFL11-12-J24 AV820848;AV832355;AY136297 unknown protein
12 1 6 9 RAFL11-12-C18 AY136294 Experimental RAFL11-12-C18 AV820769;AV832343;AY136294 putative 4-hydroxyphenylpyruvate dioxygenase (HPD)
12 1 6 10 RAFL11-12-C17 AY093016 Experimental RAFL11-12-C17 AV820768;AY093016 putative CCCH-type zinc finger protein
12 1 6 11 RAFL11-12-N14 AV820886 Experimental RAFL11-12-N14 AV820886 secretory carrier membrane protein, putative
12 1 6 12 RAFL11-12-B14 AY072365 Experimental RAFL11-12-B14 AV820757;AV832339;AY072365 vacuolar-type H+-ATPase subunit G1 (VHA-G1 / AVMA10)
12 1 6 13 RAFL11-12-E12 AY136292 Experimental RAFL11-12-E12 AV820790;AY136292
12 1 6 14 RAFL11-12-J10 AV832354 Experimental RAFL11-12-J10 AV820841;AV832354 putative protein kinase
12 2 1 1 RAFL09-11-B18 AV827081 Experimental RAFL09-11-B18 AV797185;AV827081;AF361592 seed maturation protein, putative
12 2 1 2 RAFL09-11-P17 BP561688 Experimental RAFL09-11-P17 AV797402;BP561688;AY065035 putative protein
12 2 1 3 RAFL09-11-L17 BP561687 Experimental RAFL09-11-L17 AV797342;BP561687;AY094392 unknown protein
12 2 1 4 RAFL09-11-D17 AY126991 Experimental RAFL09-11-D17 AV797216;AY126991 phosphoglycerate kinase like protein
12 2 1 5 RAFL09-11-O13 AV827154 Experimental RAFL09-11-O13 AV797386;AV827154;AF367356 unknown protein
12 2 1 6 RAFL09-11-D13 AV827093 Experimental RAFL09-11-D13 AV797214;AV827093;AF367347 putative cytochrome P450
12 2 1 7 RAFL09-11-O12 AV827153 Experimental RAFL09-11-O12 AV797385;AV827153;AF361590 unknown protein
12 2 1 8 RAFL09-11-J12 AV827126 Experimental RAFL09-11-J12 AV797307;AV827126;AF367341 succinate dehydrogenase flavoprotein alpha subunit (emb|CAA05025.1)
12 2 1 9 RAFL09-11-H12 AV827111 Experimental RAFL09-11-H12 AV797271;AV827111;AF361586 unknown protein
12 2 1 10 RAFL09-11-I11 AV827118 Experimental RAFL09-11-I11 AV797290;AV827118;AF361573 ABC transporter like protein
12 2 1 11 RAFL09-11-A09 AV827076 Experimental RAFL09-11-A09 AV797161;AV827076;AF361605 UDP-glucose pyrophosphorylase like protein
12 2 1 12 RAFL09-11-H08 AY045632 Experimental RAFL09-11-H08 AV797269;AV827110;AY045632 serine protein kinase - like
12 2 1 13 RAFL09-11-C08 AV827085 Experimental RAFL09-11-C08 AV797194;AV827085;AF361591 putative protein
12 2 1 14 RAFL09-11-K07 AV827132 Experimental RAFL09-11-K07 AV797319;AV827132;AF367338 receptor like kinase like protein
12 2 2 1 RAFL09-15-D08 AV827415 Experimental RAFL09-15-D08 AV798163;AV827415;AF360162 putative protein
12 2 2 2 RAFL09-15-O07 AY045780 Experimental RAFL09-15-O07 AV798343;AV827474;AY045780 fimbrin
12 2 2 3 RAFL09-15-K07 AY035045 Experimental RAFL09-15-K07 AV798274;AV827454;AY035045 myo-inositol-1-phosphate synthase
12 2 2 4 RAFL09-15-E07 AV827420 Experimental RAFL09-15-E07 AV798179;AV827420;AF360277 putative 11-zinc finger protein
12 2 2 5 RAFL09-15-A07 AV827403 Experimental RAFL09-15-A07 AV798115;AV827403;AF360235 unknown protein
12 2 2 6 RAFL09-15-M06 BP561733 Experimental RAFL09-15-M06 AV798310;BP561733;AF360185
12 2 2 7 RAFL09-15-D03 AV827414 Experimental RAFL09-15-D03 AV798159;AV827414;AF360332 putative protein
12 2 2 8 RAFL09-15-G02 AY064052 Experimental RAFL09-15-G02 AV798210;AV827431;AY064052 putative protein
12 2 2 9 RAFL09-15-K01 AV827450 Experimental RAFL09-15-K01 AV798269;AV827450;AF360346 putative N-acetylornithine deacetylase
12 2 2 10 RAFL09-15-F01 AV827424 Experimental RAFL09-15-F01 AV798190;AV827424;AF360275 unknown protein
12 2 2 11 RAFL09-15-B01 AY035085 Experimental RAFL09-15-B01 AV798127;AV827408;AY035085 putative protein transport factor
12 2 2 12 RAFL09-14-N23 AV827391 Experimental RAFL09-14-N23 AV798077;AV827391;AF360182 unknown protein
12 2 2 13 RAFL09-11-J19 AV827127 Experimental RAFL09-11-J19 AV797310;AV827127;AF361598
12 2 2 14 RAFL09-11-M18 AV827145 Experimental RAFL09-11-M18 AV797357;AV827145;AF367346 putative WD-40 repeat protein
12 2 3 1 RAFL09-18-M09 AV827729 Experimental RAFL09-18-M09 AV799119;AV827729;AF370478 endopeptidase - like protein
12 2 3 2 RAFL09-18-P08 AY120726 Experimental RAFL09-18-P08 AV799169;AV827744;AY120726 putative protein
12 2 3 3 RAFL09-15-C19 BP561727 Experimental RAFL09-15-C19 AV798153;BP561727;AF360167
12 2 3 4 RAFL09-15-I18 AY035067 Experimental RAFL09-15-I18 AV798254;AY035067 ATP-citrate lyase subunit B
12 2 3 5 RAFL09-15-D18 AY035046 Experimental RAFL09-15-D18 AV798170;AY035046 CBL-interacting protein kinase 6 (CIPK6)
12 2 3 6 RAFL09-15-P17 AV798367 Experimental RAFL09-15-P17 AV798367;AF360282 Phospholipase like protein
12 2 3 7 RAFL09-15-K17 AV798281 Experimental RAFL09-15-K17 AV798281;AF360241 transporter-like protein
12 2 3 8 RAFL09-15-P16 AV827479 Experimental RAFL09-15-P16 AV798366;AV827479;AF360191 unknown protein
12 2 3 9 RAFL09-15-D15 AY035112 Experimental RAFL09-15-D15 AV798169;AV827417;AY035112 Erd1 protein precursor (sp|P42762)
12 2 3 10 RAFL09-15-P14 AV827478 Experimental RAFL09-15-P14 AV798364;AV827478;AF370200 arginine tRNA like protein transferase
12 2 3 11 RAFL09-15-K14 AV827456 Experimental RAFL09-15-K14 AV798278;AV827456;AF360349 unknown protein
12 2 3 12 RAFL09-15-M13 AV827466 Experimental RAFL09-15-M13 AV798313;AV827466;AF360278 MLH1 protein
12 2 3 13 RAFL09-15-K12 AV827455 Experimental RAFL09-15-K12 AV798276;AV827455;AF360238 spindle pole body protein-like
12 2 3 14 RAFL09-15-F12 AY035080 Experimental RAFL09-15-F12 AV798199;AV827426;AY035080 ribonucleoside-diphosphate reductase large subunit
12 2 4 1 RAFL11-01-B06 AY059830 Experimental RAFL11-01-B06 AV818863;AV832026;AY059830 unknown protein
12 2 4 2 RAFL11-01-N05 AV832060 Experimental RAFL11-01-N05 AV819012;AV832060 cytochrome c oxidase subunit - like
12 2 4 3 RAFL11-01-E05 AY054560 Experimental RAFL11-01-E05 AV818900;AV832037;AY054560 unknown protein
12 2 4 4 RAFL11-01-O04 AV832066 Experimental RAFL11-01-O04 AV819022;AV832066 putative protein
12 2 4 5 RAFL09-18-L22 AV827725 Experimental RAFL09-18-L22 AV799114;AV827725 phosphoglycerate kinase like protein
12 2 4 6 RAFL09-18-J20 AY054557 Experimental RAFL09-18-J20 AV799081;AV827717;AY054557 putative histone H2A
12 2 4 7 RAFL09-18-P19 AV827751 Experimental RAFL09-18-P19 AV799178;AV827751;AF370502 unknown protein
12 2 4 8 RAFL09-18-P18 AY042819 Experimental RAFL09-18-P18 AV799177;AV827750;AY042819 acetolactate synthase
12 2 4 9 RAFL09-18-K18 AY042817 Experimental RAFL09-18-K18 AV799095;AV827719;AY042817 Unknown protein (MXL8.2)
12 2 4 10 RAFL09-18-H18 AV799050 Experimental RAFL09-18-H18 AV799050
12 2 4 11 RAFL09-18-M12 AY054556 Experimental RAFL09-18-M12 AV799121;AV827731;AY054556 anthranilate N-hydroxycinnamoyl/benzoyltransferase-like protein
12 2 4 12 RAFL09-18-P11 AV827746 Experimental RAFL09-18-P11 AV799172;AV827746;AF370511 unknown protein
12 2 4 13 RAFL09-18-I11 AY120736 Experimental RAFL09-18-I11 AV799062;AY120736 Strong similarity to glycoprotein EP1
12 2 4 14 RAFL09-18-M10 AV827730 Experimental RAFL09-18-M10 AV799120;AV827730;AF370495 Unknown protein
12 2 5 7 RAFL11-01-F14 AV818919 Experimental RAFL11-01-F14 AV818919 unknown protein
12 2 5 8 RAFL11-01-M13 BT002377 Experimental RAFL11-01-M13 AV819003;AV832059;BT002377 putative protein
12 2 5 9 RAFL11-01-F13 BT001985 Experimental RAFL11-01-F13 AV818918;AV832043;BT001985 phytosulfokine precursor like protein (AtPSKL)
12 2 5 10 RAFL11-01-P12 AY054564 Experimental RAFL11-01-P12 AV819032;AV832068;AY054564 unknown protein
12 2 5 11 RAFL11-01-L12 AV832056 Experimental RAFL11-01-L12 AV818989;AV832056 putative ferrochelatase precusor
12 2 5 12 RAFL11-01-K11 AY120738 Experimental RAFL11-01-K11 AV818978;AV832052;AY120738 receptor like protein kinase
12 2 5 13 RAFL11-01-H06 AV818940 Experimental RAFL11-01-H06 AV818940 mrp protein, putative
12 2 5 14 RAFL11-01-D06 AV832032 Experimental RAFL11-01-D06 AV818884;AV832032 unknown protein
12 2 7 11 RAFL11-09-J03 AV820307 Experimental RAFL11-09-J03 AV820307 ribosomal protein L17 -like protein
12 2 7 12 RAFL11-09-B02 AY072364 Experimental RAFL11-09-B02 AV820210;AY072364 nicotianamine synthase (dbj|BAA74589.1)
12 2 7 13 RAFL11-09-J01 AY072363 Experimental RAFL11-09-J01 AV820306;AY072363 unknown protein
12 3 1 1 RAFL09-13-O14 BP561711 Experimental RAFL09-13-O14 AV797818;BP561711;AF361817 sugar kinase, putative
12 3 1 2 RAFL09-13-L14 AV827301 Experimental RAFL09-13-L14 AV797783;AV827301;AF367274 putative protein
12 3 1 3 RAFL09-13-M13 AV797796 Experimental RAFL09-13-M13 AV797796;AF367262 TCH4 protein (gb|AAA92363.1)
12 3 1 4 RAFL09-13-D13 AV827267 Experimental RAFL09-13-D13 AV797711;AV827267;AF361804 NAM (no apical meristem)-like protein
12 3 1 5 RAFL09-13-P08 AV827315 Experimental RAFL09-13-P08 AV797827;AV827315;AF361829 pectinesterase like protein
12 3 1 6 RAFL09-13-E08 AV827271 Experimental RAFL09-13-E08 AV797716;AV827271;AF361812
12 3 1 7 RAFL09-13-D07 AY094403 Experimental RAFL09-13-D07 AV797708;AV827265;AY094403 arginine decarboxylase (spe2)
12 3 1 8 RAFL09-13-N06 BP561709 Experimental RAFL09-13-N06 AV797804;BP561709;AF367276 unknown protein
12 3 1 9 RAFL09-13-I06 AV827293 Experimental RAFL09-13-I06 AV797759;AV827293;AF367270 teosinte branched1 like protein
12 3 1 10 RAFL09-13-E06 AV827270 Experimental RAFL09-13-E06 AV797715;AV827270;AF367256 putative DnaJ protein
12 3 1 11 RAFL09-13-F03 AV827275 Experimental RAFL09-13-F03 AV797725;AV827275;AF361836 putative glutamate decarboxylase
12 3 1 12 RAFL09-13-H02 AV827287 Experimental RAFL09-13-H02 AV797747;AV827287;AF361810 unknown protein
12 3 1 13 RAFL09-13-L01 AV827299 Experimental RAFL09-13-L01 AV797779;AV827299;AF361815 translationally controlled tumor protein-like protein
12 3 1 14 RAFL09-13-F01 AV827274 Experimental RAFL09-13-F01 AV797724;AV827274;AF367273 COPPER-TRANSPORTING ATPASE RAN1 (RESPONSIVE-TO-ANTAGONIST 1)
12 3 2 1 RAFL09-17-D02 AV827580 Experimental RAFL09-17-D02 AV798691;AV827580;AF360334 ABC transporter-like protein
12 3 2 2 RAFL09-17-J01 AV827618 Experimental RAFL09-17-J01 AV798790;AV827618;AF360315 putative ubiquitin carboxyl terminal hydrolase
12 3 2 3 RAFL09-17-E01 AV827585 Experimental RAFL09-17-E01 AV798708;AV827585 putative protein
12 3 2 4 RAFL09-16-K24 AV798559 Experimental RAFL09-16-K24 AV798559;AF370135 unknown protein
12 3 2 5 RAFL09-16-G24 BP561738 Experimental RAFL09-16-G24 AV798489;BP561738 isp4 like protein
12 3 2 6 RAFL09-16-D24 AY035078 Experimental RAFL09-16-D24 AV798433;AV827503;AY035078 unknown protein
12 3 2 7 RAFL09-16-B21 AV827491 Experimental RAFL09-16-B21 AV798403;AV827491;AF360331 unknown protein
12 3 2 8 RAFL09-16-M20 AV827554 Experimental RAFL09-16-M20 AV798591;AV827554;AF360313 auxin response transcription factor 3 (ETTIN/ARF3)
12 3 2 9 RAFL09-16-F20 AV827514 Experimental RAFL09-16-F20 AV798468;AV827514 unknown protein
12 3 2 10 RAFL09-16-B20 AY035035 Experimental RAFL09-16-B20 AV798402;AY035035 unknown protei
12 3 2 11 RAFL09-16-J19 AV798535 Experimental RAFL09-16-J19 AV798535;AF360233 putative histidine decarboxylase
12 3 2 12 RAFL09-16-A18 AV827484 Experimental RAFL09-16-A18 AV798385;AV827484;AF360181 unknown protein
12 3 2 13 RAFL09-13-P15 AV827317 Experimental RAFL09-13-P15 AV797832;AV827317;AF367293 beta-amylase, putative
12 3 2 14 RAFL09-13-F15 AV827279 Experimental RAFL09-13-F15 AV797732;AV827279;AF367286 ARE1-like protein
12 3 3 1 RAFL11-03-D14 AV832122 Experimental RAFL11-03-D14 AV819258;AV832122;AF370488 putative lectin
12 3 3 2 RAFL11-03-M12 AY042796 Experimental RAFL11-03-M12 AV819327;AY042796
12 3 3 3 RAFL09-17-H12 AV827604 Experimental RAFL09-17-H12 AV798765;AV827604;AF360166 putative protein
12 3 3 4 RAFL09-17-D12 AV827582 Experimental RAFL09-17-D12 AV798697;AV827582;AF360145 unknown protein
12 3 3 5 RAFL09-17-M11 BT000799 Experimental RAFL09-17-M11 AV798851;AV827638;BT000799 putative cold-acclimation protein
12 3 3 6 RAFL09-17-E11 AV827589 Experimental RAFL09-17-E11 AV798715;AV827589;AF360281 unknown protein
12 3 3 7 RAFL09-17-M10 BP561749 Experimental RAFL09-17-M10 AV798850;BP561749;AY045778 unknown protein
12 3 3 8 RAFL09-17-I10 AV827612 Experimental RAFL09-17-I10 AV798781;AV827612;AF360190 putative serine/threonine-protein kinase
12 3 3 9 RAFL09-17-M07 AV827637 Experimental RAFL09-17-M07 AV798848;AV827637;AF360163 unknown protein
12 3 3 10 RAFL09-17-E07 AV827587 Experimental RAFL09-17-E07 AV798711;AV827587;AF370145 unknown protein
12 3 3 11 RAFL09-17-A07 AV827569 Experimental RAFL09-17-A07 AV798645;AV827569;AF360348 myrosinase TGG2
12 3 3 12 RAFL09-17-K06 AY035036 Experimental RAFL09-17-K06 AV798813;AV827627;AY035036 putative jasmonate inducible protein
12 3 3 13 RAFL09-17-B06 AV827572 Experimental RAFL09-17-B06 AV798660;AV827572;AF360237 unknown protein
12 3 3 14 RAFL09-17-L05 AV798829 Experimental RAFL09-17-L05 AV798829;AF360187 putative pseudouridine synthase
12 3 4 1 RAFL11-04-E24 AV832152 Experimental RAFL11-04-E24 AV819386;AV832152 F15N24.6
12 3 4 2 RAFL11-04-H23 AV819404 Experimental RAFL11-04-H23 AV819404 unknown protein
12 3 4 3 RAFL11-04-K22 AV832166 Experimental RAFL11-04-K22 AV819424;AV832166 unknown protein
12 3 4 4 RAFL11-04-I21 AY128366 Experimental RAFL11-04-I21 AV819407;AV832158;AY128366 cytidine deaminase 1 (cda1)
12 3 4 5 RAFL11-04-C09 AY062636 Experimental RAFL11-04-C09 AV819369;AV832146;AY062636 UTP-glucose glucosyltransferase
