spacer
spacer

PDBsum entry 1tob

Go to PDB code: 
dna_rna ligands links
RNA PDB id
1tob

 

 

 

 

Loading ...

 
JSmol PyMol  
Contents
DNA/RNA
Ligands
TOA-TOC-TOB
PDB id:
1tob
Name: RNA
Title: Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex, nmr, 7 structures
Structure: RNA (5'-r(ggcacgagguuuagcuacacucgugcc)-3'). Chain: a. Engineered: yes
Source: Synthetic: yes. Synthetic construct. Organism_taxid: 32630
NMR struc: 7 models
Authors: L.Jiang,A.K.Suri,R.Fiala,D.J.Patel
Key ref: L.Jiang et al. (1997). Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex. Chem Biol, 4, 35-50. PubMed id: 9070426
Date:
12-Dec-96     Release date:   16-Jun-97    
 Headers
 References

DNA/RNA chain
  G-G-C-A-C-G-A-G-G-U-U-U-A-G-C-U-A-C-A-C-U-C-G-U-G-C-C 27 bases

 

 
Chem Biol 4:35-50 (1997)
PubMed id: 9070426  
 
 
Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex.
L.Jiang, A.K.Suri, R.Fiala, D.J.Patel.
 
  ABSTRACT  
 
BACKGROUND: Aminoglycoside antibiotics are known to target ribosomal, retroviral and catalytic RNAs with high affinity and specificity. Recently, in vitro selection experiments have identified RNA aptamers that bind to aminoglycoside antibiotics with nanomolar affinity and stringent specificity, allowing discrimination between closely related family members. There has, to date, been limited structural information on the molecular basis of such saccharide-RNA recognition. RESULTS: We describe a solution-structure determination of the tobramycin-RNA aptamer complex, obtained using NMR and molecular dynamics. The structure gives insight into the molecular features associated with saccharide-RNA recognition. Tobramycin adopts a defined alignment and binds to the RNA major groove centered about a stem-loop junction site. A portion of the bound tobramycin is encapsulated between the floor of the major groove and a looped-out cytosine residue that forms a flap over the binding site in the complex. CONCLUSIONS: The emergence of antibiotic-resistant pathogens and their impact on human health continues to be a major concern in the medical community. Rational modification of existing antibiotics aimed at improving their efficacy requires a molecular view of their receptor-binding sites. We have provided such a molecular view for a member of the aminoglycoside antibiotic family that targets RNA.
 

