top_cornerHomeEMD-5127  Contact us 
Image unavailable
Title:Three-dimensional EM structure of an intact activator-dependent transcription initiation complex
Authors:B.P.Hudson,J.Quispe,S.Lara,Y.Kim,H.M.Berman,E.Arnold,R.H.Ebright,C.L.Lawson
Sample:E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Aggregation state:Single particle (19.8 angstroms resolution)
Red flagLatest update:2010-03-10
inner_corner
tab_top_blue.gif
bullet_white.gif  Summary
tab_bottom_blue.gif
pixel.gif
tab_top_white.gif
bullet.png Experimental details
tab_bottom_white.gif
pixel.gif
tab_top_blue.gif
bullet_white.gif  Visualization
tab_bottom_blue.gif
pixel.gif
tab_top_blue.gif
bullet_white.gif  Map information
tab_bottom_blue.gif
pixel.gif
tab_top_blue.gif
bullet_white.gif  Downloads
tab_bottom_blue.gif
pixel.gif
Sample
Sample name: E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Oligomeric state: One molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex)
Theoretical molecular weight of the sample: 0.57
Components:
ID Type Name Exp. MW (MDa) Oligomeric details Recombinant expression Synthetic Organism GO identifier InterPro identifier Virus identifier Details
1proteinCatabolite Activator ProteinhomodimertrueEscherichia coliGO:0006355IPR001808
2nucleic-acidlac(ICAP)UP-UV5-bubble0.06trueunidentifiedAn engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAGTGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3'
3proteinRNA polymerase holoenzyme (sigma70)heterohexamertrueEscherichia coliGO:0006351Six subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70.
Experiment
Sample preparation:
pHSample conc.DetailsStainingSample support details
8.06.18 mg/mL25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMPSample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes.400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon
Vitrification:
Cryogen nameHumidityTemp.Instr.MethodTime resolvedDetails
NONE% KNONE ms
Imaging:
MicroscopeVoltageIllumination modeImaging modeCsDefocus min.Defocus max.Nominal mag.Calibrated mag.Electron sourceDetectorDetector distanceAstigmatism
FEI TECNAI F20120 kVFLOOD BEAMBRIGHT FIELD2.0 mm500 nm1500 nm50000FIELD EMISSION GUNTeitz F415 4k x 4k pixel CCD camera mm

Specimen holderHolder modelTilt min.Tilt max.Energy filterEnergy windowTemp.Temp. min.Temp. max.Beam tiltElectron doseOther detailsDate
standard side-entry room-temperature stageSIDE ENTRY, EUCENTRIC°° eV293 K K K mrad16 e/Å215 um pixel size on detector04-NOV-2008
Processing
Software:EMAN, SPIDER
CTF correction:ACE
Resolution by author:19.8 Å
Resolution method:FSC at 0.5 cut-off
Processing details:EMAN interleaved with SPIDER correspondence analysis
Unit cell:
Scanned images:
Num. imagesSampling sizeOD rangeQuant. bit numberOther detailsScanner
349 μm/pixellink
Fitting:
PDBProtocolTarget crit.SoftwareB valueFitting spacePDB chainDetails
1LB2 rigid body, Yup.scx simulated annealingmap-derived potential energyChimera, Yup.scxREALA complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
1BDF rigid body fit followed by Yup.scx simulated annealingmap-derived potential energyChimera, Yup.scxREALA complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
2AUK manual fit followed by Yup.scx simulated annealingmap-derived potential energyChimera, Yup.scxREALA complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
1SIG rigid body fit followed by Yup.scx simulated annealingmap-derived potential energyChimera, Yup.scxREALA complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
3DXJ rigid body fit followed by Yup.scx simulated annealingmap-derived potential energyChimera, Modeller, Yup.scxREALA complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
outer_corner