› 1sax

X-ray diffraction
2.8Å resolution

Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA

Released:
DOI: 10.2210/pdb1sax/pdb
PDB entry 1sax coloured by chain, front view.
PDB entry 1sax coloured by chain, side view.
PDB entry 1sax coloured by chain, top view.
Source organism: Staphylococcus aureus subsp. aureus N315
Primary publication:
On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator.
García-Castellanos R, Mallorquí-Fernández G, Marrero A, Potempa J, Coll M, Gomis-Rüth FX
J Biol Chem 279 17888-96 (2004)
PMID: 14960592

Function and Biology Details

Biochemical function:
Biological process:
Cellular component:
Sequence domains:
Structure domain:

Structure analysis Details

Assembly composition:
hetero tetramer (preferred)
Assembly name:
PDBe Complex ID:
PDB-CPX-114587 (preferred)
Entry contents:
1 distinct polypeptide molecule
2 distinct DNA molecules
Macromolecules (3 distinct):
Methicillin resistance regulatory protein MecI Chains: A, B
Molecule details ›
Chains: A, B
Length: 123 amino acids
Theoretical weight: 14.81 KDa
Source organism: Staphylococcus aureus subsp. aureus N315
Expression system: Escherichia coli
UniProt:
  • Canonical: P68261 (Residues: 1-123; Coverage: 100%)
Gene names: SA0040, mecI
Sequence domains: Penicillinase repressor
Structure domains:
5'-d(GCTCCGATATTACAGTTGTAATTTT)-3' Chain: C
Molecule details ›
Chain: C
Length: 25 nucleotides
Theoretical weight: 7.65 KDa
Source organism: Staphylococcus aureus subsp. aureus N315
Expression system: Not provided
5'-d(CAAAATTACAACTGTAATATCGGAG)-3' Chain: D
Molecule details ›
Chain: D
Length: 25 nucleotides
Theoretical weight: 7.7 KDa
Source organism: Staphylococcus aureus subsp. aureus N315
Expression system: Not provided

Ligands and Environments

1 bound ligand:
Ligand K 1 x K
No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: ESRF BEAMLINE ID13
Spacegroup: P3121
Unit cell:
a: 133.6Å b: 133.6Å c: 54.7Å
α: 90° β: 90° γ: 120°
R-values:
R R work R free
0.216 0.212 0.276
Expression systems:
  • Escherichia coli
  • Not provided

Quick links

Citations

9 review citations

Penicillin-binding proteins and beta-lactam resistance.
Zapun et al. (2008)
8 more

17 mentions without citation

Crystal structures of the BlaI repressor from Staphylococcus aureus and its complex with DNA: insights into transcriptional regulation of the bla and mec operons.
Safo et al. (2005)
16 more