2 protocols
AccessionType
nucleic acid library construction protocol
Trizol reagent was used to isolate total RNA from human cells. PNK treated total RNA was purified with the RNA clean and concentrator kit (Zymo Research). 120 pmol of 5’ phosphorylated 3’ RACE adapter oligonucleotide (cctatagtgagtcgtattaattctgtgctcgc(tdd)) were mixed with 3 µg of purified RNA and ligated with T4 RNA ligase as above. 1 µg of ligated RNA was reverse-transcribed with Superscript III (Invitrogen) using adapter-specific oligonucleotide (GCGAGCACAGAATTAATACGACT). cDNA was PCR-amplified with the Phusion High-Fidelity PCR kit (Thermo Scientific) and PCR products were sequenced. Primers to amplify human U6 (acactctttccctacacgacgctcttccgatctcggcagcacatatactaaaattggaac + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg); Primers to amplify U6atac (acactctttccctacacgacgctcttccgatcttgttgtatgaaaggagagaaggttagcactc + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg); Primers to amplify vtRNA1-1 (acactctttccctacacgacgctcttccgatctgctggctttagctcagcggttacttcg + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg)
growth protocol
PNFF-derived cells were maintained in DMEM supplemented with 20% fetal bovine serum, non-essential amino acids, penicillin/streptomycin