EMD-5602

Single-particle
29.0 Å
EMD-5602 Deposition: 09/03/2013
Map released: 01/05/2013
Last modified: 19/06/2013
Overview 3D View Sample Experiment Validation Volume Browser Additional data Links
Overview 3D View Sample Experiment Validation Volume Browser Additional data Links

EMD-5602

Substrate-specific structural rearrangements of human Dicer

EMD-5602

Single-particle
29.0 Å
EMD-5602 Deposition: 09/03/2013
Map released: 01/05/2013
Last modified: 19/06/2013
Overview 3D View Sample Experiment Validation Volume Browser Additional data Links
Name: Human Dicer in complex with a 35 bp pre-siRNA
Sample [1]
Name: Human Dicer in complex with a 35 bp pre-siRNA
Number of unique components: 2
Oligomeric state: monomer
Molecular weight
Experimental Theoretical Method
- 250 kDa -
Protein [1]
Name: Endoribonuclease Dicer (Dicer, Helicase with RNase motif)
Number of copies: 1
Oligomeric state: monomer
UniProtKB PDBe-KB AlphaFold DB
Domains
Gene Ontology [1]
Biological process:
pre-miRNA processing

Natural source
Organism: Homo sapiens (Human)
Molecular weight
Experimental Theoretical Method
- 220 kDa -
Recombinant Expression
Organism Strain Cell Plasmid
- - - -
RNA [1]
Name: 35 bp pre-siRNA (37ab)
Details: Second single-stranded RNA used for duplex formation = UCGUGAACUUUCAAACUAUACAACCUACUACCUCAUU
Natural source
Organism: Homo sapiens (Human)
Molecular weight
Experimental Theoretical Method
- 24 kDa -