EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07708 alignment
(11 sequences with 57 bp)


Q9GSF5_THEAN/399-417 GAAGAGTTAGATCCAGAAACTATTCCAGTGGATATAGAATCAGATGAAGAAGATGAG
Q9GSF5_THEAN/353-371 GAAGATTTAGATCCAGAAACTATTCCAGTAGAACTAGAATCAGATGAAGAAGAACTT
Q9BLN0_THEAN/217-235 ACAGAGTTAGAACCAGAAACTATTCCAGTGGAACTTGAATCAGATGATGAAGAAATT
Q9Y067_THEAN/1000-1018 CAAGAGTTAGAACCAGAAACTATTACAGTGGAACTTTCATCAGATGAAGAAGTACTT
Q9GSF5_THEAN/283-301 CAAGAGTTAGATCCAGAAACTACTGAAATGGAACTAGAATCAGATGATGAAGAAGAG
Q9GSF5_THEAN/188-206 GAAGATTTAGATCCAGAAACTATTCATTTTGAAGTTTCATCAGATGATGAAGAAGAG
Q9BLN0_THEAN/849-867 TTCACATTACAACCAGAAACTATTCATCTTGAAATTTCATCAGATGAAGAGGAACCA
Q9GSF5_THEAN/231-249 GAAGAAATAGATCCAGAAACTATTAAAGTGGAAGTAGGATCAGATGATGAAGATACT
Q9Y067_THEAN/974-992 GAACATACAAAACCAGAAACTATTACAGTGGAAATTTCATCAGATGAAGAACCTACT
Q7Z1L3_THEAN/256-274 GAAGAACTAGAACCTGAAATTTTTGAATTGGAAATATCATCAGACAGTGATATGGAT
Q9Y067_THEAN/906-924 GAACCGACTGAACCAGAAACTATTACACTGGATTTGTTATCAAGTCATGATGAAGAA