PDBe 4p0s

X-ray diffraction
6Å resolution

human Mus81-Eme1-3'flap DNA complex

Released:

Function and Biology Details

Biochemical function:
  • not assigned
Biological process:
  • not assigned
Cellular component:
  • not assigned

Structure analysis Details

Assembly composition:
hetero pentamer (preferred)
Entry contents:
2 distinct polypeptide molecules
3 distinct DNA molecules
Macromolecules (5 distinct):
Crossover junction endonuclease MUS81 Chains: A, C, E, G
Molecule details ›
Chains: A, C, E, G
Length: 306 amino acids
Theoretical weight: 34.02 KDa
Source organism: Homo sapiens
Expression system: Escherichia coli
UniProt:
  • Canonical: NEW Q96NY9 (Residues: 246-551; Coverage: 56%)
Gene name: MUS81
Sequence domains: ERCC4 domain
Crossover junction endonuclease EME1 Chains: B, D, F, H
Molecule details ›
Chains: B, D, F, H
Length: 393 amino acids
Theoretical weight: 43.74 KDa
Source organism: Homo sapiens
Expression system: Escherichia coli
UniProt:
  • Canonical: NEW Q96AY2 (Residues: 178-570; Coverage: 69%)
Gene names: EME1, MMS4
Sequence domains: ERCC4 domain
DNA GAATGTGTGTCT Chains: I, M, Q, U
Molecule details ›
Chains: I, M, Q, U
Length: 12 nucleotides
Theoretical weight: 3.71 KDa
DNA TAGACACACATTCGGGACATGCAG Chains: J, N, R, V
Molecule details ›
Chains: J, N, R, V
Length: 24 nucleotides
Theoretical weight: 7.39 KDa
DNA TCTGCATGTCATT Chains: L, P, T, X
Molecule details ›
Chains: L, P, T, X
Length: 13 nucleotides
Theoretical weight: 3.93 KDa

Ligands and Environments

No bound ligands

No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: PAL/PLS BEAMLINE 5C (4A)
Spacegroup: C2221
Unit cell:
a: 92.442Å b: 250.758Å c: 430.24Å
α: 90° β: 90° γ: 90°
R-values:
R R work R free
0.253 0.25 0.308
Expression system: Escherichia coli