Static html Template - Edit/Add Centre Content
If you are using a fixed width template the main body section has a width of 645px.
In the source code of your template look for the following comment tags:
The following are examples of html code you could use between the comment tags. The styles used in these examples will only work if you use the EBI stylesheets contents.css and userstyles.css . We recommend you make absolute links to the EBI stylesheets on your webpages, so any updates we do will be reflected in your pages.
Main Body Text and Links
Example Breadcrumb Navigation
Example First Top Level Heading
Example Second Sub Level Heading
Example Third Sub Level Heading
Example Fourh Sub Level Heading
Example Publication Listing
Example Edit/Add Tables
Example For Text Bold
Example For Text Red Bold
Example For Text Green Bold Small List
Example For Image / Icon To Right Align
Sequence Formatting
Next/Previous Navigation
Lists/Trees in the Contents
Using Flash
Using jquery
1. Main Body Text and Links
The following examples show the main body text, general default links and small links used on the EBI webisite.
Example 1:
Main body text
Example 2:
General Default Link
Example 3:
General Green Bold Link
To use this General Green Bold Link just add the class name "greenbold" to your anchor (href) tag, for example
<a href="#" class="greenbold">General Green Bold Link</a>
Example 4:
Small Link
To use this Small Link just add the class name "smallgreen" to your anchor (href) tag, for example
<a href="#" class="smallgreen">Small Link</a>
CSS Information on Main Body Text and Links:
Main Body Text
font-family: Helvetica, Arial, Verdana, sans-serif
font-size: 10pt;
colour: hex: #000000;
General Default Link: 'link' and 'visited' attribute
color: #006666;
text-decoration: underline;
General Default Link: 'hover' and 'active' attribute
color: #e33e3e;
text-decoration: none;
Small Link: 'link' and 'visited' attribute
font-size: 8pt;
color: #408c8c;
text-decoration: underline;
Small Link: 'hover' and 'active' attribute
font-size: 8pt;
color: #ff3300;
text-decoration: none;
2. Example Breadcrumb Navigation
Always start the page content with a breadcrumb navigation. The first link of the breadcrumb should go to the EBI homepage. The subsequent link hierachy can be implemented as you think appropriate.
Example:
The following html code can be cut and paste into your template between the <!-- start contents here --> and <!-- end contents here --> comment tags.
CSS Information on Breadcrumbs:
Breadcrumb Links: 'link' and 'visited' attribute
font-size: 8pt;
color: #999999;
text-decoration: none;
background: url(http://www.ebi.ac.uk/inc/images/bread_arrow2.gif)
Breadcrumb Links: 'hover' and 'active' attribute
font-size: 8pt;
color: # e33e3e;
text-decoration: underline;
background: url(http://www.ebi.ac.uk/inc/images/bread_arrow2.gif)
3.Example First Top Level Heading
Use a <h1></h1> tag for your top level heading on each page.
Example:
Demo - My First Top Level Heading
The following html code can be cut and pasted into your template between the <!-- start contents here --> and <!-- end contents here --> comment tags.
<h1>Demo - My First Top Level Heading</h1>
CSS Information on First Top Level Heading:
First Top Level Heading
font-size: 11pt;
font-weight: bold;
color: #006666;
padding: 4px;
background: #edf6f5;
border: 1px solid #d9dadc;
margin: 5px 0px 10px 0px; (top right bottom left)
4. Example Second Sub Level Heading
Use a <h2></h2> tag for your second sub level heading on a page.
Example:
Demo - My Second Sub Level Heading
The following html code can be cut and pasted into your template between the <!-- start contents here --> and <!-- end contents here --> comment tags.
<h2>Demo - My Second Sub Level Heading</h2>
CSS Information on Second Sub Level Heading:
Second Sub Level Heading
font-size: 10pt;
color: #1f1f1f;
padding: 0;
background: #ffffff;
border-top: 0px;
border-right: 0px;
border-left: 0px;
border-bottom: 1px solid #d9dadc;
margin: 25px 0px 5px 0px; (top right bottom left)
5. Example Third Sub Level Heading
Use a <h3></h3> tag for your third sub level heading on a page.
