ID   JN029953; SV 1; linear; genomic RNA; STD; VRL; 339 BP.
XX
AC   JN029953;
XX
DT   18-SEP-2011 (Rel. 110, Created)
DT   24-FEB-2012 (Rel. 111, Last updated, Version 3)
XX
DE   Cucumber mosaic virus satellite RNA isolate IR-NY, complete sequence.
XX
KW   .
XX
OS   Cucumber mosaic virus satellite RNA
OC   Viruses; Satellites; RNA satellites; Single stranded RNA satellites;
OC   Small linear single stranded RNA satellites.
XX
RN   [1]
RP   1-339
RX   DOI; 10.1007/s00705-011-1154-1.
RX   PUBMED; 22038072.
RA   Nouri S., Falk B.W., Groves R.L.;
RT   "A new satellite RNA is associated with natural infections of cucumber
RT   mosaic virus in succulent snap bean";
RL   Arch. Virol. 157(2):375-377(2012).
XX
RN   [2]
RP   1-339
RA   Nouri S.;
RT   ;
RL   Submitted (22-MAY-2011) to the INSDC.
RL   Plant Pathology, University of Wisconsin-Madison, 537 Russell Labs., 1630
RL   Linden Dr., Madison, WI 53706, USA
XX
DR   MD5; 2789ccaed325781ba0e6f0c8838c0454.
DR   EuropePMC; PMC3268982; 22038072.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..339
FT                   /organism="Cucumber mosaic virus satellite RNA"
FT                   /host="snap bean"
FT                   /isolate="IR-NY"
FT                   /mol_type="genomic RNA"
FT                   /country="USA"
FT                   /collection_date="2009"
FT                   /PCR_primers="fwd_name: sat f, fwd_seq:
FT                   gggaattcatttaggtgacactatagttttgtttg, rev_name: sat r,
FT                   rev_seq: ggggtctagacccgggtcctg"
FT                   /db_xref="taxon:12436"
XX
SQ   Sequence 339 BP; 70 A; 87 C; 94 G; 88 T; 0 other;
     gttttgtttg ttagagaatt gcgtagaggg gttgtatcta cgtgaggatc tatcactcgg        60
     cggtgtgggt tacctccctg ctacggcggg ttgagttgac gcacctcgga ctggggaccg       120
     ctggcctgag ggctatgtcc gctactctca gcactgcgct ctcatttgag cccccgctca       180
     gtttgctagc aaaacccggc ccatggtttg ccgttaccgt ggaaatttcg aaagaaacac       240
     tctgttaggt ggtatcgtgg atgacgcaca cagggagaag ctaaaaccta tatggtcatg       300
     ctgatctccg cgtatgtaca tcataccctc acaggaccc                              339
//