ID EU382204; SV 1; circular; genomic RNA; STD; VRL; 370 BP. XX AC EU382204; XX DT 05-FEB-2008 (Rel. 94, Created) DT 07-SEP-2010 (Rel. 106, Last updated, Version 2) XX DE Citrus exocortis viroid isolate Severe clone 3, complete genome. XX KW . XX OS Citrus exocortis viroid OC Viruses; Riboviria; Pospiviroidae; Pospiviroid. XX RN [1] RP 1-370 RX DOI; 10.1094/PDIS-92-6-0978B. RX AGRICOLA; IND44108216. RA Wang X.F., Zhou C.Y., Tang K.Z., Li Z.A.; RT "Occurrence of Four Citrus Viroids in Chongqing, China"; RL Plant Dis. 92(6):978-978(2008). XX RN [2] RP 1-370 RA Wang X., Tang K., Li Z., Zhou C.; RT ; RL Submitted (09-JAN-2008) to the INSDC. RL National Citrus Virus Exclusion Center, Citrus Resrearch Institute of RL Chinese Academy of Agriculture Science, No.15 Citrus Village, Beibei, RL Chongqing 400712, China XX DR MD5; ed5a90a628baea1b9bfeac90ef1347a0. XX FH Key Location/Qualifiers FH FT source 1..370 FT /organism="Citrus exocortis viroid" FT /isolate="Severe" FT /mol_type="genomic RNA" FT /clone="3" FT /PCR_primers="fwd_seq: ggaaacctggaggaagtcgag, rev_seq: FT ccggggatccctgaaggactt" FT /db_xref="taxon:12890" XX SQ Sequence 370 BP; 70 A; 113 C; 110 G; 77 T; 0 other; ggaaacctgg aggaagtcga ggtcgggggg gacgactgcc tcggtcgccg cggatcactg 60 gcgtccagcg gagaaacagg agctcgtctc cttcctttcg ctgctggctc cacatccgat 120 cgtcgctgag gcttcgcgcc ccctcgcccg gagcttctct ctggctacta cccggtggat 180 acaactgaag cttcaacccc aaaccgcttt tcttatatct tcactgctct ccgggcgagg 240 gtgaaagccc tcggaaccct agattgggtc cctcgggatc tttcttgagg ttcctgtggt 300 gctcacctga ccctgcaggc aggaaaagaa aaaagaggcg gcggggaaga agtccttcag 360 ggatccccgg 370 //