EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07834 alignment
(3 sequences with 555 bp)


Q7SYN0_BRARE/392-573 GGCAATGATGCTGAGGAAAATGGTCTAAATGGAACAAAAGATGTCATTGAAGAAAAGGAG---------GAGCCTCCCCACAGTTCTGAGCTCATGTCCTTCCTCGTCTCTCCATCAGCTGAAAAACTGATCTCACTTGGAACCAAAAGAGTTCAGCTCATTGAACAGCAGGTTGATGTTACAGATGCGAATAAGGTGTCAGAAGTTTTTCTGAAGATCTCGTCAGTATATAAAGATGAGCCAGAAGTAAAGCAAGCTGTTTTTGAGACCACTGATGCCCTGTTGAGGAAGGCCTTCTCCAACTCTCCTCACTCTCAATCTTATAGTTTTATCTCCTCTCTAATGGTGAACCTGGGACTTTTAAAGAGTGAAGATAAGAAGGTGAAGAAAGTATCTGTACTGCCTGGACATTTGCTCACATTAGAGCATGCAGTCTCACAGGAGTTTTTCCCAGCGGATCAAGCTGGAGTTCTGGAATCCTTTGTGTCACGAAATGGTGCAGTCTTAGAATCCTGCTGCAGTGCCAGAGATGCTCTCAAGATCACACTGGTGAAA
RGP1_HUMAN/404-586 GGAGAGAAGTCAGCCACGCCCTCACGGAAGATTCTGGACCCTAACACTGGGGAGCCAGCTCCCGTGCTGTCCTCCCCACCTCCTGCAGACGTCTCCACCTTCCTGGCTTTTCCCTCTCCAGAGAAGCTCCTGCGCCTAGGGCCCAAGAGCTCCGTGCTGATAGCCCAGCAGACTGACACGTCTGACCCCGAGAAGGTGGTCTCTGCCTTCCTAAAGGTGTCATCTGTGTTCAAGGACGAAGCTACTGTGAGGATGGCAGTGCAGGATGCAGTAGATGCCCTGATGCAGAAGGCTTTCAACTCCTCGTCCTTC---AACTCCAACACCTTCCTCACCAGGCTCCTCGTGCACATGGGTCTGCTCAAGAGTGAAGAC---AAGGTCAAGGCCATTGCCAACCTGTACGGCCCCCTGATGGCGCTGAACCACATGGTGCAGCAGGACTATTTCCCCAAGGCCCTTGCACCCCTGCTGCTGGCGTTCGTGACCAAGCCCAACAGCGCCCTGGAATCCTGCTCCTTCGCCCGCCACAGTCTGCTGCAGACGCTGTACAAG
RGP1_XENLA/397-579 GGAGGAGATAATGAAAACAAAGAGAAGTCCAAAGAAATTCCATGCTTAAGTGGATCAGCACCAGCTTCTCCACCTAAACTTCCTGTTGATGCATCCACCTTTCTTAGCTTTCCTTCCCCAGAGAAACTTGTGCGCATGGGTCCTAGACGTTCTGCAATGATAGCACAACAGGTCAATGTTGCAGATACAGAAAAGGTGGTCCAAGCTTTCATTCAGGTCTCCTCTGTGTATAGGGAGGATGGTGAAATAAAGGCGGCTGTTGAAGAAACTATTGATGGTTTAATGAAGGAGGCTTTTGAAAACAGAGGTTTC---CAAGCAAATGTGTTTATCACTAGTCTACTGGTGCAAATGGGACTTCTTAAGAGTGAAGAC---AAAATGAAAACAATACCACACTTAAATGGCCCTTTGCTAACTCTGAATCACATGGTACAGCAGAATTACTTCCCAAAGTCTCTTGCTTCTACTCTTCTTGCTTTCATCTCCAAGCCCAACGGTGTCCTGGAAAATAACGCCAGTGCCAGACACACATTGCTGTGCAACCTTCATAAT