Identifying a sequence

An image of corn infected by a fungal disease

Background

Every year fungal diseases destroy valuable crops. In the 1970s, the USA almost lost its entire corn crop to fungal parasites, bringing economic disaster to many farmers. Much time and money is spent researching the development of new fungicides and disease-resistant transgenic plants.

Scenario

A farmer's corn field is destroyed by a particularly virulent but unknown fungal species. You manage to get a partial sequence of the gene you think is responsible for spread of the fungus. What does the culprit gene encode, and which species is it from?

 

Notes

The sequence you identified is:

GAAAAACTTTCTCAAAACAGCTGGCCCGCCCATTTAG
CTGAATTGACTGACTACCGCCCGCAGGACCTTCTTCT
TTCACTTCCTCATTCATTTGGTCTCTGGGCGAATCACC
ATGCAGATTATAAATGTGGTATACTCCTTCCTGTTTGC
GGCAGCAATGCTTCCAGTGGTTCACTCCTTAGGGATTA
ATTGTAGGGGCAGCTCGCAATGTGGGTTATCCGGCGGG
AACCTTATGGTCCG