12 3 4 6 RAFL11-04-E07 AY120729 Experimental RAFL11-04-E07 AV819379;AV832149;AY120729 unknown protein
12 3 4 7 RAFL11-04-M06 AV832170 Experimental RAFL11-04-M06 AV819431;AV832170
12 3 4 8 RAFL11-04-J05 AY042788 Experimental RAFL11-04-J05 AV819412;AV832162;AY042788 Ara4-interacting protein (SAY1)
12 3 4 9 RAFL11-04-P04 AY128377 Experimental RAFL11-04-P04 AV819448;AY128377 adenine phosphoribosyltransferase 1, APRT
12 3 4 10 RAFL11-04-I04 AV819406 Experimental RAFL11-04-I04 AV819406 eukaryotic release factor 1 homolog (eRF1)
12 3 4 11 RAFL11-03-B18 AV832117 Experimental RAFL11-03-B18 AV819245;AV832117;AF370510 Unknown protein (T22H22.5)
12 3 4 12 RAFL11-03-C17 AY128364 Experimental RAFL11-03-C17 AV819252;AV832120;AY128364 phosphomethylpyrimidine kinase
12 3 4 13 RAFL11-03-M16 AY120744 Experimental RAFL11-03-M16 AV819331;AV832139;AY120744 unknown
12 3 4 14 RAFL11-03-E16 BP562639 Experimental RAFL11-03-E16 AV819264;BP562639;AY054538 putative protein
12 3 5 1 RAFL11-11-C18 AY093029 Experimental RAFL11-11-C18 AV820577;AV832312;AY093029 protein serine/threonine kinase-like protein
12 3 5 2 RAFL11-11-K16 AV832326 Experimental RAFL11-11-K16 AV820670;AV832326 GTL1 - like protein
12 3 5 3 RAFL11-11-K15 AV832325 Experimental RAFL11-11-K15 AV820669;AV832325 hypothetical protein
12 3 5 4 RAFL11-11-O14 AY093035 Experimental RAFL11-11-O14 AV820723;AV832333;AY093035 sugar transporter like protein
12 3 5 5 RAFL11-11-H13 AY072353 Experimental RAFL11-11-H13 AV820630;AV832320;AY072353 putative xyloglucan endotransglycosylase
12 3 5 6 RAFL11-11-J12 AV832324 Experimental RAFL11-11-J12 AV820655;AV832324 puative protein
12 3 5 7 RAFL11-05-P15 AV832201 Experimental RAFL11-05-P15 AV819616;AV832201
12 3 5 8 RAFL11-05-H14 AV832186 Experimental RAFL11-05-H14 AV819534;AV832186
12 3 5 9 RAFL11-05-H10 AY054569 Experimental RAFL11-05-H10 AV819532;AV832185;AY054569 unknown protein
12 3 5 10 RAFL11-05-E10 BT002375 Experimental RAFL11-05-E10 AV819504;AV832180;BT002375 hypothetical protein
12 3 5 11 RAFL11-05-C09 AY054568 Experimental RAFL11-05-C09 AV819479;AV832177;AY054568 Unknown protein (At1g78100; T11I11.4)
12 3 5 12 RAFL11-05-A09 BT002058 Experimental RAFL11-05-A09 AV819457;BP562643;BT002058 putative protein
12 3 5 13 RAFL11-05-I03 BP562646 Experimental RAFL11-05-I03 AV819543;BP562646;AY042795 GTP-binding protein ara-3
12 3 5 14 RAFL11-05-A02 AY054537 Experimental RAFL11-05-A02 AV819453;AV832172;AY054537 Unknown protein (At1g27300; F17L21.9)
12 3 6 1 RAFL11-13-B11 AY136299 Experimental RAFL11-13-B11 AV820928;AV832366;AY136299 unknown protein
12 3 6 2 RAFL11-13-H10 AV820995 Experimental RAFL11-13-H10 AV820995
12 3 6 3 RAFL11-12-K22 AY139978 Experimental RAFL11-12-K22 AV820858;AY139978 receptor like protein kinase
12 3 6 4 RAFL11-12-L21 AV832360 Experimental RAFL11-12-L21 AV820869;AV832360 ethylene-response protein, ETR1
12 3 6 5 RAFL11-12-O20 AY093017 Experimental RAFL11-12-O20 AV820899;AV832363;AY093017 putative protein
12 3 6 6 RAFL11-12-K19 BT000461 Experimental RAFL11-12-K19 AV820856;AV832356;BT000461 GTL1 - like protein
12 3 6 7 RAFL11-12-P18 AY136296 Experimental RAFL11-12-P18 AV820909;AV832365;AY136296 beta-1,3-glucanase precursor, putative
12 3 6 8 RAFL11-12-H18 AV832352 Experimental RAFL11-12-H18 AV820826;AV832352 ras-related small GTP-binding protein RAB1c
12 3 6 9 RAFL11-12-B10 AY136291 Experimental RAFL11-12-B10 AV820754;AV832338;AY136291 33 kDa polypeptide of oxygen-evolving complex (OEC) in photosystem II (emb|CAA75629.1)
12 3 6 10 RAFL11-12-O09 BP562669 Experimental RAFL11-12-O09 AV820894;BP562669;AY136317 unknown protein
12 3 6 11 RAFL11-12-F09 AV832347 Experimental RAFL11-12-F09 AV820799;AV832347 11-beta-hydroxysteroid dehydrogenase-like
12 3 6 12 RAFL11-12-J08 AV832353 Experimental RAFL11-12-J08 AV820839;AV832353 unknown protein
12 3 6 13 RAFL11-12-C05 AV832342 Experimental RAFL11-12-C05 AV820763;AV832342 endomembrane-associated protein
12 3 6 14 RAFL11-12-H04 AV832351 Experimental RAFL11-12-H04 AV820820;AV832351 ribosomal protein, putative
12 3 7 11 RAFL11-13-J19 AY136300 Experimental RAFL11-13-J19 AV821024;AY136300 50S ribosomal protein L12-C
12 3 7 12 RAFL11-13-G16 AV832373 Experimental RAFL11-13-G16 AV820982;AV832373 putative protein
12 3 7 13 RAFL11-13-K15 AV832376 Experimental RAFL11-13-K15 AV821035;AV832376 unknown
12 3 7 14 RAFL11-13-B13 AY072355 Experimental RAFL11-13-B13 AV820930;AV832367;AY072355 unknown protein
12 4 1 1 RAFL09-11-H15 AY065037 Experimental RAFL09-11-H15 AV797273;AV827112;AY065037 threonine dehydratase/deaminase (OMR1)
12 4 1 2 RAFL09-11-N14 AY045626 Experimental RAFL09-11-N14 AV797371;AV827151;AY045626 L-aspartate oxidase -like protein
12 4 1 3 RAFL09-11-K14 AV827134 Experimental RAFL09-11-K14 AV797324;AV827134;AF361584 unknown protein
12 4 1 4 RAFL09-11-F14 AY094391 Experimental RAFL09-11-F14 AV797248;AV827104;AY094391 putative protein
12 4 1 5 RAFL09-11-P10 AV827158 Experimental RAFL09-11-P10 AV797396;AV827158;AF367358 UDP-Glucose Transferase (UGT75B2)
12 4 1 6 RAFL09-11-L10 AV827138 Experimental RAFL09-11-L10 AV797338;AV827138 myrosinase TGG2
12 4 1 7 RAFL09-11-G10 AY045629 Experimental RAFL09-11-G10 AV797254;AV827106;AY045629 glycine-rich protein, putative
12 4 1 8 RAFL09-11-M09 AY065036 Experimental RAFL09-11-M09 AV797350;AV827141;AY065036 prolyl 4-hydroxylase like protein
12 4 1 9 RAFL09-11-I09 AV827117 Experimental RAFL09-11-I09 AV797288;AV827117;AF361581 unknown protein
12 4 1 10 RAFL09-11-D09 AV797212 Experimental RAFL09-11-D09 AV797212;AF361574 putative dTDP-glucose 4-6-dehydratase
12 4 1 11 RAFL09-11-I05 AV827115 Experimental RAFL09-11-I05 AV797284;AV827115;AF361604 serine carboxypeptidase II-like
12 4 1 12 RAFL09-11-E05 AV827097 Experimental RAFL09-11-E05 AV797224;AV827097;AF367344 unknown protein
12 4 1 13 RAFL09-11-B05 AY045630 Experimental RAFL09-11-B05 AV797176;AV827078;AY045630 putative protein
12 4 1 14 RAFL09-11-L03 AV827137 Experimental RAFL09-11-L03 AV797334;AV827137;AF367340 asparagine synthetase (gb|AAC72837.1)
12 4 2 1 RAFL09-15-G06 AV827432 Experimental RAFL09-15-G06 AV798214;AV827432;AF360333 unknown protein
12 4 2 2 RAFL09-15-P05 AV798358 Experimental RAFL09-15-P05 AV798358;AF360314 unknown protein
12 4 2 3 RAFL09-15-M05 AV827465 Experimental RAFL09-15-M05 AV798309;AV827465 hypothetical protein
12 4 2 4 RAFL09-15-E05 AV798177 Experimental RAFL09-15-E05 AV798177;AF360276 putative disease resistance protein
12 4 2 5 RAFL09-15-L04 AV827459 Experimental RAFL09-15-L04 AV798288;AV827459;AF360234 phosphoglycerate kinase like protein
12 4 2 6 RAFL09-15-K03 AV827451 Experimental RAFL09-15-K03 AV798270;AV827451;AF360184 putative protein
12 4 2 7 RAFL09-14-P21 AV827399 Experimental RAFL09-14-P21 AV798109;AV827399;AF360330 ribose 5-phosphate isomerase like protein
12 4 2 8 RAFL09-14-N18 AY035066 Experimental RAFL09-14-N18 AV798074;AV827389;AY035066 glucosyltransferase-like protein
12 4 2 9 RAFL09-14-O15 AY039915 Experimental RAFL09-14-O15 AV798087;AV827394;AY039915 unknown protein
12 4 2 10 RAFL09-14-P11 AV827398 Experimental RAFL09-14-P11 AV798100;AV827398;AF360274 mucin -like protein
12 4 2 11 RAFL09-14-P09 AY045777 Experimental RAFL09-14-P09 AV798098;AY045777 receptor kinase, putative
12 4 2 12 RAFL09-14-P05 AY035077 Experimental RAFL09-14-P05 AV798094;AV827397;AY035077 unknown protein
12 4 2 13 RAFL09-11-N16 AV827152 Experimental RAFL09-11-N16 AV797373;AV827152;AF361601 putative serine carboxypeptidase I
12 4 2 14 RAFL09-11-E16 AY065038 Experimental RAFL09-11-E16 AV797233;AY065038 unknown protein
12 4 3 1 RAFL09-18-K04 BP561756 Experimental RAFL09-18-K04 AV799084;BP561756;AF370521 unknown protein
12 4 3 2 RAFL09-18-L02 AY054526 Experimental RAFL09-18-L02 AV799101;AV827721;AY054526 Unknown protein
12 4 3 3 RAFL09-15-L16 AV798299 Experimental RAFL09-15-L16 AV798299;AF360165 thaumatin-like predicted GPI-anchored protein
12 4 3 4 RAFL09-15-I16 BP561732 Experimental RAFL09-15-I16 AV798253;BP561732;AF360144 unknown protein
12 4 3 5 RAFL09-15-B16 AV827410 Experimental RAFL09-15-B16 AV798137;AV827410;AF360350 unknown protein
12 4 3 6 RAFL09-15-M15 AV798314 Experimental RAFL09-15-M15 AV798314;AF360280 40S ribosomal protein S11
12 4 3 7 RAFL09-15-K15 AV798279 Experimental RAFL09-15-K15 AV798279;AF360240 beta-glucosidase like protein
12 4 3 8 RAFL09-15-G15 BP561730 Experimental RAFL09-15-G15 AV798221;BP561730;AF360189 putative protein
12 4 3 9 RAFL09-15-I11 AY035111 Experimental RAFL09-15-I11 AV798250;AV827445;AY035111 nitrate reductase (At1g37130)
12 4 3 10 RAFL09-15-F10 AV827425 Experimental RAFL09-15-F10 AV798198;AV827425;AF360143 unknown protein
12 4 3 11 RAFL09-15-N09 AV827471 Experimental RAFL09-15-N09 AV798329;AV827471;AF360347 putative protein
12 4 3 12 RAFL09-15-F09 BP561728 Experimental RAFL09-15-F09 AV798197;BP561728
12 4 3 13 RAFL09-15-P08 AV827476 Experimental RAFL09-15-P08 AV798360;AV827476;AF360236 unknown protein
12 4 3 14 RAFL09-15-I08 AY035079 Experimental RAFL09-15-I08 AV798248;AV827444;AY035079 unknown protein
12 4 4 1 RAFL11-01-B01 AV818859 Experimental RAFL11-01-B01 AV818859 60S ribosomal protein - like
12 4 4 2 RAFL09-18-M24 AY054558 Experimental RAFL09-18-M24 AV799130;AV827734;AY054558 unknown protein
12 4 4 3 RAFL09-18-H24 AY042791 Experimental RAFL09-18-H24 AV799055;AV827706;AY042791 arm repeat containing protein homolog
12 4 4 4 RAFL09-18-H23 AY054533 Experimental RAFL09-18-H23 AV799054;AV827705;AY054533 protein kinase like protein
12 4 4 5 RAFL09-18-O16 AY054531 Experimental RAFL09-18-O16 AV799160;AV827742;AY054531 putative pectinacetylesterase protein
12 4 4 6 RAFL09-18-L15 AY054530 Experimental RAFL09-18-L15 AV799110;AV827724;AY054530 unknown protein
12 4 4 7 RAFL09-18-I15 AY128374 Experimental RAFL09-18-I15 AV799063;AV827710;AY128374 putative protein
12 4 4 8 RAFL09-18-P14 AY054529 Experimental RAFL09-18-P14 AV799175;AV827749;AY054529 unknown protein
12 4 4 9 RAFL09-18-P13 AY065104 Experimental RAFL09-18-P13 AV799174;AV827748;AY065104 selenium-binding protein (Z97335.13)
12 4 4 10 RAFL09-18-L13 AV827723 Experimental RAFL09-18-L13 AV799109;AV827723;AF370516 putative protein kinase
12 4 4 11 RAFL09-18-N08 AY128373 Experimental RAFL09-18-N08 AV799137;AV827735;AY128373 putative protein
12 4 4 12 RAFL09-18-I07 AY062635 Experimental RAFL09-18-I07 AV799059;AV827709;AY062635 adenosine triphosphatase, putative, 3' partial
12 4 4 13 RAFL09-18-I06 AY120727 Experimental RAFL09-18-I06 AV799058;AY120727 calmodulin-domain protein kinase CDPK isoform 9
12 4 4 14 RAFL09-18-J05 AV827714 Experimental RAFL09-18-J05 AV799073;AV827714;AF370480 glutathione S-transferase, putative
12 4 5 7 RAFL11-01-A11 BT002047 Experimental RAFL11-01-A11 AV818853;BP562630;BT002047 unknown protein
12 4 5 8 RAFL11-01-M10 BT002036 Experimental RAFL11-01-M10 AV819000;AV832057;BT002036 unknown protein
12 4 5 9 RAFL11-01-A10 AY054562 Experimental RAFL11-01-A10 AV818852;AV832021;AY054562 putative protein
12 4 5 10 RAFL11-01-A09 AY128376 Experimental RAFL11-01-A09 AV818851;AV832020;AY128376 hypothetical protein
12 4 5 11 RAFL11-01-H08 BT002451 Experimental RAFL11-01-H08 AV818941;AV832047;BT002451 unknown protein
12 4 5 12 RAFL11-01-G07 AV818925 Experimental RAFL11-01-G07 AV818925 unknown protein
12 4 5 13 RAFL11-01-J02 BT000474 Experimental RAFL11-01-J02 AV818963;BT000474 putative ubiquinol-cytochrome C reductase complex ubiquinone-binding protein (QP-C)
12 4 5 14 RAFL11-01-F01 BP562633 Experimental RAFL11-01-F01 AV818910;BP562633;AF370470 predicted GPI-anchored protein
1 1 9 1 empty Control control_empty
1 1 9 2 empty Control control_empty
1 1 9 3 empty Control control_empty
1 1 9 4 empty Control control_empty
1 1 9 5 empty Control control_empty
1 1 9 6 empty Control control_empty
1 1 10 1 empty Control control_empty
1 1 10 2 empty Control control_empty
1 1 10 3 empty Control control_empty
1 1 10 4 empty Control control_empty
1 1 10 5 empty Control control_empty
1 1 10 6 empty Control control_empty
1 1 10 7 empty Control control_empty
1 1 10 8 empty Control control_empty
1 1 10 9 empty Control control_empty
1 1 10 10 empty Control control_empty
1 1 10 11 empty Control control_empty
1 1 10 12 empty Control control_empty
1 1 10 13 empty Control control_empty
1 1 10 14 empty Control control_empty
1 1 11 1 empty Control control_empty
1 1 11 2 empty Control control_empty
1 1 11 3 empty Control control_empty
1 1 11 4 empty Control control_empty
1 1 11 5 empty Control control_empty
1 1 11 6 empty Control control_empty
1 1 11 7 empty Control control_empty
1 1 11 8 empty Control control_empty
1 1 11 9 empty Control control_empty
1 1 11 10 empty Control control_empty
1 1 11 11 empty Control control_empty
1 1 11 12 empty Control control_empty
1 1 11 13 empty Control control_empty
1 1 11 14 empty Control control_empty
1 1 12 1 empty Control control_empty
1 1 12 2 empty Control control_empty
1 1 12 3 empty Control control_empty
1 1 12 4 empty Control control_empty
1 1 12 5 empty Control control_empty
1 1 12 6 empty Control control_empty
1 1 12 7 empty Control control_empty
1 1 12 8 empty Control control_empty
1 1 12 9 empty Control control_empty
1 1 12 10 empty Control control_empty
1 1 12 11 empty Control control_empty
1 1 12 12 empty Control control_empty
1 1 12 13 empty Control control_empty
