EMD-4369 Function and Biology

Unique features of mammalian mitochondrial translation initiation revealed by cryo-EM. This file contains the 28S ribosomal subunit.

Single particle reconstruction
3.1Å resolution
Overview of EMD-4369
Sample name: mammalian mitochondrial translation initiation complex
Number of unique components: 48

mammalian mitochondrial translation initiation complex

Protein type
Name: mammalian mitochondrial translation initiation complex
Theoretical weight (MDa): 2.85

Porcine Ribosome [Sus scrofa]

Protein type
Name: Porcine Ribosome

Translation initiation factor IF-2, mitochondrial [Homo sapiens]

Protein type
Name: Translation initiation factor IF-2, mitochondrial
Expression system
Expression system: Escherichia coli

Nucleic acids [Homo sapiens]

Protein type
Name: Nucleic acids
Expression system
Expression system: synthetic construct

Translation initiation factor IF-2, mitochondrial [Homo sapiens]

Protein type
Name: Translation initiation factor IF-2, mitochondrial
Theoretical weight (MDa): 0.073
Number of copies: 1
Expression system
Expression system: Escherichia coli

Mitochondrial ribosomal protein L19 [Pig]

Protein type
Name: Mitochondrial ribosomal protein L19
Theoretical weight (MDa): 0.033
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

12S ribosomal RNA, mitochondrial [Sus scrofa]

Nucleic-acid type
Name: 12S ribosomal RNA, mitochondrial
Theoretical weight (MDa): 0.309
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: ACACAGGUUUGGUCCUGGCCUUUCUAUUAAUUCUUAAUAAAAUUACACAUGCAAGUAUCCGCGCCCCGGUGAGAAUGCCC UCCAGAUCUUAAAGAUCAAAAGGAGCAGGUAUCAAGCACACCUAUAACGGUAGCUCAUAACGCCUUGCUCAACCACACCC CCACGGGAAACAGCAGUGAUAAAAAUUAAGCCAUGAACGAAAGUUUGACUAAGUUAUAUUAAUUAGAGUUGGUAAAUCUC GUGCCAGCCACCGCGGUCAUACGAUUAACCCAAAUUAAUAGAUCCACGGCGUAAAGAGUGUUUAAGAAAAAAAAUCACAA UAGAGUUAAAUUAUAACUAAGCUGUAAAAAGCCCUAGUUAAAAUAAAAUAACCCACGAAAGUGACUCUAAUAAUCCUGAC ACACGAUAGCUAGGACCCAAACUGGGAUUAGAUACCCCACUAUGCCUAGCCCUAAACCCAAAUAGUUACAUAACAAAACU AUUCGCCAGAGUACUACUCGCAACUGCCUAAAACUCAAAGGACUUGGCGGUGCUUCACAUCCACCUAGAGGAGCCUGUUC UAUAAUCGAUAAACCCCGAUAGACCUUACCAACCCUUGCCAAUUCAGCCUAUAUACCGCCAUCUUCAGCAAACCCUAAAA AGGAACAAUAGUAAGCACAAUCAUAGCACAUAAAAACGUUAGGUCAAGGUGUAGCUUAUGGGUUGGAAAGAAAUGGGCUA CAUUUUCUACAUAAGAAUAUCCACCACACGAAAGUUUUUAUGAAACUAAAAACCAAAGGAGGAUUUAGCAGUAAAUCAAG AAUAGAGUGCUUGAUUGAAUAAGGCCAUGAAGCACGCACACACCGCCCGUCACCCUCCUCAAGCAUGUAGUAAUAAAAAU AACCUAUAUUCAAUUACACAACCAUGCAAGAAGAGACAAGUCGUAACAAGGUAAGCAUACUGGAAAGUGUGCUUGGAUUA CC

Mitochondrial ribosomal protein S2 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S2
Theoretical weight (MDa): 0.032
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S24 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S24
Theoretical weight (MDa): 0.019
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S5 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S5
Theoretical weight (MDa): 0.048
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S6 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S6
Theoretical weight (MDa): 0.014
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S7 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S7
Theoretical weight (MDa): 0.028
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S9 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S9
Theoretical weight (MDa): 0.046
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S10 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S10
Theoretical weight (MDa): 0.023
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S11 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S11
Theoretical weight (MDa): 0.021
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S12 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S12
Theoretical weight (MDa): 0.015
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S14 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S14
Theoretical weight (MDa): 0.015
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S15 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S15
Theoretical weight (MDa): 0.027
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

bS16m, MRPS16 [Sus scrofa]

Protein type
Name: bS16m, MRPS16
Theoretical weight (MDa): 0.015
Number of copies: 1
Natural source of the component
Organism: Sus scrofa
Organ/Tissue: liver

