EMD-5602
Substrate-specific structural rearrangements of human Dicer
EMD-5602
Single-particle29.0 Å
Deposition: 09/03/2013
Map released: 01/05/2013
Last modified: 19/06/2013
Name: Human Dicer in complex with a 35 bp pre-siRNA
Summary:
Human Dicer in complex with a 35 bp pre-siRNA
Number of unique components: 2
Oligomeric state: monomer
Name: Number of unique components: 2
Oligomeric state: monomer
Molecular weight
Experimental | Theoretical | Method |
---|---|---|
- | 250 kDa | - |
Endoribonuclease Dicer
(Dicer, Helicase with RNase motif)
Number of copies: 1
Oligomeric state: monomer
UniProtKB PDBe-KB AlphaFold DB
Name: Number of copies: 1
Oligomeric state: monomer
UniProtKB PDBe-KB AlphaFold DB
Domains
Gene Ontology [1]
Natural source
Molecular weight
Experimental | Theoretical | Method |
---|---|---|
- | 220 kDa | - |
Recombinant Expression
Organism | Strain | Cell | Plasmid |
---|---|---|---|
- | - | - | - |
35 bp pre-siRNA
(37ab)
Details: Second single-stranded RNA used for duplex formation = UCGUGAACUUUCAAACUAUACAACCUACUACCUCAUU
Name: Details: Second single-stranded RNA used for duplex formation = UCGUGAACUUUCAAACUAUACAACCUACUACCUCAUU
Natural source
Molecular weight
Experimental | Theoretical | Method |
---|---|---|
- | 24 kDa | - |