1 1 12 14 empty Control control_empty
1 2 2 5 empty Control control_empty
1 2 2 6 empty Control control_empty
1 2 2 7 empty Control control_empty
1 2 2 8 empty Control control_empty
1 2 2 9 empty Control control_empty
1 2 2 10 empty Control control_empty
1 3 9 1 empty Control control_empty
1 3 9 2 empty Control control_empty
1 3 9 3 empty Control control_empty
1 3 9 4 empty Control control_empty
1 3 9 5 empty Control control_empty
1 3 9 6 empty Control control_empty
1 3 10 1 empty Control control_empty
1 3 10 2 empty Control control_empty
1 3 10 3 empty Control control_empty
1 3 10 4 empty Control control_empty
1 3 10 5 empty Control control_empty
1 3 10 6 empty Control control_empty
1 3 10 7 empty Control control_empty
1 3 10 8 empty Control control_empty
1 3 10 9 empty Control control_empty
1 3 10 10 empty Control control_empty
1 3 10 11 empty Control control_empty
1 3 10 12 empty Control control_empty
1 3 10 13 empty Control control_empty
1 3 10 14 empty Control control_empty
1 3 11 1 empty Control control_empty
1 3 11 2 empty Control control_empty
1 3 11 3 empty Control control_empty
1 3 11 4 empty Control control_empty
1 3 11 5 empty Control control_empty
1 3 11 6 empty Control control_empty
1 3 11 7 empty Control control_empty
1 3 11 8 empty Control control_empty
1 3 11 9 empty Control control_empty
1 3 11 10 empty Control control_empty
1 3 11 11 empty Control control_empty
1 3 11 12 empty Control control_empty
1 3 11 13 empty Control control_empty
1 3 11 14 empty Control control_empty
1 3 12 1 empty Control control_empty
1 3 12 2 empty Control control_empty
1 3 12 3 empty Control control_empty
1 3 12 4 empty Control control_empty
1 3 12 5 empty Control control_empty
1 3 12 6 empty Control control_empty
1 3 12 7 empty Control control_empty
1 3 12 8 empty Control control_empty
1 3 12 9 empty Control control_empty
1 3 12 10 empty Control control_empty
1 3 12 11 empty Control control_empty
1 3 12 12 empty Control control_empty
1 3 12 13 empty Control control_empty
1 3 12 14 empty Control control_empty
1 4 2 5 empty Control control_empty
1 4 2 6 empty Control control_empty
1 4 2 7 empty Control control_empty
1 4 2 8 empty Control control_empty
1 4 2 9 empty Control control_empty
1 4 2 10 empty Control control_empty
1 4 2 11 empty Control control_empty
3 1 9 1 empty Control control_empty
3 1 9 2 empty Control control_empty
3 1 9 3 empty Control control_empty
3 1 9 4 empty Control control_empty
3 1 9 5 empty Control control_empty
3 1 9 6 empty Control control_empty
3 1 10 1 empty Control control_empty
3 1 10 2 empty Control control_empty
3 1 10 3 empty Control control_empty
3 1 10 4 empty Control control_empty
3 1 10 5 empty Control control_empty
3 1 10 6 empty Control control_empty
3 1 10 7 empty Control control_empty
3 1 10 8 empty Control control_empty
3 1 10 9 empty Control control_empty
3 1 10 10 empty Control control_empty
3 1 10 11 empty Control control_empty
3 1 10 12 empty Control control_empty
3 1 10 13 empty Control control_empty
3 1 10 14 empty Control control_empty
3 1 11 1 empty Control control_empty
3 1 11 2 empty Control control_empty
3 1 11 3 empty Control control_empty
3 1 11 4 empty Control control_empty
3 1 11 5 empty Control control_empty
3 1 11 6 empty Control control_empty
3 1 11 7 empty Control control_empty
3 1 11 8 empty Control control_empty
3 1 11 9 empty Control control_empty
3 1 11 10 empty Control control_empty
3 1 11 11 empty Control control_empty
3 1 11 12 empty Control control_empty
3 1 11 13 empty Control control_empty
3 1 11 14 empty Control control_empty
3 1 12 1 empty Control control_empty
3 1 12 2 empty Control control_empty
3 1 12 3 empty Control control_empty
3 1 12 4 empty Control control_empty
3 1 12 5 empty Control control_empty
3 1 12 6 empty Control control_empty
3 1 12 7 empty Control control_empty
3 1 12 8 empty Control control_empty
3 1 12 9 empty Control control_empty
3 1 12 10 empty Control control_empty
3 1 12 11 empty Control control_empty
3 1 12 12 empty Control control_empty
3 1 12 13 empty Control control_empty
3 1 12 14 empty Control control_empty
3 2 2 5 empty Control control_empty
3 2 2 6 empty Control control_empty
3 2 2 7 empty Control control_empty
3 2 2 8 empty Control control_empty
3 2 2 9 empty Control control_empty
3 2 2 10 empty Control control_empty
3 3 9 1 empty Control control_empty
3 3 9 2 empty Control control_empty
3 3 9 3 empty Control control_empty
3 3 9 4 empty Control control_empty
3 3 9 5 empty Control control_empty
3 3 9 6 empty Control control_empty
3 3 10 1 empty Control control_empty
3 3 10 2 empty Control control_empty
3 3 10 3 empty Control control_empty
3 3 10 4 empty Control control_empty
3 3 10 5 empty Control control_empty
3 3 10 6 empty Control control_empty
3 3 10 7 empty Control control_empty
3 3 10 8 empty Control control_empty
3 3 10 9 empty Control control_empty
3 3 10 10 empty Control control_empty
3 3 10 11 empty Control control_empty
3 3 10 12 empty Control control_empty
3 3 10 13 empty Control control_empty
3 3 10 14 empty Control control_empty
3 3 11 1 empty Control control_empty
3 3 11 2 empty Control control_empty
3 3 11 3 empty Control control_empty
3 3 11 4 empty Control control_empty
3 3 11 5 empty Control control_empty
3 3 11 6 empty Control control_empty
3 3 11 7 empty Control control_empty
3 3 11 8 empty Control control_empty
3 3 11 9 empty Control control_empty
3 3 11 10 empty Control control_empty
3 3 11 11 empty Control control_empty
3 3 11 12 empty Control control_empty
3 3 11 13 empty Control control_empty
3 3 11 14 empty Control control_empty
3 3 12 1 empty Control control_empty
3 3 12 2 empty Control control_empty
3 3 12 3 empty Control control_empty
3 3 12 4 empty Control control_empty
3 3 12 5 empty Control control_empty
3 3 12 6 empty Control control_empty
3 3 12 7 empty Control control_empty
3 3 12 8 empty Control control_empty
3 3 12 9 empty Control control_empty
3 3 12 10 empty Control control_empty
3 3 12 11 empty Control control_empty
3 3 12 12 empty Control control_empty
3 3 12 13 empty Control control_empty
3 3 12 14 empty Control control_empty
3 4 2 5 empty Control control_empty
3 4 2 6 empty Control control_empty
3 4 2 7 empty Control control_empty
3 4 2 8 empty Control control_empty
3 4 2 9 empty Control control_empty
3 4 2 10 empty Control control_empty
3 4 2 12 empty Control control_empty
5 1 12 1 empty Control control_empty
5 1 12 2 empty Control control_empty
5 1 12 3 empty Control control_empty
5 1 12 4 empty Control control_empty
5 1 13 7 empty Control control_empty
5 1 13 8 empty Control control_empty
5 1 13 9 empty Control control_empty
5 1 13 10 empty Control control_empty
5 1 13 11 empty Control control_empty
5 1 13 12 empty Control control_empty
5 1 13 13 empty Control control_empty
5 1 13 14 empty Control control_empty
5 2 5 3 empty Control control_empty
5 2 5 4 empty Control control_empty
5 2 5 5 empty Control control_empty
5 2 5 6 empty Control control_empty
5 2 5 7 empty Control control_empty
5 2 5 8 empty Control control_empty
5 2 5 9 empty Control control_empty
5 2 5 10 empty Control control_empty
5 3 12 1 empty Control control_empty
5 3 12 2 empty Control control_empty
5 3 12 3 empty Control control_empty
5 3 12 4 empty Control control_empty
5 3 13 5 empty Control control_empty
5 3 13 6 empty Control control_empty
5 3 13 7 empty Control control_empty
5 3 13 8 empty Control control_empty
5 3 13 9 empty Control control_empty
5 3 13 10 empty Control control_empty
5 3 13 11 empty Control control_empty
5 3 13 12 empty Control control_empty
5 3 13 13 empty Control control_empty
5 3 13 14 empty Control control_empty
5 4 5 3 empty Control control_empty
5 4 5 4 empty Control control_empty
5 4 5 5 empty Control control_empty
5 4 5 6 empty Control control_empty
5 4 5 7 empty Control control_empty
5 4 5 8 empty Control control_empty
6 2 13 1 empty Control control_empty
6 2 13 2 empty Control control_empty
6 2 14 9 empty Control control_empty
6 2 14 10 empty Control control_empty
6 2 14 11 empty Control control_empty
6 2 14 12 empty Control control_empty
6 2 14 13 empty Control control_empty
6 2 14 14 empty Control control_empty
6 4 14 9 empty Control control_empty
6 4 14 10 empty Control control_empty
6 4 14 11 empty Control control_empty
6 4 14 12 empty Control control_empty
6 4 14 13 empty Control control_empty
6 4 14 14 empty Control control_empty
7 1 12 1 empty Control control_empty
7 1 12 2 empty Control control_empty
7 1 12 3 empty Control control_empty
7 1 12 4 empty Control control_empty
7 1 13 7 empty Control control_empty
7 1 13 8 empty Control control_empty
7 1 13 9 empty Control control_empty
7 1 13 10 empty Control control_empty
7 1 13 11 empty Control control_empty
7 1 13 12 empty Control control_empty
7 1 13 13 empty Control control_empty
7 1 13 14 empty Control control_empty
7 2 5 3 empty Control control_empty
7 2 5 4 empty Control control_empty
7 2 5 5 empty Control control_empty
7 2 5 6 empty Control control_empty
7 2 5 7 empty Control control_empty
7 2 5 8 empty Control control_empty
7 2 5 9 empty Control control_empty
7 2 5 10 empty Control control_empty
7 3 12 1 empty Control control_empty
7 3 12 2 empty Control control_empty
7 3 12 3 empty Control control_empty
7 3 12 4 empty Control control_empty
7 3 13 5 empty Control control_empty
7 3 13 6 empty Control control_empty
7 3 13 7 empty Control control_empty
7 3 13 8 empty Control control_empty
7 3 13 9 empty Control control_empty
7 3 13 10 empty Control control_empty
7 3 13 11 empty Control control_empty
7 3 13 12 empty Control control_empty
7 3 13 13 empty Control control_empty
7 3 13 14 empty Control control_empty
7 4 5 3 empty Control control_empty
7 4 5 4 empty Control control_empty
7 4 5 5 empty Control control_empty
7 4 5 6 empty Control control_empty
7 4 5 7 empty Control control_empty
7 4 5 8 empty Control control_empty
8 2 13 1 empty Control control_empty
8 2 13 2 empty Control control_empty
8 2 14 9 empty Control control_empty
8 2 14 10 empty Control control_empty
8 2 14 11 empty Control control_empty
8 2 14 12 empty Control control_empty
8 2 14 13 empty Control control_empty
8 2 14 14 empty Control control_empty
8 4 14 9 empty Control control_empty
8 4 14 10 empty Control control_empty
8 4 14 11 empty Control control_empty
8 4 14 12 empty Control control_empty
8 4 14 13 empty Control control_empty
8 4 14 14 empty Control control_empty
9 1 7 1 empty Control control_empty
9 1 7 2 empty Control control_empty
9 1 7 3 empty Control control_empty
9 1 7 4 empty Control control_empty
9 1 7 5 empty Control control_empty
9 1 7 6 empty Control control_empty
9 1 7 7 empty Control control_empty
9 1 7 8 empty Control control_empty
9 1 7 9 empty Control control_empty
9 1 7 10 empty Control control_empty
9 1 8 1 empty Control control_empty
9 1 8 2 empty Control control_empty
9 1 8 3 empty Control control_empty
9 1 8 4 empty Control control_empty
9 1 8 5 empty Control control_empty
9 1 8 6 empty Control control_empty
9 1 8 7 empty Control control_empty
9 1 8 8 empty Control control_empty
9 1 8 9 empty Control control_empty
9 1 8 10 empty Control control_empty
9 1 8 11 empty Control control_empty
9 1 8 12 empty Control control_empty
9 1 8 13 empty Control control_empty
9 1 8 14 empty Control control_empty
9 1 9 1 empty Control control_empty
9 1 9 2 empty Control control_empty
9 1 9 3 empty Control control_empty
9 1 9 4 empty Control control_empty
9 1 9 5 empty Control control_empty
9 1 9 6 empty Control control_empty
9 1 9 7 empty Control control_empty
9 1 9 8 empty Control control_empty
9 1 9 9 empty Control control_empty
9 1 9 10 empty Control control_empty
9 1 9 11 empty Control control_empty
9 1 9 12 empty Control control_empty
9 1 9 13 empty Control control_empty
9 1 9 14 empty Control control_empty
9 1 10 1 empty Control control_empty
9 1 10 2 empty Control control_empty
9 1 10 3 empty Control control_empty
9 1 10 4 empty Control control_empty
9 1 10 5 empty Control control_empty
9 1 10 6 empty Control control_empty
9 1 10 7 empty Control control_empty
9 1 10 8 empty Control control_empty
9 1 10 9 empty Control control_empty
9 1 10 10 empty Control control_empty
9 1 10 11 empty Control control_empty
9 1 10 12 empty Control control_empty
9 1 10 13 empty Control control_empty
9 1 10 14 empty Control control_empty
9 1 11 1 empty Control control_empty
9 1 11 2 empty Control control_empty
9 1 11 3 empty Control control_empty
9 1 11 4 empty Control control_empty
9 1 11 5 empty Control control_empty
9 1 11 6 empty Control control_empty
9 1 11 7 empty Control control_empty
9 1 11 8 empty Control control_empty
9 1 11 9 empty Control control_empty
9 1 11 10 empty Control control_empty
9 1 11 11 empty Control control_empty
9 1 11 12 empty Control control_empty
9 1 11 13 empty Control control_empty
9 1 11 14 empty Control control_empty
9 1 12 1 empty Control control_empty
9 1 12 2 empty Control control_empty
9 1 12 3 empty Control control_empty
9 1 12 4 empty Control control_empty
9 1 12 5 empty Control control_empty
9 1 12 6 empty Control control_empty
9 1 12 7 empty Control control_empty
9 1 12 8 empty Control control_empty
9 1 12 9 empty Control control_empty
