EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07828 alignment
(2 sequences with 363 bp)


PA1L_PSEAE/1-121 GCTTGGAAAGGTGAGGTTCTGGCTAATAACGAAGCAGGGCAGGTAACGTCGATTATCTACAATCCGGGCGATGTCATTACCATCGTCGCCGCCGGTTGGGCCAGTTACGGACCTACCCAGAAATGGGGGCCGCAGGGCGATCGGGAGCATCCGGACCAAGGGCTGATCTGCCACGATGCGTTTTGTGGTGCGCTGGTCATGAAGATCGGCAACAGCGGAACCATTCCGGTCAATACCGGGTTGTTCCGTTGGGTTGCACCCAATAATGTCCAGGGTGCAATCACTCTTATCTACAACGACGTGCCCGGAACCTATGGCAATAACTCCGGCTCGTTCAGTGTCAATATTGGAAAGGATCAGTCC
Q7N561_PHOLL/3-117 GATTGGTCAGGAAGTGTTCCAGCTAACGCTGAAAATGGTAAATCCACAGGACTTATTCTCAAACAGGGAGATACAATCTCTGTTGTTGCTCATGGATGGGTGAAATATGGCCGTGATAATGTTGAATGGGCAGCACCTGATGGTCCTGTACCCAATAATCCA---------CAACCGTCATCAATAGCCACTCTCGTCGCTAAGATCGCCAACAAGAAGTTTGCAATTGGCAACGGAGTACTTCATAAAACGGTTCCT---------GTAGATGGCGAATTAATACTTTTATTCAATGACGTACCGGGTACTTTTGGTGATAATTCAGGTGAATTTCAAGTCGAGGTCATAATAGAGTCTCGA