Literature references that cite this PDB file's key reference

  PubMed id Reference
21051217 E.González-Fernández, N.de-los-Santos-Álvarez, M.J.Lobo-Castañón, A.J.Miranda-Ordieres, and P.Tuñón-Blanco (2011).
Impedimetric aptasensor for tobramycin detection in human serum.
  Biosens Bioelectron, 26, 2354-2360.  
19726586 D.J.Paul, S.J.Seedhouse, and M.D.Disney (2009).
Two-dimensional combinatorial screening and the RNA Privileged Space Predictor program efficiently identify aminoglycoside-RNA hairpin loop interactions.
  Nucleic Acids Res, 37, 5894-5907.  
19401772 R.Cencic, M.Carrier, G.Galicia-Vázquez, M.E.Bordeleau, R.Sukarieh, A.Bourdeau, B.Brem, J.G.Teodoro, H.Greger, M.L.Tremblay, J.A.Porco, and J.Pelletier (2009).
Antitumor activity and mechanism of action of the cyclopenta[b]benzofuran, silvestrol.
  PLoS ONE, 4, e5223.  
18000033 J.E.Weigand, M.Sanchez, E.B.Gunnesch, S.Zeiher, R.Schroeder, and B.Suess (2008).
Screening for engineered neomycin riboswitches that control translation initiation.
  RNA, 14, 89-97.  
16326918 C.M.Barbieri, and D.S.Pilch (2006).
Complete thermodynamic characterization of the multiple protonation equilibria of the aminoglycoside antibiotic paromomycin: a calorimetric and natural abundance 15N NMR study.
  Biophys J, 90, 1338-1349.  
16408312 M.Kaiser, M.Sainlos, J.M.Lehn, S.Bombard, and M.P.Teulade-Fichou (2006).
Aminoglycoside-quinacridine conjugates: towards recognition of the P6.1 element of telomerase RNA.
  Chembiochem, 7, 321-329.  
14962384 O.Ohlenschläger, J.Wöhnert, E.Bucci, S.Seitz, S.Häfner, R.Ramachandran, R.Zell, and M.Görlach (2004).
The structure of the stemloop D subdomain of coxsackievirus B3 cloverleaf RNA and its interaction with the proteinase 3C.
  Structure, 12, 237-248.
PDB code: 1rfr
15239050 S.H.Verhelst, P.J.Michiels, G.A.van der Marel, C.A.van Boeckel, and J.H.van Boom (2004).
Surface plasmon resonance evaluation of various aminoglycoside-RNA hairpin interactions reveals low degree of selectivity.
  Chembiochem, 5, 937-942.  
12925993 D.S.Pilch, M.Kaul, C.M.Barbieri, and J.E.Kerrigan (2003).
Thermodynamics of aminoglycoside-rRNA recognition.
  Biopolymers, 70, 58-79.  
11847123 F.Walter, J.Pütz, R.Giegé, and E.Westhof (2002).
Binding of tobramycin leads to conformational changes in yeast tRNA(Asp) and inhibition of aminoacylation.
  EMBO J, 21, 760-768.  
11854489 I.Harvey, P.Garneau, and J.Pelletier (2002).
Forced engagement of a RNA/protein complex by a chemical inducer of dimerization to modulate gene expression.
  Proc Natl Acad Sci U S A, 99, 1882-1887.  
12079787 Q.Vicens, and E.Westhof (2002).
Crystal structure of a complex between the aminoglycoside tobramycin and an oligonucleotide containing the ribosomal decoding a site.
  Chem Biol, 9, 747-755.
PDB code: 1lc4
12009887 S.Yoshizawa, D.Fourmy, R.G.Eason, and J.D.Puglisi (2002).
Sequence-specific recognition of the major groove of RNA by deoxystreptamine.
  Biochemistry, 41, 6263-6270.  
10715103 A.Litovchick, A.G.Evdokimov, and A.Lapidot (2000).
Aminoglycoside-arginine conjugates that bind TAR RNA: synthesis, characterization, and antiviral activity.
  Biochemistry, 39, 2838-2852.  
10637322 L.Varani, M.G.Spillantini, M.Goedert, and G.Varani (2000).
Structural basis for recognition of the RNA major groove in the tau exon 10 splicing regulatory element by aminoglycoside antibiotics.
  Nucleic Acids Res, 28, 710-719.
PDB code: 1ei2
10786841 R.D.Knight, and L.F.Landweber (2000).
Guilt by association: the arginine case revisited.
  RNA, 6, 499-510.  
10619838 R.Schroeder, C.Waldsich, and H.Wank (2000).
Modulation of RNA function by aminoglycoside antibiotics.
  EMBO J, 19, 1-9.
PDB codes: 1qhn 1qhs 1qhx 1qhy
10657289 T.Hermann, and D.J.Patel (2000).