9 1 12 10 empty Control control_empty
9 1 12 11 empty Control control_empty
9 1 12 12 empty Control control_empty
9 1 12 13 empty Control control_empty
9 1 12 14 empty Control control_empty
9 1 13 1 empty Control control_empty
9 1 13 2 empty Control control_empty
9 1 13 3 empty Control control_empty
9 1 13 4 empty Control control_empty
9 1 13 5 empty Control control_empty
9 1 13 6 empty Control control_empty
9 1 13 7 empty Control control_empty
9 1 13 8 empty Control control_empty
9 1 13 9 empty Control control_empty
9 1 13 10 empty Control control_empty
9 1 13 11 empty Control control_empty
9 1 13 12 empty Control control_empty
9 1 13 13 empty Control control_empty
9 1 13 14 empty Control control_empty
9 1 14 1 empty Control control_empty
9 1 14 2 empty Control control_empty
9 1 14 3 empty Control control_empty
9 1 14 4 empty Control control_empty
9 1 14 5 empty Control control_empty
9 1 14 6 empty Control control_empty
9 1 14 7 empty Control control_empty
9 1 14 8 empty Control control_empty
9 1 14 9 empty Control control_empty
9 1 14 10 empty Control control_empty
9 1 14 11 empty Control control_empty
9 1 14 12 empty Control control_empty
9 1 14 13 empty Control control_empty
9 1 14 14 empty Control control_empty
9 2 7 1 empty Control control_empty
9 2 7 2 empty Control control_empty
9 2 7 3 empty Control control_empty
9 2 7 4 empty Control control_empty
9 2 7 5 empty Control control_empty
9 2 7 6 empty Control control_empty
9 2 7 7 empty Control control_empty
9 2 7 8 empty Control control_empty
9 2 7 9 empty Control control_empty
9 2 7 10 empty Control control_empty
9 2 7 11 empty Control control_empty
9 2 7 12 empty Control control_empty
9 2 7 13 empty Control control_empty
9 2 7 14 empty Control control_empty
9 2 8 1 empty Control control_empty
9 2 8 2 empty Control control_empty
9 2 8 3 empty Control control_empty
9 2 8 4 empty Control control_empty
9 2 8 5 empty Control control_empty
9 2 8 6 empty Control control_empty
9 2 8 7 empty Control control_empty
9 2 8 8 empty Control control_empty
9 2 8 9 empty Control control_empty
9 2 8 10 empty Control control_empty
9 2 8 11 empty Control control_empty
9 2 8 12 empty Control control_empty
9 2 8 13 empty Control control_empty
9 2 8 14 empty Control control_empty
9 2 9 1 empty Control control_empty
9 2 9 2 empty Control control_empty
9 2 9 3 empty Control control_empty
9 2 9 4 empty Control control_empty
9 2 9 5 empty Control control_empty
9 2 9 6 empty Control control_empty
9 2 9 7 empty Control control_empty
9 2 9 8 empty Control control_empty
9 2 9 9 empty Control control_empty
9 2 9 10 empty Control control_empty
9 2 9 11 empty Control control_empty
9 2 9 12 empty Control control_empty
9 2 9 13 empty Control control_empty
9 2 9 14 empty Control control_empty
9 2 10 1 empty Control control_empty
9 2 10 2 empty Control control_empty
9 2 10 3 empty Control control_empty
9 2 10 4 empty Control control_empty
9 2 10 5 empty Control control_empty
9 2 10 6 empty Control control_empty
9 2 10 7 empty Control control_empty
9 2 10 8 empty Control control_empty
9 2 10 9 empty Control control_empty
9 2 10 10 empty Control control_empty
9 2 10 11 empty Control control_empty
9 2 10 12 empty Control control_empty
9 2 10 13 empty Control control_empty
9 2 10 14 empty Control control_empty
9 2 11 1 empty Control control_empty
9 2 11 2 empty Control control_empty
9 2 11 3 empty Control control_empty
9 2 11 4 empty Control control_empty
9 2 11 5 empty Control control_empty
9 2 11 6 empty Control control_empty
9 2 11 7 empty Control control_empty
9 2 11 8 empty Control control_empty
9 2 11 9 empty Control control_empty
9 2 11 10 empty Control control_empty
9 2 11 11 empty Control control_empty
9 2 11 12 empty Control control_empty
9 2 11 13 empty Control control_empty
9 2 11 14 empty Control control_empty
9 2 12 1 empty Control control_empty
9 2 12 2 empty Control control_empty
9 2 12 3 empty Control control_empty
9 2 12 4 empty Control control_empty
9 2 12 5 empty Control control_empty
9 2 12 6 empty Control control_empty
9 2 12 7 empty Control control_empty
9 2 12 8 empty Control control_empty
9 2 12 9 empty Control control_empty
9 2 12 10 empty Control control_empty
9 2 12 11 empty Control control_empty
9 2 12 12 empty Control control_empty
9 2 12 13 empty Control control_empty
9 2 12 14 empty Control control_empty
9 2 13 1 empty Control control_empty
9 2 13 2 empty Control control_empty
9 2 13 3 empty Control control_empty
9 2 13 4 empty Control control_empty
9 2 13 5 empty Control control_empty
9 2 13 6 empty Control control_empty
9 2 13 7 empty Control control_empty
9 2 13 8 empty Control control_empty
9 2 13 9 empty Control control_empty
9 2 13 10 empty Control control_empty
9 2 13 11 empty Control control_empty
9 2 13 12 empty Control control_empty
9 2 13 13 empty Control control_empty
9 2 13 14 empty Control control_empty
9 2 14 1 empty Control control_empty
9 2 14 2 empty Control control_empty
9 2 14 3 empty Control control_empty
9 2 14 4 empty Control control_empty
9 2 14 5 empty Control control_empty
9 2 14 6 empty Control control_empty
9 2 14 7 empty Control control_empty
9 2 14 8 empty Control control_empty
9 2 14 9 empty Control control_empty
9 2 14 10 empty Control control_empty
9 2 14 11 empty Control control_empty
9 2 14 12 empty Control control_empty
9 2 14 13 empty Control control_empty
9 2 14 14 empty Control control_empty
9 3 7 1 empty Control control_empty
9 3 7 2 empty Control control_empty
9 3 7 3 empty Control control_empty
9 3 7 4 empty Control control_empty
9 3 7 5 empty Control control_empty
9 3 7 6 empty Control control_empty
9 3 7 7 empty Control control_empty
9 3 7 8 empty Control control_empty
9 3 7 9 empty Control control_empty
9 3 7 10 empty Control control_empty
9 3 8 1 empty Control control_empty
9 3 8 2 empty Control control_empty
9 3 8 3 empty Control control_empty
9 3 8 4 empty Control control_empty
9 3 8 5 empty Control control_empty
9 3 8 6 empty Control control_empty
9 3 8 7 empty Control control_empty
9 3 8 8 empty Control control_empty
9 3 8 9 empty Control control_empty
9 3 8 10 empty Control control_empty
9 3 8 11 empty Control control_empty
9 3 8 12 empty Control control_empty
9 3 8 13 empty Control control_empty
9 3 8 14 empty Control control_empty
9 3 9 1 empty Control control_empty
9 3 9 2 empty Control control_empty
9 3 9 3 empty Control control_empty
9 3 9 4 empty Control control_empty
9 3 9 5 empty Control control_empty
9 3 9 6 empty Control control_empty
9 3 9 7 empty Control control_empty
9 3 9 8 empty Control control_empty
9 3 9 9 empty Control control_empty
9 3 9 10 empty Control control_empty
9 3 9 11 empty Control control_empty
9 3 9 12 empty Control control_empty
9 3 9 13 empty Control control_empty
9 3 9 14 empty Control control_empty
9 3 10 1 empty Control control_empty
9 3 10 2 empty Control control_empty
9 3 10 3 empty Control control_empty
9 3 10 4 empty Control control_empty
9 3 10 5 empty Control control_empty
9 3 10 6 empty Control control_empty
9 3 10 7 empty Control control_empty
9 3 10 8 empty Control control_empty
9 3 10 9 empty Control control_empty
9 3 10 10 empty Control control_empty
9 3 10 11 empty Control control_empty
9 3 10 12 empty Control control_empty
9 3 10 13 empty Control control_empty
9 3 10 14 empty Control control_empty
9 3 11 1 empty Control control_empty
9 3 11 2 empty Control control_empty
9 3 11 3 empty Control control_empty
9 3 11 4 empty Control control_empty
9 3 11 5 empty Control control_empty
9 3 11 6 empty Control control_empty
9 3 11 7 empty Control control_empty
9 3 11 8 empty Control control_empty
9 3 11 9 empty Control control_empty
9 3 11 10 empty Control control_empty
9 3 11 11 empty Control control_empty
9 3 11 12 empty Control control_empty
9 3 11 13 empty Control control_empty
9 3 11 14 empty Control control_empty
9 3 12 1 empty Control control_empty
9 3 12 2 empty Control control_empty
9 3 12 3 empty Control control_empty
9 3 12 4 empty Control control_empty
9 3 12 5 empty Control control_empty
9 3 12 6 empty Control control_empty
9 3 12 7 empty Control control_empty
9 3 12 8 empty Control control_empty
9 3 12 9 empty Control control_empty
9 3 12 10 empty Control control_empty
9 3 12 11 empty Control control_empty
9 3 12 12 empty Control control_empty
9 3 12 13 empty Control control_empty
9 3 12 14 empty Control control_empty
9 3 13 1 empty Control control_empty
9 3 13 2 empty Control control_empty
9 3 13 3 empty Control control_empty
9 3 13 4 empty Control control_empty
9 3 13 5 empty Control control_empty
9 3 13 6 empty Control control_empty
9 3 13 7 empty Control control_empty
9 3 13 8 empty Control control_empty
9 3 13 9 empty Control control_empty
9 3 13 10 empty Control control_empty
9 3 13 11 empty Control control_empty
9 3 13 12 empty Control control_empty
9 3 13 13 empty Control control_empty
9 3 13 14 empty Control control_empty
9 3 14 1 empty Control control_empty
9 3 14 2 empty Control control_empty
9 3 14 3 empty Control control_empty
9 3 14 4 empty Control control_empty
9 3 14 5 empty Control control_empty
9 3 14 6 empty Control control_empty
9 3 14 7 empty Control control_empty
9 3 14 8 empty Control control_empty
9 3 14 9 empty Control control_empty
9 3 14 10 empty Control control_empty
9 3 14 11 empty Control control_empty
9 3 14 12 empty Control control_empty
9 3 14 13 empty Control control_empty
9 3 14 14 empty Control control_empty
9 4 7 1 empty Control control_empty
9 4 7 2 empty Control control_empty
9 4 7 3 empty Control control_empty
9 4 7 4 empty Control control_empty
9 4 7 5 empty Control control_empty
9 4 7 6 empty Control control_empty
9 4 7 7 empty Control control_empty
9 4 7 8 empty Control control_empty
9 4 7 9 empty Control control_empty
9 4 7 10 empty Control control_empty
9 4 8 1 empty Control control_empty
9 4 8 2 empty Control control_empty
9 4 8 3 empty Control control_empty
9 4 8 4 empty Control control_empty
9 4 8 5 empty Control control_empty
9 4 8 6 empty Control control_empty
9 4 8 7 empty Control control_empty
9 4 8 8 empty Control control_empty
9 4 8 9 empty Control control_empty
9 4 8 10 empty Control control_empty
9 4 8 11 empty Control control_empty
9 4 8 12 empty Control control_empty
9 4 8 13 empty Control control_empty
9 4 8 14 empty Control control_empty
9 4 9 1 empty Control control_empty
9 4 9 2 empty Control control_empty
9 4 9 3 empty Control control_empty
9 4 9 4 empty Control control_empty
9 4 9 5 empty Control control_empty
9 4 9 6 empty Control control_empty
9 4 9 7 empty Control control_empty
9 4 9 8 empty Control control_empty
9 4 9 9 empty Control control_empty
9 4 9 10 empty Control control_empty
9 4 9 11 empty Control control_empty
9 4 9 12 empty Control control_empty
9 4 9 13 empty Control control_empty
9 4 9 14 empty Control control_empty
9 4 10 1 empty Control control_empty
9 4 10 2 empty Control control_empty
9 4 10 3 empty Control control_empty
9 4 10 4 empty Control control_empty
9 4 10 5 empty Control control_empty
9 4 10 6 empty Control control_empty
9 4 10 7 empty Control control_empty
9 4 10 8 empty Control control_empty
9 4 10 9 empty Control control_empty
9 4 10 10 empty Control control_empty
9 4 10 11 empty Control control_empty
9 4 10 12 empty Control control_empty
9 4 10 13 empty Control control_empty
9 4 10 14 empty Control control_empty
9 4 11 1 empty Control control_empty
9 4 11 2 empty Control control_empty
9 4 11 3 empty Control control_empty
9 4 11 4 empty Control control_empty
9 4 11 5 empty Control control_empty
9 4 11 6 empty Control control_empty
9 4 11 7 empty Control control_empty
9 4 11 8 empty Control control_empty
9 4 11 9 empty Control control_empty
9 4 11 10 empty Control control_empty
9 4 11 11 empty Control control_empty
9 4 11 12 empty Control control_empty
9 4 11 13 empty Control control_empty
9 4 11 14 empty Control control_empty
9 4 12 1 empty Control control_empty
9 4 12 2 empty Control control_empty
9 4 12 3 empty Control control_empty
9 4 12 4 empty Control control_empty
9 4 12 5 empty Control control_empty
9 4 12 6 empty Control control_empty
9 4 12 7 empty Control control_empty
9 4 12 8 empty Control control_empty
9 4 12 9 empty Control control_empty
9 4 12 10 empty Control control_empty
9 4 12 11 empty Control control_empty
9 4 12 12 empty Control control_empty
9 4 12 13 empty Control control_empty
9 4 12 14 empty Control control_empty
9 4 13 1 empty Control control_empty
9 4 13 2 empty Control control_empty
9 4 13 3 empty Control control_empty
9 4 13 4 empty Control control_empty
9 4 13 5 empty Control control_empty
9 4 13 6 empty Control control_empty
9 4 13 7 empty Control control_empty
9 4 13 8 empty Control control_empty
9 4 13 9 empty Control control_empty
9 4 13 10 empty Control control_empty
9 4 13 11 empty Control control_empty
9 4 13 12 empty Control control_empty
9 4 13 13 empty Control control_empty
9 4 13 14 empty Control control_empty
9 4 14 1 empty Control control_empty
9 4 14 2 empty Control control_empty
9 4 14 3 empty Control control_empty
9 4 14 4 empty Control control_empty
9 4 14 5 empty Control control_empty
9 4 14 6 empty Control control_empty
9 4 14 7 empty Control control_empty
