EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF08061 alignment
(7 sequences with 105 bp)


Q9W744_CHICK/480-514 TCTGCGGGCAAAAGGGGTGGATTTAGTAGCTTTAGAGAGAGGGAGAACTTTGAGAGAACTTATGGTGCACTAGGAAAGAGAGACTTTGGAGCCAAAGCTCAAAAT
Q6P4W2_XENTR/493-521 TCTTCAGGCAAGCGGGGTGGGTGG------------GACCGGGAAAACTATGACCGTGGGTTTGGCGGC------AAGAGAGACTTTGGCAACAAATCCCAAAAT
DDX5_HUMAN/498-532 TCTGCGGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAATTATGACAGAGGTTACTCTAGCCTGCTTAAAAGAGATTTTGGGGCAAAAACTCAGAAT
Q6P4W2_XENTR/545-576 GGCACCAATGTTCAGAGTGGGTTCCGGGCAGGAGCACAGAACGGCACATACCAGAATGGCTACGCCAGC---------CAGCAGAATGGCTACAGTGCACCTCCA
Q9W744_CHICK/534-564 GCTGCAGGCATGCAAGCTGGCTTCAGGGCTGGTAACCCTGCAGGAGCTTACCAGAATGGTTATGAT------------CAGCAGTATGGAAGTAACATTGCAAAT
Q28465_MACEU/165-193 TCTGCTGGTATACAGACTAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAATGGTTAT------------------ACAGTACACAGCAATATGGAAATA
DDX5_HUMAN/551-583 TCTGCTGGTATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAATGGTTATGATAGC------ACTCAGCAATACGGAAGTAATGTTCCAAAT