Adaptive recognition by nucleic acid aptamers.
  Science, 287, 820-825.  
10745015 T.Hermann, and D.J.Patel (2000).
RNA bulges as architectural and recognition motifs.
  Structure, 8, R47-R54.  
10397790 C.Schneider, and J.Sühnel (1999).
A molecular dynamics simulation of the flavin mononucleotide-RNA aptamer complex.
  Biopolymers, 50, 287-302.  
10872462 D.S.Wilson, J.W.Szostak, and J.W.Szostak (1999).
In vitro selection of functional nucleic acids.
  Annu Rev Biochem, 68, 611-647.  
10600721 F.Walter, Q.Vicens, and E.Westhof (1999).
Aminoglycoside-RNA interactions.
  Curr Opin Chem Biol, 3, 694-704.  
10573122 G.A.Soukup, and R.R.Breaker (1999).
Relationship between internucleotide linkage geometry and the stability of RNA.
  RNA, 5, 1308-1325.  
10089439 J.C.Nix, A.R.Newhoff, and C.Wilson (1999).
Preliminary crystallographic characterization of an in vitro evolved biotin-binding RNA pseudoknot.
  Acta Crystallogr D Biol Crystallogr, 55, 323-325.  
10425683 L.Jiang, A.Majumdar, W.Hu, T.J.Jaishree, W.Xu, and D.J.Patel (1999).
Saccharide-RNA recognition in a complex formed between neomycin B and an RNA aptamer.
  Structure, 7, 817-827.
PDB code: 1nem
10361088 M.Famulok (1999).
Oligonucleotide aptamers that recognize small molecules.
  Curr Opin Struct Biol, 9, 324-329.  
9772167 C.Wilson, J.Nix, and J.Szostak (1998).
Functional requirements for specific ligand recognition by a biotin-binding RNA pseudoknot.
  Biochemistry, 37, 14410-14419.  
9512549 D.Kiga, Y.Futamura, K.Sakamoto, and S.Yokoyama (1998).
An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition.
  Nucleic Acids Res, 26, 1755-1760.  
9934492 H.Wang, and Y.Tor (1998).
Tobramycin-EDTA conjugate: a noninnocent affinity-cleaving reagent.
  Bioorg Med Chem Lett, 8, 3665-3670.  
9731769 L.Jiang, and D.J.Patel (1998).
Solution structure of the tobramycin-RNA aptamer complex.
  Nat Struct Biol, 5, 769-774.
PDB code: 2tob
9576904 Q.Yang, I.J.Goldstein, H.Y.Mei, and D.R.Engelke (1998).
DNA ligands that bind tightly and selectively to cellobiose.
  Proc Natl Acad Sci U S A, 95, 5462-5467.  
9751648 R.D.Knight, and L.F.Landweber (1998).
Rhyme or reason: RNA-arginine interactions and the genetic code.
  Chem Biol, 5, R215-R220.  
  9436913 S.T.Wallace, and R.Schroeder (1998).
In vitro selection and characterization of streptomycin-binding RNAs: recognition discrimination between antibiotics.
  RNA, 4, 112-123.  
9548939 S.Wang, P.W.Huber, M.Cui, A.W.Czarnik, and H.Y.Mei (1998).
Binding of neomycin to the TAR element of HIV-1 RNA induces dissociation of Tat protein by an allosteric mechanism.
  Biochemistry, 37, 5549-5557.  
9503590 T.Hermann, and E.Westhof (1998).
RNA as a drug target: chemical, modelling, and evolutionary tools.
  Curr Opin Biotechnol, 9, 66-73.  
9831530 Y.Tor, T.Hermann, and E.Westhof (1998).
Deciphering RNA recognition: aminoglycoside binding to the hammerhead ribozyme.
  Chem Biol, 5, R277-R283.  
9204272 A.Ramos, C.C.Gubser, and G.Varani (1997).
Recent solution structures of RNA and its complexes with drugs, peptides and proteins.
  Curr Opin Struct Biol, 7, 317-323.  
9204270 E.Westhof, and D.J.Patel (1997).
Nucleic acids. From self-assembly to induced-fit recognition.
  Curr Opin Struct Biol, 7, 305-309.  
9253403 H.A.Heus (1997).
RNA aptamers.
  Nat Struct Biol, 4, 597-600.  
The most recent references are shown first. Citation data come partly from CiteXplore and partly from an automated harvesting procedure. Note that this is likely to be only a partial list as not all journals are covered by either method. However, we are continually building up the citation data so more and more references will be included with time. Where a reference describes a PDB structure, the PDB code is shown on the right.

 

spacer

spacer