9 4 14 8 empty Control control_empty
9 4 14 9 empty Control control_empty
9 4 14 10 empty Control control_empty
9 4 14 11 empty Control control_empty
9 4 14 12 empty Control control_empty
9 4 14 13 empty Control control_empty
9 4 14 14 empty Control control_empty
10 1 6 1 empty Control control_empty
10 1 7 1 empty Control control_empty
10 1 7 2 empty Control control_empty
10 1 7 3 empty Control control_empty
10 1 7 4 empty Control control_empty
10 1 7 5 empty Control control_empty
10 1 7 6 empty Control control_empty
10 1 7 7 empty Control control_empty
10 1 7 8 empty Control control_empty
10 1 7 9 empty Control control_empty
10 1 7 10 empty Control control_empty
10 1 7 11 empty Control control_empty
10 1 7 12 empty Control control_empty
10 1 7 13 empty Control control_empty
10 1 7 14 empty Control control_empty
10 1 8 1 empty Control control_empty
10 1 8 2 empty Control control_empty
10 1 8 3 empty Control control_empty
10 1 8 4 empty Control control_empty
10 1 8 5 empty Control control_empty
10 1 8 6 empty Control control_empty
10 1 8 7 empty Control control_empty
10 1 8 8 empty Control control_empty
10 1 8 9 empty Control control_empty
10 1 8 10 empty Control control_empty
10 1 8 11 empty Control control_empty
10 1 8 12 empty Control control_empty
10 1 8 13 empty Control control_empty
10 1 8 14 empty Control control_empty
10 1 9 1 empty Control control_empty
10 1 9 2 empty Control control_empty
10 1 9 3 empty Control control_empty
10 1 9 4 empty Control control_empty
10 1 9 5 empty Control control_empty
10 1 9 6 empty Control control_empty
10 1 9 7 empty Control control_empty
10 1 9 8 empty Control control_empty
10 1 9 9 empty Control control_empty
10 1 9 10 empty Control control_empty
10 1 9 11 empty Control control_empty
10 1 9 12 empty Control control_empty
10 1 9 13 empty Control control_empty
10 1 9 14 empty Control control_empty
10 1 10 1 empty Control control_empty
10 1 10 2 empty Control control_empty
10 1 10 3 empty Control control_empty
10 1 10 4 empty Control control_empty
10 1 10 5 empty Control control_empty
10 1 10 6 empty Control control_empty
10 1 10 7 empty Control control_empty
10 1 10 8 empty Control control_empty
10 1 10 9 empty Control control_empty
10 1 10 10 empty Control control_empty
10 1 10 11 empty Control control_empty
10 1 10 12 empty Control control_empty
10 1 10 13 empty Control control_empty
10 1 10 14 empty Control control_empty
10 1 11 1 empty Control control_empty
10 1 11 2 empty Control control_empty
10 1 11 3 empty Control control_empty
10 1 11 4 empty Control control_empty
10 1 11 5 empty Control control_empty
10 1 11 6 empty Control control_empty
10 1 11 7 empty Control control_empty
10 1 11 8 empty Control control_empty
10 1 11 9 empty Control control_empty
10 1 11 10 empty Control control_empty
10 1 11 11 empty Control control_empty
10 1 11 12 empty Control control_empty
10 1 11 13 empty Control control_empty
10 1 11 14 empty Control control_empty
10 1 12 1 empty Control control_empty
10 1 12 2 empty Control control_empty
10 1 12 3 empty Control control_empty
10 1 12 4 empty Control control_empty
10 1 12 5 empty Control control_empty
10 1 12 6 empty Control control_empty
10 1 12 7 empty Control control_empty
10 1 12 8 empty Control control_empty
10 1 12 9 empty Control control_empty
10 1 12 10 empty Control control_empty
10 1 12 11 empty Control control_empty
10 1 12 12 empty Control control_empty
10 1 12 13 empty Control control_empty
10 1 12 14 empty Control control_empty
10 1 13 1 empty Control control_empty
10 1 13 2 empty Control control_empty
10 1 13 3 empty Control control_empty
10 1 13 4 empty Control control_empty
10 1 13 5 empty Control control_empty
10 1 13 6 empty Control control_empty
10 1 13 7 empty Control control_empty
10 1 13 8 empty Control control_empty
10 1 13 9 empty Control control_empty
10 1 13 10 empty Control control_empty
10 1 13 11 empty Control control_empty
10 1 13 12 empty Control control_empty
10 1 13 13 empty Control control_empty
10 1 13 14 empty Control control_empty
10 1 14 1 empty Control control_empty
10 1 14 2 empty Control control_empty
10 1 14 3 empty Control control_empty
10 1 14 4 empty Control control_empty
10 1 14 5 empty Control control_empty
10 1 14 6 empty Control control_empty
10 1 14 7 empty Control control_empty
10 1 14 8 empty Control control_empty
10 1 14 9 empty Control control_empty
10 1 14 10 empty Control control_empty
10 1 14 11 empty Control control_empty
10 1 14 12 empty Control control_empty
10 1 14 13 empty Control control_empty
10 1 14 14 empty Control control_empty
10 2 6 1 empty Control control_empty
10 2 6 3 empty Control control_empty
10 2 6 4 empty Control control_empty
10 2 6 5 empty Control control_empty
10 2 6 6 empty Control control_empty
10 2 6 7 empty Control control_empty
10 2 6 8 empty Control control_empty
10 2 6 9 empty Control control_empty
10 2 6 10 empty Control control_empty
10 2 6 11 empty Control control_empty
10 2 6 12 empty Control control_empty
10 2 6 13 empty Control control_empty
10 2 6 14 empty Control control_empty
10 2 7 1 empty Control control_empty
10 2 7 2 empty Control control_empty
10 2 7 3 empty Control control_empty
10 2 7 4 empty Control control_empty
10 2 7 5 empty Control control_empty
10 2 7 6 empty Control control_empty
10 2 7 7 empty Control control_empty
10 2 7 8 empty Control control_empty
10 2 7 9 empty Control control_empty
10 2 7 10 empty Control control_empty
10 2 7 14 empty Control control_empty
10 2 8 1 empty Control control_empty
10 2 8 2 empty Control control_empty
10 2 8 3 empty Control control_empty
10 2 8 4 empty Control control_empty
10 2 8 5 empty Control control_empty
10 2 8 6 empty Control control_empty
10 2 8 7 empty Control control_empty
10 2 8 8 empty Control control_empty
10 2 8 9 empty Control control_empty
10 2 8 10 empty Control control_empty
10 2 8 11 empty Control control_empty
10 2 8 12 empty Control control_empty
10 2 8 13 empty Control control_empty
10 2 8 14 empty Control control_empty
10 2 9 1 empty Control control_empty
10 2 9 2 empty Control control_empty
10 2 9 3 empty Control control_empty
10 2 9 4 empty Control control_empty
10 2 9 5 empty Control control_empty
10 2 9 6 empty Control control_empty
10 2 9 7 empty Control control_empty
10 2 9 8 empty Control control_empty
10 2 9 9 empty Control control_empty
10 2 9 10 empty Control control_empty
10 2 9 11 empty Control control_empty
10 2 9 12 empty Control control_empty
10 2 9 13 empty Control control_empty
10 2 9 14 empty Control control_empty
10 2 10 1 empty Control control_empty
10 2 10 2 empty Control control_empty
10 2 10 3 empty Control control_empty
10 2 10 4 empty Control control_empty
10 2 10 5 empty Control control_empty
10 2 10 6 empty Control control_empty
10 2 10 7 empty Control control_empty
10 2 10 8 empty Control control_empty
10 2 10 9 empty Control control_empty
10 2 10 10 empty Control control_empty
10 2 10 11 empty Control control_empty
10 2 10 12 empty Control control_empty
10 2 10 13 empty Control control_empty
10 2 10 14 empty Control control_empty
10 2 11 1 empty Control control_empty
10 2 11 2 empty Control control_empty
10 2 11 3 empty Control control_empty
10 2 11 4 empty Control control_empty
10 2 11 5 empty Control control_empty
10 2 11 6 empty Control control_empty
10 2 11 7 empty Control control_empty
10 2 11 8 empty Control control_empty
10 2 11 9 empty Control control_empty
10 2 11 10 empty Control control_empty
10 2 11 11 empty Control control_empty
10 2 11 12 empty Control control_empty
10 2 11 13 empty Control control_empty
10 2 11 14 empty Control control_empty
10 2 12 1 empty Control control_empty
10 2 12 2 empty Control control_empty
10 2 12 3 empty Control control_empty
10 2 12 4 empty Control control_empty
10 2 12 5 empty Control control_empty
10 2 12 6 empty Control control_empty
10 2 12 7 empty Control control_empty
10 2 12 8 empty Control control_empty
10 2 12 9 empty Control control_empty
10 2 12 10 empty Control control_empty
10 2 12 11 empty Control control_empty
10 2 12 12 empty Control control_empty
10 2 12 13 empty Control control_empty
10 2 12 14 empty Control control_empty
10 2 13 1 empty Control control_empty
10 2 13 2 empty Control control_empty
10 2 13 3 empty Control control_empty
10 2 13 4 empty Control control_empty
10 2 13 5 empty Control control_empty
10 2 13 6 empty Control control_empty
10 2 13 7 empty Control control_empty
10 2 13 8 empty Control control_empty
10 2 13 9 empty Control control_empty
10 2 13 10 empty Control control_empty
10 2 13 11 empty Control control_empty
10 2 13 12 empty Control control_empty
10 2 13 13 empty Control control_empty
10 2 13 14 empty Control control_empty
10 2 14 1 empty Control control_empty
10 2 14 2 empty Control control_empty
10 2 14 3 empty Control control_empty
10 2 14 4 empty Control control_empty
10 2 14 5 empty Control control_empty
10 2 14 6 empty Control control_empty
10 2 14 7 empty Control control_empty
10 2 14 8 empty Control control_empty
10 2 14 9 empty Control control_empty
10 2 14 10 empty Control control_empty
10 2 14 11 empty Control control_empty
10 2 14 12 empty Control control_empty
10 2 14 13 empty Control control_empty
10 2 14 14 empty Control control_empty
10 3 7 1 empty Control control_empty
10 3 7 2 empty Control control_empty
10 3 7 3 empty Control control_empty
10 3 7 4 empty Control control_empty
10 3 7 5 empty Control control_empty
10 3 7 6 empty Control control_empty
10 3 7 7 empty Control control_empty
10 3 7 8 empty Control control_empty
10 3 7 9 empty Control control_empty
10 3 7 10 empty Control control_empty
10 3 8 1 empty Control control_empty
10 3 8 2 empty Control control_empty
10 3 8 3 empty Control control_empty
10 3 8 4 empty Control control_empty
10 3 8 5 empty Control control_empty
10 3 8 6 empty Control control_empty
10 3 8 7 empty Control control_empty
10 3 8 8 empty Control control_empty
10 3 8 9 empty Control control_empty
10 3 8 10 empty Control control_empty
10 3 8 11 empty Control control_empty
10 3 8 12 empty Control control_empty
10 3 8 13 empty Control control_empty
10 3 8 14 empty Control control_empty
10 3 9 1 empty Control control_empty
10 3 9 2 empty Control control_empty
10 3 9 3 empty Control control_empty
10 3 9 4 empty Control control_empty
10 3 9 5 empty Control control_empty
10 3 9 6 empty Control control_empty
10 3 9 7 empty Control control_empty
10 3 9 8 empty Control control_empty
10 3 9 9 empty Control control_empty
10 3 9 10 empty Control control_empty
10 3 9 11 empty Control control_empty
10 3 9 12 empty Control control_empty
10 3 9 13 empty Control control_empty
10 3 9 14 empty Control control_empty
10 3 10 1 empty Control control_empty
10 3 10 2 empty Control control_empty
10 3 10 3 empty Control control_empty
10 3 10 4 empty Control control_empty
10 3 10 5 empty Control control_empty
10 3 10 6 empty Control control_empty
10 3 10 7 empty Control control_empty
10 3 10 8 empty Control control_empty
10 3 10 9 empty Control control_empty
10 3 10 10 empty Control control_empty
10 3 10 11 empty Control control_empty
10 3 10 12 empty Control control_empty
10 3 10 13 empty Control control_empty
10 3 10 14 empty Control control_empty
10 3 11 1 empty Control control_empty
10 3 11 2 empty Control control_empty
10 3 11 3 empty Control control_empty
10 3 11 4 empty Control control_empty
10 3 11 5 empty Control control_empty
10 3 11 6 empty Control control_empty
10 3 11 7 empty Control control_empty
10 3 11 8 empty Control control_empty
10 3 11 9 empty Control control_empty
10 3 11 10 empty Control control_empty
10 3 11 11 empty Control control_empty
10 3 11 12 empty Control control_empty
10 3 11 13 empty Control control_empty
10 3 11 14 empty Control control_empty
10 3 12 1 empty Control control_empty
10 3 12 2 empty Control control_empty
10 3 12 3 empty Control control_empty
10 3 12 4 empty Control control_empty
10 3 12 5 empty Control control_empty
10 3 12 6 empty Control control_empty
10 3 12 7 empty Control control_empty
10 3 12 8 empty Control control_empty
10 3 12 9 empty Control control_empty
10 3 12 10 empty Control control_empty
10 3 12 11 empty Control control_empty
10 3 12 12 empty Control control_empty
10 3 12 13 empty Control control_empty
10 3 12 14 empty Control control_empty
10 3 13 1 empty Control control_empty
10 3 13 2 empty Control control_empty
10 3 13 3 empty Control control_empty
10 3 13 4 empty Control control_empty
10 3 13 5 empty Control control_empty
10 3 13 6 empty Control control_empty
10 3 13 7 empty Control control_empty
10 3 13 8 empty Control control_empty
10 3 13 9 empty Control control_empty
10 3 13 10 empty Control control_empty
10 3 13 11 empty Control control_empty
10 3 13 12 empty Control control_empty
10 3 13 13 empty Control control_empty
10 3 13 14 empty Control control_empty
10 3 14 1 empty Control control_empty
10 3 14 2 empty Control control_empty
10 3 14 3 empty Control control_empty
10 3 14 4 empty Control control_empty
10 3 14 5 empty Control control_empty
10 3 14 6 empty Control control_empty
10 3 14 7 empty Control control_empty
10 3 14 8 empty Control control_empty
10 3 14 9 empty Control control_empty
