ID FJ751930; SV 1; circular; genomic RNA; STD; VRL; 395 BP. XX AC FJ751930; XX DT 13-APR-2009 (Rel. 100, Created) DT 13-APR-2009 (Rel. 100, Last updated, Version 1) XX DE Citrus exocortis Yucatan viroid isolate 12, complete genome. XX KW . XX OS Citrus exocortis Yucatan viroid OC Viruses; Riboviria; Pospiviroidae; Pospiviroid. XX RN [1] RP 1-395 RA Uc-Varguez A., Moreno-Valenzuela O.A.; RT "Molecular characterization of a population of Citrus Exocortis Viroid-Low RT sequence similarity (CEVd-LSS), a tentative new citrus viroid isolated in RT citrus species in Yucatan, Mexico"; RL Unpublished. XX RN [2] RP 1-395 RA Uc-Varguez A., Moreno-Valenzuela O.A.; RT ; RL Submitted (13-FEB-2009) to the INSDC. RL UBBMP, Centro de Investigacion Cientifica de Yucatan, 43, Merida, Yucatan RL 97200, Mexico XX DR MD5; 4ac52c0be72422f87e7e58d0a026e94a. XX FH Key Location/Qualifiers FH FT source 1..395 FT /organism="Citrus exocortis Yucatan viroid" FT /isolate="12" FT /mol_type="genomic RNA" FT /PCR_primers="fwd_name: CEVd-F, fwd_seq: FT ccctgaaggacttcttcccc, rev_name: CEVd-R, rev_seq: FT atccccggggaaacctggaggaag" FT /note="similar to mitochondrial small subunit ribosomal FT RNA" FT /db_xref="taxon:596768" XX SQ Sequence 395 BP; 93 A; 100 C; 118 G; 84 T; 0 other; atccccgggg aaacctggag gaaggtgggg atgacgtcaa gtccgcatgg cccttatggg 60 ctgggccaca cacgtgctac aatggcaatt acaatgggaa gcaaggctgt aaggcggagc 120 gaatccggaa agattgcctc agttcggatt gttctctgca actcgggaac atgaagttgg 180 aatcgctagt aatcgcggat cagcatgccg cggtgaatat gtacccgggc cctgtacaca 240 ccgcccgtca caccctggga attggtttcg cccgaagcat cggaccaatg atcacccatg 300 acttctgtgt accactagtg ccacaaaggc ttttggtggt cttattggcg cataccacgg 360 tggggtcttc gactggggaa gaagtcctta caggg 395 //