EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07981 alignment
(37 sequences with 51 bp)


Q8IJ18_PLAF7/273-289 ATGTACTTTTCTCCAGACTACACTCTACGACTCGTACAGCTACCAGGTACT
Q8IIX9_PLAF7/527-543 ATGTACTTTTCTCCAGACTACACTCTACGACTCATACAGCTACCAGGTACT
Q8IJ18_PLAF7/103-119 ATGTACTTTTCTCCAGACTACACTCTACGACTCATACAGCTACCAGGTACT
Q8IIX9_PLAF7/493-509 ATGTACGTTTCTCCAGACTACACTCTACGACTCGTACAGCTACCAGATACT
Q8IJ18_PLAF7/171-187 ATGTACGTTTCTCCAGACTACACTCTACGACTCGTACAGCTACCAGATACT
Q8IIX9_PLAF7/222-238 ATGTACTTTTCTCCAGACTACACTCTACGACTCGTACAGCTACCAGATACT
Q8IIX9_PLAF7/459-475 ATGTACTTTTCTCCAGACTACACTCTACGACTCGTACAGCTACCAGATACT
Q8IJ18_PLAF7/69-85 ATGTACTTTTCTCCAGACTACACTCTACGACTCGTACAGCTACCAGATACT
Q8IJ18_PLAF7/307-323 ATGTACTTTTCTCCAGACTACACTCTACGACTCGTACAGCTACCAGATACT
Q8IIX9_PLAF7/35-51 ATGTACTTTTCTCCAGACTACACTCTACGACTCATACAGCTACCAGATACT
Q8IIX9_PLAF7/357-373 ATGTACTTTTCTCCAGACTACACTCTACGACTCATACAGCTACCAGATACT
Q8IIX9_PLAF7/799-815 ATGTACTTTTCTCCAGACTACTCTCTACGACTCGTACAGCTACCAGATACT
Q8IIX9_PLAF7/901-917 ATGTACTTTTCTCCAGACTACTCTCTACGACTCGTACAGCTACCAGATACT
Q8IIX9_PLAF7/425-441 ATGTACTTTTCTCCAGACTACTCTCTACGACTCATGCAGCTACCAGATACT
Q8IIX9_PLAF7/289-305 ATGTACTCTTCTCCAGACTACACTCTACGACTCATACAGCTACCAGATACT
Q8IIX9_PLAF7/595-611 ATGTACTCTTCTCCAGACTACACTCTACGACTCATACAGCTACCAGATACT
Q8IIX9_PLAF7/697-713 ATGTACTCTTCTCCAGACTACACTCTACGACTCATACAGCTACCAGATACT
Q8IIX9_PLAF7/120-136 ATGTACTCTTCTCCAGACTACTCTCTACGACTCATACAGCTACCAGATACT
Q8IIX9_PLAF7/255-271 ATGTACTTTTCTCCAGACTGCACTCTACGACTCGTACAGCTACCAGATACT
Q8IIX9_PLAF7/391-407 ATGTACTTTTCTCCAGACTGCACTCTACGACTCGTACAGCTACCAGATACT
Q8IIX9_PLAF7/154-170 ATGTACGTTTCTCCAGACTGCACTCTACGACTCGTACAGCTACCAGATACT
Q8IIX9_PLAF7/629-645 ATGTACGTTTCTCCAGACTGCACTCTACGACTCGTACAGCTACCAGATACT
Q8IJ18_PLAF7/205-221 ATGTACTCTTCTCCAGACTACTCTCTACCATTCGTAGGGTTACCAGATACT
Q8IJ18_PLAF7/35-51 ATGTACTCTTCTCCAGACTACTCTCTACCATTCGTAGGGTTATCAGATACT
Q8IJ18_PLAF7/137-153 ATGTACTCTTCTCCAGACTACTCTCTACCATTCGTAGGGTTATCAGATACT
Q8IJ18_PLAF7/239-255 ATGTACTCTTCTCCAGACTACTCTCTACCATTCGTAGGGTTATCAGATACT
Q8IJ18_PLAF7/1-17 ATGTACTCTTCTCCAGACTACACTCTACCATTCGTAGGGTTATCAGATACT
Q8IIX9_PLAF7/323-339 ATGTACTTTTCTCCAGACTACTCTCTACCATTCGTAGTGTTACCAGATACT
Q8IIX9_PLAF7/1-17 ATGTACTTTTCTCCAGACTACTCTCTACCATTCGTAGGGTTACCAGATACT
Q8IIX9_PLAF7/86-102 ATGTACTTTTCTCCAGACTACACTCTACCATTCGTAGTGTTACCAGATACT
Q8IIX9_PLAF7/561-577 ATGTACTTTTCTCCAGACTACACTCTACCATTCGTAGTGTTACCAGATACT
Q8IIX9_PLAF7/765-781 ATGTACTTTTCTCCAGACTACACTCTACCATTCGTAGTGTTACCAGATACT
Q8IIX9_PLAF7/833-849 ATGTACTCTTCTCCAGGCTACACTCTACCATTCGTAGTGTTACCAGATACT
Q8IIX9_PLAF7/188-204 GTGTACTTTTCTCCAGACTGCACTCTACCATTCGTAGTGTTACCAGATACT
Q8IIX9_PLAF7/663-679 GTGTACTTTTCTCCAGACTGCACTCTACCATTCGTAGTGTTACCAGATACT
Q8IIX9_PLAF7/731-747 GTGTACTTTTCTCCAGACTGCACTCTACCATTCGTAGTGTTACCAGATACT
Q8IIX9_PLAF7/867-883 GTGTACTTTTCTCCAGACTGCACTCTACCATTCGTAGTGTTACCAGATACT