Step 1 - Use BLAST/BLAT

Notes Use this sequence to enter the browser.

CTCCGCACTGCTCACTCCCGCGCAGTGAGGTTGGCACAGCCACCGCTCTGT

GGCTCGCTTGGTTCCCTTAGTCCCGAGCGCTCGCCCACTGCAGATTCCTTTC

CCGTGCAGACATGGCCT

 

Steps

 

  1. Start at the Ensembl home page
  2. Click on BLAST/BLAT at the top of the page
  3. Enter the sequence at the top of the BLAST/BLAT view
  4. Make sure your species of interest is chosen (Homo sapiens)
  5. Click RUN. The default program is BLAT.