ID FJ751926; SV 1; circular; genomic RNA; STD; VRL; 395 BP. XX AC FJ751926; XX DT 13-APR-2009 (Rel. 100, Created) DT 13-APR-2009 (Rel. 100, Last updated, Version 1) XX DE Citrus exocortis Yucatan viroid isolate 8, complete genome. XX KW . XX OS Citrus exocortis Yucatan viroid OC Viruses; Riboviria; Pospiviroidae; Pospiviroid. XX RN [1] RP 1-395 RA Uc-Varguez A., Moreno-Valenzuela O.A.; RT "Molecular characterization of a population of Citrus Exocortis Yucatan RT Viroid (CEYVD), a tentative new citrus viroid isolated in citrus species in RT Yucatan, Mexico"; RL Unpublished. XX RN [2] RP 1-395 RA Uc-Varguez A., Moreno-Valenzuela O.A.; RT ; RL Submitted (13-FEB-2009) to the INSDC. RL UBBMP, Centro de Investigacion Cientifica de Yucatan, 43, Merida, Yucatan RL 97200, Mexico XX DR MD5; bb8963593b97d9759da4009b1d0a98fe. XX FH Key Location/Qualifiers FH FT source 1..395 FT /organism="Citrus exocortis Yucatan viroid" FT /isolate="8" FT /mol_type="genomic RNA" FT /PCR_primers="fwd_name: CEVd-F, fwd_seq: FT ccctgaaggacttcttcccc, rev_name: CEVd-R, rev_seq: FT atccccggggaaacctggaggaag" FT /note="similar to mitochondrial small subunit ribosomal FT RNA" FT /db_xref="taxon:596768" XX SQ Sequence 395 BP; 92 A; 100 C; 118 G; 85 T; 0 other; atccccgggg aaacctggag gaaggtgggg atgacgtcaa gtccgcatgg cccttatggg 60 ctgggccaca cacgtgctac aatggcaatt acaatgggaa gcaaggctgt aaggcggagc 120 gaatccggaa agattgcctc agttcggatt gttctctgca actcgggaac atgaagttgg 180 aatcgctagt aatcgcggat cagcatgccg cggtgaatat gtacccgggc cctgtacaca 240 ccgcccgtca caccctggga attggtttcg cccgaagcat cggaccaatg atcacccatg 300 acttctgtgt accactagtg ccacaaaggc ttttggtggt cttattggcg cataccacgg 360 tggggtcttc gatctgggga agaagtcctt caggg 395 //