› › DNA chain C

21-nt PEN element of the SV40 DNA origin

21-nt PEN element of the SV40 DNA origin in PDB entry 2ntc, assembly 1, front view.
21-nt PEN element of the SV40 DNA origin in PDB entry 2ntc, assembly 1, side view.
21-nt PEN element of the SV40 DNA origin in PDB entry 2ntc, assembly 1, top view.
Source organism: Synthetic construct [32630]
Expression system: Not provided
As chain: C
Length: 21 nucleotides
Theoretical weight: 6.47 KDa
FASTA Sequence
>pdb|2ntc|C
TCAGAGGCCAGAAGTGCCTCG

Visualisation

Quick links

Search similar DNA