EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07460 alignment
(67 sequences with 42 bp)


Q9ANR6_BACMO/171-184 AAAGGTAAAAAACATAGTGAGGAGAGTAAGACTAAGTTGTCA
Q36580_NEUCR/230-243 TTTGGTAAAAAACATAGTGAAGCTACTAAGGCGTCTATGAGT
O79867_9CHLO/251-264 TTTGGAAAAAAACATTCTGAAGAGTTTAAAGCTTGGCTAAGT
SEGA_BPT4/135-148 CTAGGCAAAAAGCAGTCAGAAGAAACTAAAGCAAAACGAAAA
Q9ANR6_BACMO/143-156 TTTGGAAGAAAACATACAGAAACGACAAAGCTAAAGATTTCA
Q93L78_9BACI/150-163 GATGGAAGGAAGCACACTGAGGAAACTAAGCGAAAAATGTCT
Q02677_PODAN/233-246 TTAGGTAGAAAACATTCTGAAGAAACTCTATTAAAGATGAGT
Q84603_CHVP1/178-191 AAGGGAAAACAACTAACCGAAGAAACGAAGAAGAAAATTAGT
Q33764_ALLMA/97-110 CTTGGAAAAACACATACAGAGGAAACAAAAGCAAAAATTAGT
Q02677_PODAN/164-177 TTAGGACATAAACTAACAGAAGAAACTAAAGCTAAAATTAGT
O41133_CHVP1/148-161 ATCGGGATGACACATACCGAAGAATCAAAGAAAAAAATAAGT
Q98545_CHVP1/115-128 TTAGGAAAAACACATTCGGAGGAATACAAGAAGAAAATGAGT
Q84603_CHVP1/161-174 TTCGGCAAACATCATGATGAAGAAACAAAGAAGAAAATGAGT
Q84603_CHVP1/137-150 TTTGGAAAACAACTATCCGAAGAAACAAAGAAGAAAATGAGT
Q84603_CHVP1/113-126 ATTGGCAAACAATATGACGAAGAAACTAAGAAAAGAATGAGT
Q89820_CHVP1/118-131 TACAATAAGCATCATAGCGAAGAATCAAAAAAGAAAATAAGT
Q02674_PODAN/211-224 TACGGTAAGTTACATAGTGAAGAAACAAAGAAAAAGATAAGT
SEGC_BPT4/111-124 TACGGTAAATCTCATTCGCGTGAAACTAGATTGAAAATTAGC
Q89820_CHVP1/166-179 TATGGTAAAAAACACACAGAGGAATCTCTCAAAAAACAAAGT
Q02674_PODAN/189-202 TATGGTAAGAAACATACAGAGCAAACCTTAAAATTGATTAGT
Q36580_NEUCR/208-221 TTTGGTAAAACTCATACTGAAGAAGCACTAGGTTTAATTAGT
Q89820_CHVP1/142-155 TATGGTAAACCACAAAAAGAAGAAGTTAAGAGTAAAATAAGT
O41133_CHVP1/114-127 TATGGAAAGACACGTAATGAAACAACGAAACAGAAAATTAGT
Q93L78_9BACI/167-180 AAGGGAAGAAAAAAGACAAAAGAAACTTGTCTTAAGCTTAGT
O97286_PLAF7/295-308 AATAAATTTAAACATACAGAAAAAACCAAAAAATTATTATCC
O79867_9CHLO/210-223 ATTGGTTTTAAACACTCTGAAGAAACTAAACGTCTTTTATCC
O47567_AGRAE/191-204 TTAGGTTATAAACATACAAAAGAGACTAAAGAATTATTATCT
SEGA_BPT4/101-114 ATTGGTTATAGAGTTTCATCAGAAACCAAAGAAAAAATTTCA
Q98545_CHVP1/132-145 AAAGGAAAAATAGTTTCAAAGGATTCTAAGAAGAAAATGAGC
Q950S4_SPIPN/160-173 AAGGGGAAAAGACTTTCTCAAGAAACACGTGATAAAATGAGT
Q33764_ALLMA/138-151 TTGGGTAAACCATTATCAGATGAAATAAGAGCAAAGATGAGT
Q950L5_9FUNG/114-127 ATGGGTAAAAAACATTCTTAGGAAACTAGAATTAAAATGAGT
O79867_9CHLO/227-240 CGCGGAAAACCATTATCCGACGAAACTAAAACTAAATTAAGC