10 3 14 10 empty Control control_empty
10 3 14 11 empty Control control_empty
10 3 14 12 empty Control control_empty
10 3 14 13 empty Control control_empty
10 3 14 14 empty Control control_empty
10 4 6 1 empty Control control_empty
10 4 6 2 empty Control control_empty
10 4 6 3 empty Control control_empty
10 4 6 4 empty Control control_empty
10 4 6 5 empty Control control_empty
10 4 6 6 empty Control control_empty
10 4 6 7 empty Control control_empty
10 4 6 8 empty Control control_empty
10 4 6 9 empty Control control_empty
10 4 6 10 empty Control control_empty
10 4 6 11 empty Control control_empty
10 4 6 12 empty Control control_empty
10 4 6 13 empty Control control_empty
10 4 7 1 empty Control control_empty
10 4 7 2 empty Control control_empty
10 4 7 3 empty Control control_empty
10 4 7 4 empty Control control_empty
10 4 7 5 empty Control control_empty
10 4 7 6 empty Control control_empty
10 4 7 7 empty Control control_empty
10 4 7 8 empty Control control_empty
10 4 7 9 empty Control control_empty
10 4 7 10 empty Control control_empty
10 4 7 11 empty Control control_empty
10 4 7 12 empty Control control_empty
10 4 7 13 empty Control control_empty
10 4 7 14 empty Control control_empty
10 4 8 1 empty Control control_empty
10 4 8 2 empty Control control_empty
10 4 8 3 empty Control control_empty
10 4 8 4 empty Control control_empty
10 4 8 5 empty Control control_empty
10 4 8 6 empty Control control_empty
10 4 8 7 empty Control control_empty
10 4 8 8 empty Control control_empty
10 4 8 9 empty Control control_empty
10 4 8 10 empty Control control_empty
10 4 8 11 empty Control control_empty
10 4 8 12 empty Control control_empty
10 4 8 13 empty Control control_empty
10 4 8 14 empty Control control_empty
10 4 9 1 empty Control control_empty
10 4 9 2 empty Control control_empty
10 4 9 3 empty Control control_empty
10 4 9 4 empty Control control_empty
10 4 9 5 empty Control control_empty
10 4 9 6 empty Control control_empty
10 4 9 7 empty Control control_empty
10 4 9 8 empty Control control_empty
10 4 9 9 empty Control control_empty
10 4 9 10 empty Control control_empty
10 4 9 11 empty Control control_empty
10 4 9 12 empty Control control_empty
10 4 9 13 empty Control control_empty
10 4 9 14 empty Control control_empty
10 4 10 1 empty Control control_empty
10 4 10 2 empty Control control_empty
10 4 10 3 empty Control control_empty
10 4 10 4 empty Control control_empty
10 4 10 5 empty Control control_empty
10 4 10 6 empty Control control_empty
10 4 10 7 empty Control control_empty
10 4 10 8 empty Control control_empty
10 4 10 9 empty Control control_empty
10 4 10 10 empty Control control_empty
10 4 10 11 empty Control control_empty
10 4 10 12 empty Control control_empty
10 4 10 13 empty Control control_empty
10 4 10 14 empty Control control_empty
10 4 11 1 empty Control control_empty
10 4 11 2 empty Control control_empty
10 4 11 3 empty Control control_empty
10 4 11 4 empty Control control_empty
10 4 11 5 empty Control control_empty
10 4 11 6 empty Control control_empty
10 4 11 7 empty Control control_empty
10 4 11 8 empty Control control_empty
10 4 11 9 empty Control control_empty
10 4 11 10 empty Control control_empty
10 4 11 11 empty Control control_empty
10 4 11 12 empty Control control_empty
10 4 11 13 empty Control control_empty
10 4 11 14 empty Control control_empty
10 4 12 1 empty Control control_empty
10 4 12 2 empty Control control_empty
10 4 12 3 empty Control control_empty
10 4 12 4 empty Control control_empty
10 4 12 5 empty Control control_empty
10 4 12 6 empty Control control_empty
10 4 12 7 empty Control control_empty
10 4 12 8 empty Control control_empty
10 4 12 9 empty Control control_empty
10 4 12 10 empty Control control_empty
10 4 12 11 empty Control control_empty
10 4 12 12 empty Control control_empty
10 4 12 13 empty Control control_empty
10 4 12 14 empty Control control_empty
10 4 13 1 empty Control control_empty
10 4 13 2 empty Control control_empty
10 4 13 3 empty Control control_empty
10 4 13 4 empty Control control_empty
10 4 13 5 empty Control control_empty
10 4 13 6 empty Control control_empty
10 4 13 7 empty Control control_empty
10 4 13 8 empty Control control_empty
10 4 13 9 empty Control control_empty
10 4 13 10 empty Control control_empty
10 4 13 11 empty Control control_empty
10 4 13 12 empty Control control_empty
10 4 13 13 empty Control control_empty
10 4 13 14 empty Control control_empty
10 4 14 1 empty Control control_empty
10 4 14 2 empty Control control_empty
10 4 14 3 empty Control control_empty
10 4 14 4 empty Control control_empty
10 4 14 5 empty Control control_empty
10 4 14 6 empty Control control_empty
10 4 14 7 empty Control control_empty
10 4 14 8 empty Control control_empty
10 4 14 9 empty Control control_empty
10 4 14 10 empty Control control_empty
10 4 14 11 empty Control control_empty
10 4 14 12 empty Control control_empty
10 4 14 13 empty Control control_empty
10 4 14 14 empty Control control_empty
11 1 7 1 empty Control control_empty
11 1 7 2 empty Control control_empty
11 1 7 3 empty Control control_empty
11 1 7 4 empty Control control_empty
11 1 7 5 empty Control control_empty
11 1 7 6 empty Control control_empty
11 1 7 7 empty Control control_empty
11 1 7 8 empty Control control_empty
11 1 7 9 empty Control control_empty
11 1 7 10 empty Control control_empty
11 1 8 1 empty Control control_empty
11 1 8 2 empty Control control_empty
11 1 8 3 empty Control control_empty
11 1 8 4 empty Control control_empty
11 1 8 5 empty Control control_empty
11 1 8 6 empty Control control_empty
11 1 8 7 empty Control control_empty
11 1 8 8 empty Control control_empty
11 1 8 9 empty Control control_empty
11 1 8 10 empty Control control_empty
11 1 8 11 empty Control control_empty
11 1 8 12 empty Control control_empty
11 1 8 13 empty Control control_empty
11 1 8 14 empty Control control_empty
11 1 9 1 empty Control control_empty
11 1 9 2 empty Control control_empty
11 1 9 3 empty Control control_empty
11 1 9 4 empty Control control_empty
11 1 9 5 empty Control control_empty
11 1 9 6 empty Control control_empty
11 1 9 7 empty Control control_empty
11 1 9 8 empty Control control_empty
11 1 9 9 empty Control control_empty
11 1 9 10 empty Control control_empty
11 1 9 11 empty Control control_empty
11 1 9 12 empty Control control_empty
11 1 9 13 empty Control control_empty
11 1 9 14 empty Control control_empty
11 1 10 1 empty Control control_empty
11 1 10 2 empty Control control_empty
11 1 10 3 empty Control control_empty
11 1 10 4 empty Control control_empty
11 1 10 5 empty Control control_empty
11 1 10 6 empty Control control_empty
11 1 10 7 empty Control control_empty
11 1 10 8 empty Control control_empty
11 1 10 9 empty Control control_empty
11 1 10 10 empty Control control_empty
11 1 10 11 empty Control control_empty
11 1 10 12 empty Control control_empty
11 1 10 13 empty Control control_empty
11 1 10 14 empty Control control_empty
11 1 11 1 empty Control control_empty
11 1 11 2 empty Control control_empty
11 1 11 3 empty Control control_empty
11 1 11 4 empty Control control_empty
11 1 11 5 empty Control control_empty
11 1 11 6 empty Control control_empty
11 1 11 7 empty Control control_empty
11 1 11 8 empty Control control_empty
11 1 11 9 empty Control control_empty
11 1 11 10 empty Control control_empty
11 1 11 11 empty Control control_empty
11 1 11 12 empty Control control_empty
11 1 11 13 empty Control control_empty
11 1 11 14 empty Control control_empty
11 1 12 1 empty Control control_empty
11 1 12 2 empty Control control_empty
11 1 12 3 empty Control control_empty
11 1 12 4 empty Control control_empty
11 1 12 5 empty Control control_empty
11 1 12 6 empty Control control_empty
11 1 12 7 empty Control control_empty
11 1 12 8 empty Control control_empty
11 1 12 9 empty Control control_empty
11 1 12 10 empty Control control_empty
11 1 12 11 empty Control control_empty
11 1 12 12 empty Control control_empty
11 1 12 13 empty Control control_empty
11 1 12 14 empty Control control_empty
11 1 13 1 empty Control control_empty
11 1 13 2 empty Control control_empty
11 1 13 3 empty Control control_empty
11 1 13 4 empty Control control_empty
11 1 13 5 empty Control control_empty
11 1 13 6 empty Control control_empty
11 1 13 7 empty Control control_empty
11 1 13 8 empty Control control_empty
11 1 13 9 empty Control control_empty
11 1 13 10 empty Control control_empty
11 1 13 11 empty Control control_empty
11 1 13 12 empty Control control_empty
11 1 13 13 empty Control control_empty
11 1 13 14 empty Control control_empty
11 1 14 1 empty Control control_empty
11 1 14 2 empty Control control_empty
11 1 14 3 empty Control control_empty
11 1 14 4 empty Control control_empty
11 1 14 5 empty Control control_empty
11 1 14 6 empty Control control_empty
11 1 14 7 empty Control control_empty
11 1 14 8 empty Control control_empty
11 1 14 9 empty Control control_empty
11 1 14 10 empty Control control_empty
11 1 14 11 empty Control control_empty
11 1 14 12 empty Control control_empty
11 1 14 13 empty Control control_empty
11 1 14 14 empty Control control_empty
11 2 7 1 empty Control control_empty
11 2 7 2 empty Control control_empty
11 2 7 3 empty Control control_empty
11 2 7 4 empty Control control_empty
11 2 7 5 empty Control control_empty
11 2 7 6 empty Control control_empty
11 2 7 7 empty Control control_empty
11 2 7 8 empty Control control_empty
11 2 7 9 empty Control control_empty
11 2 7 10 empty Control control_empty
11 2 7 11 empty Control control_empty
11 2 7 12 empty Control control_empty
11 2 7 13 empty Control control_empty
11 2 7 14 empty Control control_empty
11 2 8 1 empty Control control_empty
11 2 8 2 empty Control control_empty
11 2 8 3 empty Control control_empty
11 2 8 4 empty Control control_empty
11 2 8 5 empty Control control_empty
11 2 8 6 empty Control control_empty
11 2 8 7 empty Control control_empty
11 2 8 8 empty Control control_empty
11 2 8 9 empty Control control_empty
11 2 8 10 empty Control control_empty
11 2 8 11 empty Control control_empty
11 2 8 12 empty Control control_empty
11 2 8 13 empty Control control_empty
11 2 8 14 empty Control control_empty
11 2 9 1 empty Control control_empty
11 2 9 2 empty Control control_empty
11 2 9 3 empty Control control_empty
11 2 9 4 empty Control control_empty
11 2 9 5 empty Control control_empty
11 2 9 6 empty Control control_empty
11 2 9 7 empty Control control_empty
11 2 9 8 empty Control control_empty
11 2 9 9 empty Control control_empty
11 2 9 10 empty Control control_empty
11 2 9 11 empty Control control_empty
11 2 9 12 empty Control control_empty
11 2 9 13 empty Control control_empty
11 2 9 14 empty Control control_empty
11 2 10 1 empty Control control_empty
11 2 10 2 empty Control control_empty
11 2 10 3 empty Control control_empty
11 2 10 4 empty Control control_empty
11 2 10 5 empty Control control_empty
11 2 10 6 empty Control control_empty
11 2 10 7 empty Control control_empty
11 2 10 8 empty Control control_empty
11 2 10 9 empty Control control_empty
11 2 10 10 empty Control control_empty
11 2 10 11 empty Control control_empty
11 2 10 12 empty Control control_empty
11 2 10 13 empty Control control_empty
11 2 10 14 empty Control control_empty
11 2 11 1 empty Control control_empty
11 2 11 2 empty Control control_empty
11 2 11 3 empty Control control_empty
11 2 11 4 empty Control control_empty
11 2 11 5 empty Control control_empty
11 2 11 6 empty Control control_empty
11 2 11 7 empty Control control_empty
11 2 11 8 empty Control control_empty
11 2 11 9 empty Control control_empty
11 2 11 10 empty Control control_empty
11 2 11 11 empty Control control_empty
11 2 11 12 empty Control control_empty
11 2 11 13 empty Control control_empty
11 2 11 14 empty Control control_empty
11 2 12 1 empty Control control_empty
11 2 12 2 empty Control control_empty
11 2 12 3 empty Control control_empty
11 2 12 4 empty Control control_empty
11 2 12 5 empty Control control_empty
11 2 12 6 empty Control control_empty
11 2 12 7 empty Control control_empty
11 2 12 8 empty Control control_empty
11 2 12 9 empty Control control_empty
11 2 12 10 empty Control control_empty
11 2 12 11 empty Control control_empty
11 2 12 12 empty Control control_empty
11 2 12 13 empty Control control_empty
11 2 12 14 empty Control control_empty
11 2 13 1 empty Control control_empty
11 2 13 2 empty Control control_empty
11 2 13 3 empty Control control_empty
11 2 13 4 empty Control control_empty
11 2 13 5 empty Control control_empty
11 2 13 6 empty Control control_empty
11 2 13 7 empty Control control_empty
11 2 13 8 empty Control control_empty
11 2 13 9 empty Control control_empty
11 2 13 10 empty Control control_empty
11 2 13 11 empty Control control_empty
11 2 13 12 empty Control control_empty
11 2 13 13 empty Control control_empty
11 2 13 14 empty Control control_empty
11 2 14 1 empty Control control_empty
11 2 14 2 empty Control control_empty
11 2 14 3 empty Control control_empty
11 2 14 4 empty Control control_empty
11 2 14 5 empty Control control_empty
11 2 14 6 empty Control control_empty
11 2 14 7 empty Control control_empty
11 2 14 8 empty Control control_empty
11 2 14 9 empty Control control_empty
11 2 14 10 empty Control control_empty
