EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF08043 alignment
(59 sequences with 48 bp)


Q71LX6_RAT/1186-1201 GGCAATGTGCAGATGAATAAACAACTATTCGAGTCTGAAGGTGGTGAC
Q91957_CHICK/951-966 GGAGATGTTCAGTCCAACAAGCAGCTCTTTGAGTCCCAGCAAGTGGGC
Q8N1M9_HUMAN/314-329 GGCAATGTAAAGACAAGTAGACAATTCTTTGAGTCTGAAAATTTTGAT
Q91957_CHICK/1055-1070 GCAGATGTGAAAAGCACAACATGGCTCTTCGAGAGCACTCCCTTGGAT
Q91957_CHICK/842-857 GCAAACGTCAAGTCCTGCACAATGCTCTTTGAAAGCCAACCCTTATAC
Q8BS23_MOUSE/383-398 AGTGATGTGAAATATACAACTTGGATGTTTGAAACTCAGCCAATAGAT
Q71LX6_RAT/1289-1304 TCAGATGTCAAGACAACAACGTGGCTCTTTGAAACGACACCTATTCAC
Q71LX6_RAT/1217-1232 GGCAATGTTAAGACTTCTACTTGGCTCTTTGAAACTCACAGCATAGAT
Q91957_CHICK/982-997 GGTGATGTGAGGACATCTACCTGGCTTTTTGAAAACCAGCCTGTGGAC
Q91957_CHICK/586-601 GGTGATGTCAGAACAGCCAAGTGGCTCTTTGAAACTCAACCTATGGAT
Q702N7_HUMAN/554-569 GGGGATGTCAAAACCTGTAAATGGCTTTTTGAGACCCTGCCAATGGAG
Q8N1M9_HUMAN/20-35 GGAGATGTCAAAACTTGTACTTGGCTCTTTGAAACTCAGCCACTTGAT
O70373_MOUSE/436-451 GGGGATGTGAAAACCTTCAAGAATCTTTTTGAGACCCTTCCCTTAGAC
O70373_MOUSE/589-604 GGTGATGTACAGACTATCCGTTGGCTGTTTGAGACCTACCCTATGAGC
Q91957_CHICK/402-417 GGTGATGTGAAATCTACACTCTGGCTATTTGAAACTCAGCCGATGGAA
O70373_MOUSE/545-560 GGGGATGTCGGCACCACTCGGTGGCTCTTTGAGACGCAGCCATTGGAG
Q8N1M9_HUMAN/205-220 GGTGATGTAAAAAGCTACAGAATGCTCTTTGAAACCCAGCCACTCTAT
Q702N7_HUMAN/515-530 GGAAATGTGAAATCTGCCAAATGGTTGTTTGAAACCCAACCTCTTGAT
Q702N7_HUMAN/268-283 GGTGGGGTGAGTAAGGCAAAGTGGTTATTTGAAACCCAACCTTTGGAG
Q702N7_HUMAN/372-387 GGGGATGTTAGGCATCAAAAATGGATTTTTGAAACCCAACCTCTGGAA
Q702N7_HUMAN/335-350 GGTGATGTACAAACTACTAAGCATCTATTTGAAACACTTCCAATTGAA
Q91957_CHICK/880-895 GGTGACGTGAAAGGTGCACGGTGGTTGTTTGAAACGAAGCCCCTGGAT
O70373_MOUSE/184-199 GGAGATGTACAGGGAACCAGAAAGCTCTTTGAGACTAGGCCCCTGGAC
Q8BS23_MOUSE/420-435 GGAGATGTTTACACAGCAAGGTGGATGTTTGAAACAAGGCCTTTAGAC
O70373_MOUSE/149-164 GGTGATGTCCAAGCTGCCAGACAGATGTTTGAGACCAAGCCACTGGAT
Q702N7_HUMAN/477-492 GGTGATGTAAGAAGCTGTAGGTGGCTTTTTGAAACAAGGCCCATTGAC
O70373_MOUSE/372-387 GGCGATGTCCGCTCTACACTCTGGCTATTTGAAACAAAACCCCTGGAT
Q91957_CHICK/658-673 GCTGATGTGAAATCGTACACGTGGATGTTTGAGACTCAACCCCTGGAC
O70373_MOUSE/507-522 GGTGATGTTCAGGGCTACAAGTGGATGTTTGAGACACAGCCCCTGGAC