O47546_CHLEU/213-226 AAGGGGAAATCATTAAGTAATGAGACTAAACAAATATTGAGT
O03455_9CHLO/203-216 AAAGGCAAAACTGCCCCAGAAGAAACCCGTGCTCTTATGAGC
Q950P2_9FUNG/200-213 GCTGGTTATACTTTTAGTGATGAAACTAAATTAAAAATGAGT
Q33764_ALLMA/74-87 TTCGGGGTTAAAGCATCAGATGAAACAAAGGCAAAGATGAGT
Q33762_ALLMA/199-212 TTTGGTAAAAGTCACACAGATGAGGCGAAAGCCAAAATCAGT
Q33762_ALLMA/175-188 GCTGGGTATAAGCACACAGATGAGGCGAAAGCCAAAATGAGT
Q02674_PODAN/164-177 GAAGGATATAAGCATACAGATGAAGCTAAGTTAAAAATGTTA
Q8SHQ1_TRIRE/105-118 AAAGGTTATAAACCTACTCTTGAATCTAGAGAGAAGATGAGA
Q36580_NEUCR/183-196 TTAGGTTATAAACATACAGAAGAAGCAAGATTAAAGATGGTT
Q02671_PODAN/138-151 CTTGGTTATAAACATACTGAGGAAGATAAAGAAAAAATGAGA
O47546_CHLEU/184-197 TTGGGTTATAAACATACAGAAGAAACGAAGAATTTTATGAAA
O03455_9CHLO/174-187 TTAGGGTATAAACATACAGTAGAAACTCGTAATAAAATGAAG
Q02681_PODAN/184-197 TTTGGTTACAAACACACTGAGATTGATCGTCAAAAGATGAAA
Q93L75_9BACI/129-142 TTTGGAAGACGACATTCTGAGAAAACAAAAATGATTATTTCT
Q02677_PODAN/216-229 TTTGGTAAAACCCATTCTGAAAAAACTAAAGAGTTAATGGGA
Q02677_PODAN/192-205 TATGGTCGCACTCATTCTGAAGAAACTAAAGCACTCATGGCT
O47567_AGRAE/208-221 ACAAACAGAACACATAGTGAAGTAACTAAAGGTTTAATAGCA
Q8SHQ1_TRIRE/122-135 ACTGGAAGAAAGCATAGTGATGAAGTAAAAGATCTTATGAGT
MOBC_BPT4/101-114 CGTGGCGCAAAAAGAAGCGATAAAACTAAGAAGCTAATGAGC
Q9ANR6_BACMO/198-211 TATGGAAAAACACACAGTGATGAATTTAAGACTTATATGTCT
Q98545_CHVP1/92-105 ACTAATGGGAAACGGTCAGAAGAAACGAAGAGAAAGATTGGT
Q84603_CHVP1/96-109 AAACACGGAAGTTTGAGCGAGGAAACGAAGAAGAAAATTAGC
Q89820_CHVP1/91-104 AGTAGGGGTAAGTTTAGTGAAGAATCAAAGCAAAAAATGAGT
O41133_CHVP1/90-103 TCTAATGGTCGGCGGAGCGAAATCACAAAACAACGGATGAGT
TEV1_BPT4/178-191 TTTAATCATAAGCATTCAGACATAACTAAATCTAAAATATCA
TEV2_BPT4/106-119 AACAAATATCCGGATTCAGAAGAACATAAGCAAAAACTTAGT
Q8SHQ1_TRIRE/146-159 TATAACAAAAAGCATACTGCTGAGAATATAGAAAAATTCAGA
SEGB_BPT4/157-170 CTAAATAAGCATCATACTCCTGAAACTATTAATAAAATGAAA
Q02681_PODAN/213-226 AAAGATAAAAAGCTTTCTCCTGAAACCATAGAAAAAATAAGA
Q9SSB2_ARATH/124-137 AAAGGCAGGAAGCATAGTCCAGAGACCCTACAGAAGATTAGA
Q9MAH6_ARATH/113-126 AAAGGAAGGAAACACAGTGAAGACACTCGAAGACGAATCAAG
TEV1_BPT4/109-122 ATTATTAAGAAACGTTCTGAAACTGTTAAAGCTAAGATGCTT
Q93L78_9BACI/108-121 TTTGGGAAGACTCATTCAGAGGCGGTTAGACGTAACTCATCC
O41133_CHVP1/131-144 ACTGGACGGGTGCTTACCGAAGACCACAAGAAGAAAATTGGC