11 2 14 11 empty Control control_empty
11 2 14 12 empty Control control_empty
11 2 14 13 empty Control control_empty
11 2 14 14 empty Control control_empty
11 3 7 1 empty Control control_empty
11 3 7 2 empty Control control_empty
11 3 7 3 empty Control control_empty
11 3 7 4 empty Control control_empty
11 3 7 5 empty Control control_empty
11 3 7 6 empty Control control_empty
11 3 7 7 empty Control control_empty
11 3 7 8 empty Control control_empty
11 3 7 9 empty Control control_empty
11 3 7 10 empty Control control_empty
11 3 8 1 empty Control control_empty
11 3 8 2 empty Control control_empty
11 3 8 3 empty Control control_empty
11 3 8 4 empty Control control_empty
11 3 8 5 empty Control control_empty
11 3 8 6 empty Control control_empty
11 3 8 7 empty Control control_empty
11 3 8 8 empty Control control_empty
11 3 8 9 empty Control control_empty
11 3 8 10 empty Control control_empty
11 3 8 11 empty Control control_empty
11 3 8 12 empty Control control_empty
11 3 8 13 empty Control control_empty
11 3 8 14 empty Control control_empty
11 3 9 1 empty Control control_empty
11 3 9 2 empty Control control_empty
11 3 9 3 empty Control control_empty
11 3 9 4 empty Control control_empty
11 3 9 5 empty Control control_empty
11 3 9 6 empty Control control_empty
11 3 9 7 empty Control control_empty
11 3 9 8 empty Control control_empty
11 3 9 9 empty Control control_empty
11 3 9 10 empty Control control_empty
11 3 9 11 empty Control control_empty
11 3 9 12 empty Control control_empty
11 3 9 13 empty Control control_empty
11 3 9 14 empty Control control_empty
11 3 10 1 empty Control control_empty
11 3 10 2 empty Control control_empty
11 3 10 3 empty Control control_empty
11 3 10 4 empty Control control_empty
11 3 10 5 empty Control control_empty
11 3 10 6 empty Control control_empty
11 3 10 7 empty Control control_empty
11 3 10 8 empty Control control_empty
11 3 10 9 empty Control control_empty
11 3 10 10 empty Control control_empty
11 3 10 11 empty Control control_empty
11 3 10 12 empty Control control_empty
11 3 10 13 empty Control control_empty
11 3 10 14 empty Control control_empty
11 3 11 1 empty Control control_empty
11 3 11 2 empty Control control_empty
11 3 11 3 empty Control control_empty
11 3 11 4 empty Control control_empty
11 3 11 5 empty Control control_empty
11 3 11 6 empty Control control_empty
11 3 11 7 empty Control control_empty
11 3 11 8 empty Control control_empty
11 3 11 9 empty Control control_empty
11 3 11 10 empty Control control_empty
11 3 11 11 empty Control control_empty
11 3 11 12 empty Control control_empty
11 3 11 13 empty Control control_empty
11 3 11 14 empty Control control_empty
11 3 12 1 empty Control control_empty
11 3 12 2 empty Control control_empty
11 3 12 3 empty Control control_empty
11 3 12 4 empty Control control_empty
11 3 12 5 empty Control control_empty
11 3 12 6 empty Control control_empty
11 3 12 7 empty Control control_empty
11 3 12 8 empty Control control_empty
11 3 12 9 empty Control control_empty
11 3 12 10 empty Control control_empty
11 3 12 11 empty Control control_empty
11 3 12 12 empty Control control_empty
11 3 12 13 empty Control control_empty
11 3 12 14 empty Control control_empty
11 3 13 1 empty Control control_empty
11 3 13 2 empty Control control_empty
11 3 13 3 empty Control control_empty
11 3 13 4 empty Control control_empty
11 3 13 5 empty Control control_empty
11 3 13 6 empty Control control_empty
11 3 13 7 empty Control control_empty
11 3 13 8 empty Control control_empty
11 3 13 9 empty Control control_empty
11 3 13 10 empty Control control_empty
11 3 13 11 empty Control control_empty
11 3 13 12 empty Control control_empty
11 3 13 13 empty Control control_empty
11 3 13 14 empty Control control_empty
11 3 14 1 empty Control control_empty
11 3 14 2 empty Control control_empty
11 3 14 3 empty Control control_empty
11 3 14 4 empty Control control_empty
11 3 14 5 empty Control control_empty
11 3 14 6 empty Control control_empty
11 3 14 7 empty Control control_empty
11 3 14 8 empty Control control_empty
11 3 14 9 empty Control control_empty
11 3 14 10 empty Control control_empty
11 3 14 11 empty Control control_empty
11 3 14 12 empty Control control_empty
11 3 14 13 empty Control control_empty
11 3 14 14 empty Control control_empty
11 4 7 1 empty Control control_empty
11 4 7 2 empty Control control_empty
11 4 7 3 empty Control control_empty
11 4 7 4 empty Control control_empty
11 4 7 5 empty Control control_empty
11 4 7 6 empty Control control_empty
11 4 7 7 empty Control control_empty
11 4 7 8 empty Control control_empty
11 4 7 9 empty Control control_empty
11 4 7 10 empty Control control_empty
11 4 8 1 empty Control control_empty
11 4 8 2 empty Control control_empty
11 4 8 3 empty Control control_empty
11 4 8 4 empty Control control_empty
11 4 8 5 empty Control control_empty
11 4 8 6 empty Control control_empty
11 4 8 7 empty Control control_empty
11 4 8 8 empty Control control_empty
11 4 8 9 empty Control control_empty
11 4 8 10 empty Control control_empty
11 4 8 11 empty Control control_empty
11 4 8 12 empty Control control_empty
11 4 8 13 empty Control control_empty
11 4 8 14 empty Control control_empty
11 4 9 1 empty Control control_empty
11 4 9 2 empty Control control_empty
11 4 9 3 empty Control control_empty
11 4 9 4 empty Control control_empty
11 4 9 5 empty Control control_empty
11 4 9 6 empty Control control_empty
11 4 9 7 empty Control control_empty
11 4 9 8 empty Control control_empty
11 4 9 9 empty Control control_empty
11 4 9 10 empty Control control_empty
11 4 9 11 empty Control control_empty
11 4 9 12 empty Control control_empty
11 4 9 13 empty Control control_empty
11 4 9 14 empty Control control_empty
11 4 10 1 empty Control control_empty
11 4 10 2 empty Control control_empty
11 4 10 3 empty Control control_empty
11 4 10 4 empty Control control_empty
11 4 10 5 empty Control control_empty
11 4 10 6 empty Control control_empty
11 4 10 7 empty Control control_empty
11 4 10 8 empty Control control_empty
11 4 10 9 empty Control control_empty
11 4 10 10 empty Control control_empty
11 4 10 11 empty Control control_empty
11 4 10 12 empty Control control_empty
11 4 10 13 empty Control control_empty
11 4 10 14 empty Control control_empty
11 4 11 1 empty Control control_empty
11 4 11 2 empty Control control_empty
11 4 11 3 empty Control control_empty
11 4 11 4 empty Control control_empty
11 4 11 5 empty Control control_empty
11 4 11 6 empty Control control_empty
11 4 11 7 empty Control control_empty
11 4 11 8 empty Control control_empty
11 4 11 9 empty Control control_empty
11 4 11 10 empty Control control_empty
11 4 11 11 empty Control control_empty
11 4 11 12 empty Control control_empty
11 4 11 13 empty Control control_empty
11 4 11 14 empty Control control_empty
11 4 12 1 empty Control control_empty
11 4 12 2 empty Control control_empty
11 4 12 3 empty Control control_empty
11 4 12 4 empty Control control_empty
11 4 12 5 empty Control control_empty
11 4 12 6 empty Control control_empty
11 4 12 7 empty Control control_empty
11 4 12 8 empty Control control_empty
11 4 12 9 empty Control control_empty
11 4 12 10 empty Control control_empty
11 4 12 11 empty Control control_empty
11 4 12 12 empty Control control_empty
11 4 12 13 empty Control control_empty
11 4 12 14 empty Control control_empty
11 4 13 1 empty Control control_empty
11 4 13 2 empty Control control_empty
11 4 13 3 empty Control control_empty
11 4 13 4 empty Control control_empty
11 4 13 5 empty Control control_empty
11 4 13 6 empty Control control_empty
11 4 13 7 empty Control control_empty
11 4 13 8 empty Control control_empty
11 4 13 9 empty Control control_empty
11 4 13 10 empty Control control_empty
11 4 13 11 empty Control control_empty
11 4 13 12 empty Control control_empty
11 4 13 13 empty Control control_empty
11 4 13 14 empty Control control_empty
11 4 14 1 empty Control control_empty
11 4 14 2 empty Control control_empty
11 4 14 3 empty Control control_empty
11 4 14 4 empty Control control_empty
11 4 14 5 empty Control control_empty
11 4 14 6 empty Control control_empty
11 4 14 7 empty Control control_empty
11 4 14 8 empty Control control_empty
11 4 14 9 empty Control control_empty
11 4 14 10 empty Control control_empty
11 4 14 11 empty Control control_empty
11 4 14 12 empty Control control_empty
11 4 14 13 empty Control control_empty
11 4 14 14 empty Control control_empty
12 1 6 1 empty Control control_empty
12 1 7 1 empty Control control_empty
12 1 7 2 empty Control control_empty
12 1 7 3 empty Control control_empty
12 1 7 4 empty Control control_empty
12 1 7 5 empty Control control_empty
12 1 7 6 empty Control control_empty
12 1 7 7 empty Control control_empty
12 1 7 8 empty Control control_empty
12 1 7 9 empty Control control_empty
12 1 7 10 empty Control control_empty
12 1 7 11 empty Control control_empty
12 1 7 12 empty Control control_empty
12 1 7 13 empty Control control_empty
12 1 7 14 empty Control control_empty
12 1 8 1 empty Control control_empty
12 1 8 2 empty Control control_empty
12 1 8 3 empty Control control_empty
12 1 8 4 empty Control control_empty
12 1 8 5 empty Control control_empty
12 1 8 6 empty Control control_empty
12 1 8 7 empty Control control_empty
12 1 8 8 empty Control control_empty
12 1 8 9 empty Control control_empty
12 1 8 10 empty Control control_empty
12 1 8 11 empty Control control_empty
12 1 8 12 empty Control control_empty
12 1 8 13 empty Control control_empty
12 1 8 14 empty Control control_empty
12 1 9 1 empty Control control_empty
12 1 9 2 empty Control control_empty
12 1 9 3 empty Control control_empty
12 1 9 4 empty Control control_empty
12 1 9 5 empty Control control_empty
12 1 9 6 empty Control control_empty
12 1 9 7 empty Control control_empty
12 1 9 8 empty Control control_empty
12 1 9 9 empty Control control_empty
12 1 9 10 empty Control control_empty
12 1 9 11 empty Control control_empty
12 1 9 12 empty Control control_empty
12 1 9 13 empty Control control_empty
12 1 9 14 empty Control control_empty
12 1 10 1 empty Control control_empty
12 1 10 2 empty Control control_empty
12 1 10 3 empty Control control_empty
12 1 10 4 empty Control control_empty
12 1 10 5 empty Control control_empty
12 1 10 6 empty Control control_empty
12 1 10 7 empty Control control_empty
12 1 10 8 empty Control control_empty
12 1 10 9 empty Control control_empty
12 1 10 10 empty Control control_empty
12 1 10 11 empty Control control_empty
12 1 10 12 empty Control control_empty
12 1 10 13 empty Control control_empty
12 1 10 14 empty Control control_empty
12 1 11 1 empty Control control_empty
12 1 11 2 empty Control control_empty
12 1 11 3 empty Control control_empty
12 1 11 4 empty Control control_empty
12 1 11 5 empty Control control_empty
12 1 11 6 empty Control control_empty
12 1 11 7 empty Control control_empty
12 1 11 8 empty Control control_empty
12 1 11 9 empty Control control_empty
12 1 11 10 empty Control control_empty
12 1 11 11 empty Control control_empty
12 1 11 12 empty Control control_empty
12 1 11 13 empty Control control_empty
12 1 11 14 empty Control control_empty
12 1 12 1 empty Control control_empty
12 1 12 2 empty Control control_empty
12 1 12 3 empty Control control_empty
12 1 12 4 empty Control control_empty
12 1 12 5 empty Control control_empty
12 1 12 6 empty Control control_empty
12 1 12 7 empty Control control_empty
12 1 12 8 empty Control control_empty
12 1 12 9 empty Control control_empty
12 1 12 10 empty Control control_empty
12 1 12 11 empty Control control_empty
12 1 12 12 empty Control control_empty
12 1 12 13 empty Control control_empty
12 1 12 14 empty Control control_empty
12 1 13 1 empty Control control_empty
12 1 13 2 empty Control control_empty
12 1 13 3 empty Control control_empty
12 1 13 4 empty Control control_empty
12 1 13 5 empty Control control_empty
12 1 13 6 empty Control control_empty
12 1 13 7 empty Control control_empty
12 1 13 8 empty Control control_empty
12 1 13 9 empty Control control_empty
12 1 13 10 empty Control control_empty
12 1 13 11 empty Control control_empty
12 1 13 12 empty Control control_empty
12 1 13 13 empty Control control_empty
12 1 13 14 empty Control control_empty
12 1 14 1 empty Control control_empty
12 1 14 2 empty Control control_empty
12 1 14 3 empty Control control_empty
12 1 14 4 empty Control control_empty
12 1 14 5 empty Control control_empty
12 1 14 6 empty Control control_empty
12 1 14 7 empty Control control_empty
12 1 14 8 empty Control control_empty
12 1 14 9 empty Control control_empty
12 1 14 10 empty Control control_empty
12 1 14 11 empty Control control_empty
12 1 14 12 empty Control control_empty
12 1 14 13 empty Control control_empty
12 1 14 14 empty Control control_empty
12 2 6 1 empty Control control_empty
12 2 6 2 empty Control control_empty
12 2 6 3 empty Control control_empty
12 2 6 4 empty Control control_empty
12 2 6 5 empty Control control_empty
12 2 6 6 empty Control control_empty
12 2 6 7 empty Control control_empty
12 2 6 8 empty Control control_empty
12 2 6 9 empty Control control_empty
12 2 6 10 empty Control control_empty
12 2 6 11 empty Control control_empty
12 2 6 12 empty Control control_empty