Q702N7_HUMAN/301-316 ACAGATGTCTCCAGAAAGTGTTGGATGTTTGAAACCCAGCCATTAGAC
O70373_MOUSE/298-313 CCGGATGTCAGTGCAACTCGTTGGATCTTTGAGACGCAGCCTTTGGAT
Q8N1M9_HUMAN/280-295 GGAGATGTTAGTTCTGTCAGATACAGATTTGAAACTCAGCCACTGGAT
Q8BS23_MOUSE/458-473 GGAGATGTCAAGACTGTGAGATACATGTTTGAAACTCAACAACTAGAT
Q8N1M9_HUMAN/93-108 GGAGATGTTTCCAGCATGAGGTATAAATTTGAAAATCAGTCCTTAGAT
Q91957_CHICK/215-230 GGTGATGTGAAAGGAGCCAAAGAGCTCTTTGAAGCCCAGTCCTTGGAT
Q71LX6_RAT/1254-1269 GGTGACGTGAAGCAAGCAGTGTGGCTTTTTGAAAATCAGACATTGGAT
Q8N1M9_HUMAN/132-147 GGCAATGTTTTAAATTGTAGGTGGCTTTTTGAAAACCAACCAATTGAT
Q8BS23_MOUSE/343-358 GGAGAGGTGCAGTCGATTCGATGGATTTTTGAGAATCAGCCATTAGAT
O70373_MOUSE/88-103 GGCGATGTTCAGTGTATGCGCTGGATCTTTGAGAACTGGCGGCTAGAT
Q91957_CHICK/805-820 GGAGATGTTGGAGGCAAAAGGTTCATATTTGAGACCTACTCTCTTGAC
Q8N1M9_HUMAN/168-183 GGGGATGTAAGAAAGGGGTGCTTTATTTTTGAGACTTTTTCTTTAGAT
Q8N1M9_HUMAN/58-73 GGGGATGTTCGTACAGCATGTTTTCTTTTTGAGACAGAAAATTTGGAC
Q91957_CHICK/697-712 GTTGATGTCAAAACTGTCCGGCACCTATTTGAGACTGAACCTTTGGGC
Q91957_CHICK/439-454 GGAGATGTGAAGCAAAGAAAGCATGTGTTTGAGACCTGTCCCCTTGGC
O70373_MOUSE/654-669 GGAGACAGGCAGACAGACAGACATGTCTTTGAGACTGAATCTCTGCCA
Q91957_CHICK/368-383 GCAGATGTCACTAAACAGCGATTACTCTTTGGGACCCAGGCCCTTGAT
Q702N8_HUMAN/340-355 CCAGATGTTCAGCAGCAGCAGCATCTGTTTGAGACCCGAGCGCTGGAC
O70373_MOUSE/336-351 CCAGATGTTCAGCATCAGCGACATCTGTTTGAAACCTGTTCCCTGGAC
Q91957_CHICK/510-525 GGCAATGTCAAAGCTAATCAAATCCTATTTGAAACTACACCCCTCTAT
Q702N7_HUMAN/439-454 GGTGCTGTAGAGTTAAATAAATCTCTCTTCGAGACAACACCACTGTAT
Q702N7_HUMAN/192-207 GGAAATGTTAAAAGAAGTATAAAATGTTTCGAAACTCAACCATTATAT
Q702N8_HUMAN/226-241 GGTGATGTGAAAAAGACAGTGAAGCTCTTCCAAACGGAGCCCCTGTGT
Q71LX6_RAT/1580-1595 GGAGATGTGCGTAATACAGTTAAAGTCTTCATGACGGAGCCCCAGAGT
Q91957_CHICK/736-751 GGGGAAGTGTCCAGAGTGAAAGAATTCTTCGAGGCTAAGCCCTTAGAT
Q702N7_HUMAN/408-423 GGAGATGTGAAGAATTACACACATATCTTTGAATCAAACAATTTAATT
O70373_MOUSE/723-738 GGCTCTGTGCATAAATTCACCTGGCTCTTTGAAAACTGTCCCATGGGC
Q91957_CHICK/143-158 GGGGATGTGAAAAGTACTTCTCTGAGGTTTGAAAACCAGTCAGTCAAC
Q6ZTR3_HUMAN/136-151 GCTGAGGCACAGTCCTGCACCTGGATGTTCAAGCCCCAACCTGTGGAC
Q91957_CHICK/126-141 GGGGACCATCAAGCCACAAAGAAGATGATGGAAGACGAGATAATTCCT