EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF08086 alignment
(4 sequences with 123 bp)


SEK5_CENNO/1-41 GATAGAGATAGCTGTGTTGATAAATCAAAATGCGGAAAATATGGATACTACCAAGAGTGTCAGGATTGTTGCAAGAATGCTGGACACAATGGAGGAACCTGCGTGTATTACAAGTGTAAATGT
SEK3_CENGR/1-41 GATAGAGATAGCTGTGTTGATAAATCACGATGCCAAAAATATGGACCCTACGGACAGTGTACGGACTGTTGCAAGAAAGCTGGACACACTGGAGGAACCTGCATATATTTCAAGTGTAAATGT
SEK5_CENSC/1-41 GATAGAGATAGCTGTGTTGATAAATCACGATGCGCAAAATATGGATACTACGGTCAATGTGAAGTTTGTTGTAAGAAAGCTGGACATAATGGAGGAACCTGTATGTTTTTCAAGTGTATGTGC
SEK3_CENEX/1-41 GATAGAGATAGCTGTGTTGATAAATCAAAATGCGCAAAATATGGATACTACTATCAATGTGATGAATGTTGCAAGAAAGCTGGAGACCGTGCAGGAACCTGCGAGTATTTCAAGTGTAAATGT