EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07640 alignment
(2 sequences with 108 bp)


Q7UWC5_RHOBA/27-62 TTGGCGTCTGATCAACCGCCGCTGACGCGGTACGGCTCATTCAATCAACAACCCGCGAACGCCAAAACGGCTGATTGGATGCATTGCCCAGCTTGGCAAATCCAATCC
Q7UWC0_RHOBA/14-49 ATGGCGTCGAATCAACCGCCGCTAACGCGGTGCGGCTCAATGAATCGACAGCCTGTTAGCTCGGGGTGGAAGTCCCGTGAGACCTACCATCTTTGGTCTCTACCGAGA