{ name "Short name for sequence" longname "Long (more descriptive) name for sequence" sequence-ID "Unique ID number" creation-date "mm/dd/yy hh:mm:ss" direction [-1|1] strandedness [1|2] type [DNA|RNA||PROTEIN|TEXT|MASK] offset (-999999,999999) group-ID (0,999) creator "Author's name" descrip "Verbose description" comments "Lines of comments that can be fairly arbitrary text about a sequence. Return characters are allowed, but no internal double quotes or brace characters. Remember to close with a double quote" sequence "gctagctagctagctagctcttagctgtagtcgtagctgatgctagct gatgctagctagctagctagctgatcgatgctagctgatcgtagctgacg gactgatgctagctagctagctagctgtctagtgtcgtagtgcttattgc" }