12 2 6 13 empty Control control_empty
12 2 6 14 empty Control control_empty
12 2 7 1 empty Control control_empty
12 2 7 2 empty Control control_empty
12 2 7 3 empty Control control_empty
12 2 7 4 empty Control control_empty
12 2 7 5 empty Control control_empty
12 2 7 6 empty Control control_empty
12 2 7 7 empty Control control_empty
12 2 7 8 empty Control control_empty
12 2 7 9 empty Control control_empty
12 2 7 10 empty Control control_empty
12 2 7 14 empty Control control_empty
12 2 8 1 empty Control control_empty
12 2 8 2 empty Control control_empty
12 2 8 3 empty Control control_empty
12 2 8 4 empty Control control_empty
12 2 8 5 empty Control control_empty
12 2 8 6 empty Control control_empty
12 2 8 7 empty Control control_empty
12 2 8 8 empty Control control_empty
12 2 8 9 empty Control control_empty
12 2 8 10 empty Control control_empty
12 2 8 11 empty Control control_empty
12 2 8 12 empty Control control_empty
12 2 8 13 empty Control control_empty
12 2 8 14 empty Control control_empty
12 2 9 1 empty Control control_empty
12 2 9 2 empty Control control_empty
12 2 9 3 empty Control control_empty
12 2 9 4 empty Control control_empty
12 2 9 5 empty Control control_empty
12 2 9 6 empty Control control_empty
12 2 9 7 empty Control control_empty
12 2 9 8 empty Control control_empty
12 2 9 9 empty Control control_empty
12 2 9 10 empty Control control_empty
12 2 9 11 empty Control control_empty
12 2 9 12 empty Control control_empty
12 2 9 13 empty Control control_empty
12 2 9 14 empty Control control_empty
12 2 10 1 empty Control control_empty
12 2 10 2 empty Control control_empty
12 2 10 3 empty Control control_empty
12 2 10 4 empty Control control_empty
12 2 10 5 empty Control control_empty
12 2 10 6 empty Control control_empty
12 2 10 7 empty Control control_empty
12 2 10 8 empty Control control_empty
12 2 10 9 empty Control control_empty
12 2 10 10 empty Control control_empty
12 2 10 11 empty Control control_empty
12 2 10 12 empty Control control_empty
12 2 10 13 empty Control control_empty
12 2 10 14 empty Control control_empty
12 2 11 1 empty Control control_empty
12 2 11 2 empty Control control_empty
12 2 11 3 empty Control control_empty
12 2 11 4 empty Control control_empty
12 2 11 5 empty Control control_empty
12 2 11 6 empty Control control_empty
12 2 11 7 empty Control control_empty
12 2 11 8 empty Control control_empty
12 2 11 9 empty Control control_empty
12 2 11 10 empty Control control_empty
12 2 11 11 empty Control control_empty
12 2 11 12 empty Control control_empty
12 2 11 13 empty Control control_empty
12 2 11 14 empty Control control_empty
12 2 12 1 empty Control control_empty
12 2 12 2 empty Control control_empty
12 2 12 3 empty Control control_empty
12 2 12 4 empty Control control_empty
12 2 12 5 empty Control control_empty
12 2 12 6 empty Control control_empty
12 2 12 7 empty Control control_empty
12 2 12 8 empty Control control_empty
12 2 12 9 empty Control control_empty
12 2 12 10 empty Control control_empty
12 2 12 11 empty Control control_empty
12 2 12 12 empty Control control_empty
12 2 12 13 empty Control control_empty
12 2 12 14 empty Control control_empty
12 2 13 1 empty Control control_empty
12 2 13 2 empty Control control_empty
12 2 13 3 empty Control control_empty
12 2 13 4 empty Control control_empty
12 2 13 5 empty Control control_empty
12 2 13 6 empty Control control_empty
12 2 13 7 empty Control control_empty
12 2 13 8 empty Control control_empty
12 2 13 9 empty Control control_empty
12 2 13 10 empty Control control_empty
12 2 13 11 empty Control control_empty
12 2 13 12 empty Control control_empty
12 2 13 13 empty Control control_empty
12 2 13 14 empty Control control_empty
12 2 14 1 empty Control control_empty
12 2 14 2 empty Control control_empty
12 2 14 3 empty Control control_empty
12 2 14 4 empty Control control_empty
12 2 14 5 empty Control control_empty
12 2 14 6 empty Control control_empty
12 2 14 7 empty Control control_empty
12 2 14 8 empty Control control_empty
12 2 14 9 empty Control control_empty
12 2 14 10 empty Control control_empty
12 2 14 11 empty Control control_empty
12 2 14 12 empty Control control_empty
12 2 14 13 empty Control control_empty
12 2 14 14 empty Control control_empty
12 3 7 1 empty Control control_empty
12 3 7 2 empty Control control_empty
12 3 7 3 empty Control control_empty
12 3 7 4 empty Control control_empty
12 3 7 5 empty Control control_empty
12 3 7 6 empty Control control_empty
12 3 7 7 empty Control control_empty
12 3 7 8 empty Control control_empty
12 3 7 9 empty Control control_empty
12 3 7 10 empty Control control_empty
12 3 8 1 empty Control control_empty
12 3 8 2 empty Control control_empty
12 3 8 3 empty Control control_empty
12 3 8 4 empty Control control_empty
12 3 8 5 empty Control control_empty
12 3 8 6 empty Control control_empty
12 3 8 7 empty Control control_empty
12 3 8 8 empty Control control_empty
12 3 8 9 empty Control control_empty
12 3 8 10 empty Control control_empty
12 3 8 11 empty Control control_empty
12 3 8 12 empty Control control_empty
12 3 8 13 empty Control control_empty
12 3 8 14 empty Control control_empty
12 3 9 1 empty Control control_empty
12 3 9 2 empty Control control_empty
12 3 9 3 empty Control control_empty
12 3 9 4 empty Control control_empty
12 3 9 5 empty Control control_empty
12 3 9 6 empty Control control_empty
12 3 9 7 empty Control control_empty
12 3 9 8 empty Control control_empty
12 3 9 9 empty Control control_empty
12 3 9 10 empty Control control_empty
12 3 9 11 empty Control control_empty
12 3 9 12 empty Control control_empty
12 3 9 13 empty Control control_empty
12 3 9 14 empty Control control_empty
12 3 10 1 empty Control control_empty
12 3 10 2 empty Control control_empty
12 3 10 3 empty Control control_empty
12 3 10 4 empty Control control_empty
12 3 10 5 empty Control control_empty
12 3 10 6 empty Control control_empty
12 3 10 7 empty Control control_empty
12 3 10 8 empty Control control_empty
12 3 10 9 empty Control control_empty
12 3 10 10 empty Control control_empty
12 3 10 11 empty Control control_empty
12 3 10 12 empty Control control_empty
12 3 10 13 empty Control control_empty
12 3 10 14 empty Control control_empty
12 3 11 1 empty Control control_empty
12 3 11 2 empty Control control_empty
12 3 11 3 empty Control control_empty
12 3 11 4 empty Control control_empty
12 3 11 5 empty Control control_empty
12 3 11 6 empty Control control_empty
12 3 11 7 empty Control control_empty
12 3 11 8 empty Control control_empty
12 3 11 9 empty Control control_empty
12 3 11 10 empty Control control_empty
12 3 11 11 empty Control control_empty
12 3 11 12 empty Control control_empty
12 3 11 13 empty Control control_empty
12 3 11 14 empty Control control_empty
12 3 12 1 empty Control control_empty
12 3 12 2 empty Control control_empty
12 3 12 3 empty Control control_empty
12 3 12 4 empty Control control_empty
12 3 12 5 empty Control control_empty
12 3 12 6 empty Control control_empty
12 3 12 7 empty Control control_empty
12 3 12 8 empty Control control_empty
12 3 12 9 empty Control control_empty
12 3 12 10 empty Control control_empty
12 3 12 11 empty Control control_empty
12 3 12 12 empty Control control_empty
12 3 12 13 empty Control control_empty
12 3 12 14 empty Control control_empty
12 3 13 1 empty Control control_empty
12 3 13 2 empty Control control_empty
12 3 13 3 empty Control control_empty
12 3 13 4 empty Control control_empty
12 3 13 5 empty Control control_empty
12 3 13 6 empty Control control_empty
12 3 13 7 empty Control control_empty
12 3 13 8 empty Control control_empty
12 3 13 9 empty Control control_empty
12 3 13 10 empty Control control_empty
12 3 13 11 empty Control control_empty
12 3 13 12 empty Control control_empty
12 3 13 13 empty Control control_empty
12 3 13 14 empty Control control_empty
12 3 14 1 empty Control control_empty
12 3 14 2 empty Control control_empty
12 3 14 3 empty Control control_empty
12 3 14 4 empty Control control_empty
12 3 14 5 empty Control control_empty
12 3 14 6 empty Control control_empty
12 3 14 7 empty Control control_empty
12 3 14 8 empty Control control_empty
12 3 14 9 empty Control control_empty
12 3 14 10 empty Control control_empty
12 3 14 11 empty Control control_empty
12 3 14 12 empty Control control_empty
12 3 14 13 empty Control control_empty
12 3 14 14 empty Control control_empty
12 4 6 1 empty Control control_empty
12 4 6 2 empty Control control_empty
12 4 6 3 empty Control control_empty
12 4 6 4 empty Control control_empty
12 4 6 5 empty Control control_empty
12 4 6 6 empty Control control_empty
12 4 6 7 empty Control control_empty
12 4 6 8 empty Control control_empty
12 4 6 9 empty Control control_empty
12 4 6 10 empty Control control_empty
12 4 6 11 empty Control control_empty
12 4 6 12 empty Control control_empty
12 4 6 13 empty Control control_empty
12 4 6 14 empty Control control_empty
12 4 7 1 empty Control control_empty
12 4 7 2 empty Control control_empty
12 4 7 3 empty Control control_empty
12 4 7 4 empty Control control_empty
12 4 7 5 empty Control control_empty
12 4 7 6 empty Control control_empty
12 4 7 7 empty Control control_empty
12 4 7 8 empty Control control_empty
12 4 7 9 empty Control control_empty
12 4 7 10 empty Control control_empty
12 4 7 11 empty Control control_empty
12 4 7 12 empty Control control_empty
12 4 7 13 empty Control control_empty
12 4 7 14 empty Control control_empty
12 4 8 1 empty Control control_empty
12 4 8 2 empty Control control_empty
12 4 8 3 empty Control control_empty
12 4 8 4 empty Control control_empty
12 4 8 5 empty Control control_empty
12 4 8 6 empty Control control_empty
12 4 8 7 empty Control control_empty
12 4 8 8 empty Control control_empty
12 4 8 9 empty Control control_empty
12 4 8 10 empty Control control_empty
12 4 8 11 empty Control control_empty
12 4 8 12 empty Control control_empty
12 4 8 13 empty Control control_empty
12 4 8 14 empty Control control_empty
12 4 9 1 empty Control control_empty
12 4 9 2 empty Control control_empty
12 4 9 3 empty Control control_empty
12 4 9 4 empty Control control_empty
12 4 9 5 empty Control control_empty
12 4 9 6 empty Control control_empty
12 4 9 7 empty Control control_empty
12 4 9 8 empty Control control_empty
12 4 9 9 empty Control control_empty
12 4 9 10 empty Control control_empty
12 4 9 11 empty Control control_empty
12 4 9 12 empty Control control_empty
12 4 9 13 empty Control control_empty
12 4 9 14 empty Control control_empty
12 4 10 1 empty Control control_empty
12 4 10 2 empty Control control_empty
12 4 10 3 empty Control control_empty
12 4 10 4 empty Control control_empty
12 4 10 5 empty Control control_empty
12 4 10 6 empty Control control_empty
12 4 10 7 empty Control control_empty
12 4 10 8 empty Control control_empty
12 4 10 9 empty Control control_empty
12 4 10 10 empty Control control_empty
12 4 10 11 empty Control control_empty
12 4 10 12 empty Control control_empty
12 4 10 13 empty Control control_empty
12 4 10 14 empty Control control_empty
12 4 11 1 empty Control control_empty
12 4 11 2 empty Control control_empty
12 4 11 3 empty Control control_empty
12 4 11 4 empty Control control_empty
12 4 11 5 empty Control control_empty
12 4 11 6 empty Control control_empty
12 4 11 7 empty Control control_empty
12 4 11 8 empty Control control_empty
12 4 11 9 empty Control control_empty
12 4 11 10 empty Control control_empty
12 4 11 11 empty Control control_empty
12 4 11 12 empty Control control_empty
12 4 11 13 empty Control control_empty
12 4 11 14 empty Control control_empty
12 4 12 1 empty Control control_empty
12 4 12 2 empty Control control_empty
12 4 12 3 empty Control control_empty
12 4 12 4 empty Control control_empty
12 4 12 5 empty Control control_empty
12 4 12 6 empty Control control_empty
12 4 12 7 empty Control control_empty
12 4 12 8 empty Control control_empty
12 4 12 9 empty Control control_empty
12 4 12 10 empty Control control_empty
12 4 12 11 empty Control control_empty
12 4 12 12 empty Control control_empty
12 4 12 13 empty Control control_empty
12 4 12 14 empty Control control_empty
12 4 13 1 empty Control control_empty
12 4 13 2 empty Control control_empty
12 4 13 3 empty Control control_empty
12 4 13 4 empty Control control_empty
12 4 13 5 empty Control control_empty
12 4 13 6 empty Control control_empty
12 4 13 7 empty Control control_empty
12 4 13 8 empty Control control_empty
12 4 13 9 empty Control control_empty
12 4 13 10 empty Control control_empty
12 4 13 11 empty Control control_empty
12 4 13 12 empty Control control_empty
12 4 13 13 empty Control control_empty
12 4 13 14 empty Control control_empty
12 4 14 1 empty Control control_empty
12 4 14 2 empty Control control_empty
12 4 14 3 empty Control control_empty
12 4 14 4 empty Control control_empty
12 4 14 5 empty Control control_empty
12 4 14 6 empty Control control_empty
12 4 14 7 empty Control control_empty
12 4 14 8 empty Control control_empty
12 4 14 9 empty Control control_empty
12 4 14 10 empty Control control_empty
12 4 14 11 empty Control control_empty
12 4 14 12 empty Control control_empty
12 4 14 13 empty Control control_empty
12 4 14 14 empty Control control_empty