Example:
Demo - My Third Sub Level Heading
The following html code can be cut and pasted into your template between the <!-- start contents here --> and <!-- end contents here --> comment tags.
<h3>Demo - My Third Sub Level Heading</h3>
CSS Information on Third Sub Level Heading:
Third Sub Level Heading
font-size: 9pt;
color: #006666;
padding: 0;
background: #ffffff;
border: 0;
margin: 5px 0px 5px 0px; (top right bottom left)
6. Example Fourth Sub Level Heading
Use a <h4></h4> tag for your fourth sub-level heading on a page.
Example:
Demo - My Fourth Sub Level Heading
The following html code can be cut and pasted into your template between the <!-- start contents here --> and <!-- end contents here --> comment tags.
<h4>Demo - My Fourth Sub Level Heading</h4>
CSS Information on Fourth Sub Level Heading:
Fourth Sub Level Heading
font-size: 9pt;
color: #1f1f1f;
padding: 0;
background: #ffffff;
border: 0;
margin: 5px 0px 5px 0px; (top right bottom left)
7. Example Publication Listing
Publications should be formatted as follows.
Example:
Labarga A., Pilai S., Valentin F., Anderson M. and Lopez R. (2005)
Web services at the European Bioinformatics Institute.
Nucleic Acids Research 33: 25-28.
abstract
full-text HTML
full-text PDF
The following html code can be cut and pasted into your template between the <!-- start contents here --> and <!-- end contents here --> comment tags.
<div class="pubauthors">Labarga A., Pilai S. and Lopez R. (2005)</div>
<div class="pubtitle">Web services at the EBI.</div>
<div class="pubjournal">Nucleic Acids Research 33: 25-28.</div>
<a href="#" class="pubabstract" target="_blank">abstract</a>
<a href="#" class="pubhtml" target="_blank">full-text HTML</a>
<a href="#" class="pubpdf" target="_blank">full-text PDF</a>
CSS Information on Publications:
Publication Authors
font-size: 9pt;
font-weight: bold;
color: #1f1f1f;
padding: 0;
background: #ffffff;
border: 0;
margin: 12px 0px 2px 0px; (top right bottom left)
clear: left;
Publication Title
font-size: 9pt;
font-weight: bold;
color: #006666;
padding: 0;
background: #ffffff;
border: 0;
margin: 2px 0px 2px 0px; (top right bottom left)
Publication Journal
font-size: 9pt;
font-style: italic;
color: #1f1f1f;
padding: 0;
background: #ffffff;
border: 0;
margin: 2px 0px 2px 0px; (top right bottom left)
Publication abstract, full-text HTML and full-text PDF
Links: 'link' and 'visited' attribute
font-size: 9pt;
color: #999999;
text-decoration: none;
display: inline;
padding-left:0px;
padding-right:24px;
padding-top:0px;
padding-bottom:0px;
height: 22px;
text-align: left;
width: auto;
Publication abstract, full-text HTML and full-text PDF
Links: 'hover' and 'active' attribute
font-size: 9pt;
color: #e33e3e;
text-decoration: underline;
display: inline;
padding-left:0px;
padding-right:24px;
padding-top:0px;
padding-bottom:0px;
height: 22px;
text-align: left;
width: auto;
Publication abstract Links: 'link' and 'visited' attribute
background: url(http://www.ebi.ac.uk/inc/images/icon_abstract.gif) top right no-repeat;
Publication abstract Links: 'hover' and 'active' attribute
background: url(http://www.ebi.ac.uk/inc/images/icon_abstract.gif) top right no-repeat;
Publication full-text HTML Links: 'link' and 'visited' attribute
background: url(http://www.ebi.ac.uk/inc/images/icon_html.gif) top right no-repeat;
Publication full-text HTML Links: 'hover' and 'active' attribute
background: url(http://www.ebi.ac.uk/inc/images/icon_html.gif) top right no-repeat;
Publication full-text PDF Links: 'link' and 'visited' attribute
background: url(http://www.ebi.ac.uk/inc/images/icon_pdf.gif) top right no-repeat;
Publication full-text PDF Links: 'hover' and 'active' attribute
background: url(http://www.ebi.ac.uk/inc/images/icon_pdf.gif) top right no-repeat;
9. Example For Text Bold
Use <b>Information</b>
Example:
Demo - Information
10. Example For Text Red Bold
Use <span class="red_bold">Successful Outcome of the project</span>
Example:
Demo - Successful Outcome of the project
11. Example For Text Green Bold Small List
Use <ul>
<li><a href="http://www.ebi.ac.uk/"><b>LINK TO THE EBI</b></a></li>
<li><a href="http://www.ebi.ac.uk/"><b>LINK TO THE EBI</b></a></li>
</ul>
Example:
12. Example For Image / Icon Align Right
Use <img src="/Groups/images/logo_es.gif" alt="External Services" class="grouplogo" />
Example:
13. Sequence Formatting
(a) With a <pre> tag.
CTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCC CCGCTTCATCGCCGTGGGCTACGT GGACG
ACACGCAGTTCGTG CGGTTCGACAGCGACGCC GCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATA GAGCAGGAGGGG
<pre>CTCCATGAGGTATTTCTTCACATCCGTGTCCCGG<span class="pre_style_green">CCCGGCCGCGGGGAGCC</span>CCGCTTCATCGCCG<span class="pre_style_faint">TGGGCTACGT</span>GGACG
ACAC<span class="pre_style_blue">GCAGTTCGTG</span>CGGTTCGA<span class="pre_style_yellow">CAGCGACGCC</span>GCGAGCCAGAAGATGGAGCCG<span class="pre_style_red">CGGGCGCCGTGGATA</span>GAGCAGGAGGGG
</pre>
(b) Without a <pre> tag, i.e. in a <span>
CTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCC CCGCTTCATCGCCGTGGGCTACGT GGACG
ACACGCAGTTCGTG CGGTTCGACAGCGACGCC GCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATA GAGCAGGAGGGG
<span class="pre_style">CTCCATGAGGTATTTCTTCACATCCGTGTCCCGG<span class="pre_style_green">CCCGGCCGCGGGGAGCC</span>CCGCTTCATCGCCG<span class="pre_style_faint">TGGGCTACGT</span>GGACG<br />
ACAC<span class="pre_style_blue">GCAGTTCGTG</span>CGGTTCGA<span class="pre_style_yellow">CAGCGACGCC</span>GCGAGCCAGAAGATGGAGCCG<span class="pre_style_red">CGGGCGCCGTGGATA</span>GAGCAGGAGGGG</span>
14. Example of Next/Previous Navigation
<div class="navbar">
<a href="/" class="prev">Previous</a>
<a href="/" class="next">Next</a>
</div>
15. Lists/Trees in the Contents
You can use several click to open/close
lists in the contents of your page. Lists should have a unique ID and not be the ID used for side menus.
bla bla bla bla...
<ul id="poplist_1" class="sidemenu">
<li class="clickmeopen"><a href="#">level one menu</a>
<ul>
<li><a href="#">level two menu</a></li>
<li><a href="#">level two menu</a></li>
<li><a href="#">level two menu</a></li>
</ul>
</li>
<li><a href="#">level one menu</a>
<li><a href="#">level one menu</a>
<li><a href="#">level one menu</a>
</ul>
<br />
bla bla bla bla...
<br />
<br />
<ul id="poplist_2" class="sidemenu">
<li><a href="#">level one menu</a>
<li><a href="#">level one menu</a>
<li class="clickmeopen"><a href="#">level one menu</a>
<ul>
<li><a href="#">level two menu</a></li>
<li><a href="#">level two menu</a></li>
<li><a href="#">level two menu</a></li>
</ul>
</li>
</ul>
<script type="text/javascript"
src="http://www.ebi.ac.uk/inc/js/centrallist.js"></script>
15. Using Flash
Click here .
Paste your main body content html source code in between these comment tags
<!-- end contents here -->