EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07825 alignment
(2 sequences with 231 bp)


Q88MN8_PSEPK/2-78 TGCAAAGTCACCCTCGACGAATGGGCGCACGATCACTTCAGAACGCCGCCCAGCAGCAACACTCTTCGCCGTTGGGCCCGTGAGGGCCTGATCACCCCGGCCCCGGTAAAGCACGGTCGCAGCTACTATGTTGAGGCCGATGCCTGCTACCGGGAGCCAGAGCCGCTGCCCCGCGTTCCAGTGGGCAGTCCCCTTGTTAATCGAATTGCGAGTGCACGATATGGCGCCCAG
VXIS_LAMBD/1-72 ATGTACTTGACACTTCAGGAGTGGAACGCACGCCAG---CGACGTCCAAGAAGCCTTGAAACAGTTCGTCGATGGGTTCGGGAATGCAGGATATTCCCACCTCCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGTAAAGGTTGACTTAAATCGA------------CCAGTAACAGGTGGCCTTTTGAAGAGGATCAGAAATGGGAAGAAGGCGAAGTCA