ID JX892929; SV 1; circular; genomic RNA; STD; VRL; 221 BP. XX AC JX892929; XX DT 14-NOV-2012 (Rel. 114, Created) DT 18-NOV-2012 (Rel. 114, Last updated, Version 2) XX DE Grapevine yellow speckle viroid 1 clone 17 nonsymptomatic, complete genome. XX KW . XX OS Grapevine yellow speckle viroid 1 OC Viruses; Riboviria; Pospiviroidae; Apscaviroid. XX RN [1] RP 1-221 RA Salman T.M., Habili N., Randles J.W.; RT "Symptomatic and nonsymptomatic sequence variant of Grapevine yellow RT speckle viroid 1"; RL Unpublished. XX RN [2] RP 1-221 RA Salman T.M., Habili N., Randles J.W.; RT ; RL Submitted (01-OCT-2012) to the INSDC. RL School of Agriculture, Food and Wine, the University of Adelaide, Waite RL Road, URRBRAE, SA 5064, Australia XX DR MD5; 7be2e55db423d125a4dee1e926565d56. XX FH Key Location/Qualifiers FH FT source 1..221 FT /organism="Grapevine yellow speckle viroid 1" FT /host="Vitis vinifera cv. Chardonnay" FT /isolate="Chardonnay I10V1" FT /mol_type="genomic RNA" FT /country="Australia" FT /collected_by="Thaeer M. Salman" FT /collection_date="Apr-2012" FT /clone="17 nonsymptomatic" FT /PCR_primers="fwd_name: pbcvd94h, fwd_seq: FT tgtcccgctagtcgagcgga, rev_name: pbcvd100c, rev_seq: FT agacccttcgtcgacgacga" FT /db_xref="taxon:12904" XX SQ Sequence 221 BP; 43 A; 66 C; 66 G; 46 T; 0 other; ccgctagtcg agcggacttg gtctcttccg cccaaagccc tttttctttc aactgagctt 60 gtttccaacg cgccccgcga gtggaatccc cggaacccct gcaaagaggt cctcggatca 120 ctttcctgtg gttcctgtgg ttacacctcg gaaggccgcc gcggacctgc aaagaagaag 180 ataggggcag agggggagtg agcctcgtcg tcgacgaagg g 221 //