Mitochondrial ribosomal protein S17 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S17
Theoretical weight (MDa): 0.014
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S18C [Pig]

Protein type
Name: Mitochondrial ribosomal protein S18C
Theoretical weight (MDa): 0.016
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S21 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S21
Theoretical weight (MDa): 0.011
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

P-site fMet-tRNAMet, mitochondrial [Homo sapiens]

Nucleic-acid type
Name: P-site fMet-tRNAMet, mitochondrial
Theoretical weight (MDa): 0.023
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: AGUAAGGUCAGCUAAAUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUAUACCCUUCCCGUACUACCA

MT-CO3 mRNA, mitochondrial [Homo sapiens]

Nucleic-acid type
Name: MT-CO3 mRNA, mitochondrial
Theoretical weight (MDa): 0.064
Type: RNA
Structure: OTHER
Synthetic: false
Sequence: AUGACCCACCAAUCACAUGCCUAUCAUAUAGUAAAACCCAGCCCAUGACCCCUAACAGGGGCCCUCUCAGCCCUCCUAAU GACCUCCGGCCUAGCCAUGUGAUUUCACUUCCACUCCAUAACGCUCCUCAUACUAGGCCUACUAACCAACACACUAACCA UAUACCAAUGAUGGCGCGAUGUAACACGAGAAAGCACAUAC

unassigned secondary structure elements [Sus scrofa]

Protein type
Name: unassigned secondary structure elements
Theoretical weight (MDa): 0.001
Number of copies: 1
Natural source of the component
Organism: Sus scrofa
Organ/Tissue: liver

Mitochondrial ribosomal protein S22 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S22
Theoretical weight (MDa): 0.043
Number of copies: 1

Mitochondrial ribosomal protein S23 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S23
Theoretical weight (MDa): 0.022
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S25 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S25
Theoretical weight (MDa): 0.02
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S26 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S26
Theoretical weight (MDa): 0.024
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S27 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S27
Theoretical weight (MDa): 0.045
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitoribosomal protein ms28, mrps28 [Pig]

Protein type
Name: Mitoribosomal protein ms28, mrps28
Theoretical weight (MDa): 0.021
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Death associated protein 3 [Pig]

Protein type
Name: Death associated protein 3
Theoretical weight (MDa): 0.046
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

mS31, MRPS31 [Pig]

Protein type
Name: mS31, MRPS31
Theoretical weight (MDa): 0.044
Number of copies: 1

Mitochondrial ribosomal protein S33 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S33
Theoretical weight (MDa): 0.013
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S34 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S34
Theoretical weight (MDa): 0.026
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S35 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S35
Theoretical weight (MDa): 0.037
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S37 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S37
Theoretical weight (MDa): 0.014
Number of copies: 1

Aurora kinase A interacting protein 1 [Pig]

Protein type
Name: Aurora kinase A interacting protein 1
Theoretical weight (MDa): 0.023
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

Mitochondrial ribosomal protein S39 [Pig]

Protein type
Name: Mitochondrial ribosomal protein S39
Theoretical weight (MDa): 0.076
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

28S ribosomal protein S18b, mitochondrial [Pig]

Protein type
Name: 28S ribosomal protein S18b, mitochondrial
Theoretical weight (MDa): 0.029
Number of copies: 1
Natural source of the component
Organism: Pig
Organ/Tissue: liver

5'-GUANOSINE-DIPHOSPHATE-MONOTHIOPHOSPHATE

Ligand type
Name: 5'-GUANOSINE-DIPHOSPHATE-MONOTHIOPHOSPHATE
Theoretical weight (MDa): 0.001
Number of copies: 1

MAGNESIUM ION

Ligand type
Name: MAGNESIUM ION
Theoretical weight (MDa): 0
Number of copies: 111

SODIUM ION

Ligand type
Name: SODIUM ION
Theoretical weight (MDa): 0
Number of copies: 1

SPERMINE

Ligand type
Name: SPERMINE
Theoretical weight (MDa): 0
Number of copies: 1

ZINC ION

Ligand type
Name: ZINC ION
Theoretical weight (MDa): 0
Number of copies: 3

N-FORMYLMETHIONINE

Ligand type
Name: N-FORMYLMETHIONINE
Theoretical weight (MDa): 0
Number of copies: 1

GUANOSINE-5'-TRIPHOSPHATE

Ligand type
Name: GUANOSINE-5'-TRIPHOSPHATE
Theoretical weight (MDa): 0.001
Number of copies: 1

water

Ligand type
Name: water
Theoretical weight (MDa): 0
Number of copies: 5