EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07350 alignment
(2 sequences with 1263 bp)


YBIU_ECOLI/2-421 GCTTCTACTTTTACCAGCGACACATTGCCTGCCGATCACAAAGCAGCTATCCGTCAGATGAAGCACGCGCTGCGGGCGCAGCTTGGCGACGTCCAGCAGATCTTTAATCAGCTAAGCGATGACATTGCCACGCGAGTGGCTGAAATCAACGCACTCAAAGCACAGGGCGATGCCGTCTGGCCGGTGCTGTCTTATGCCGATATCAAAGCAGGTCATGTTACTGCAGAGCAGCGCGAACAGATTAAACGTCGCGGTTGTGCGGTGATAAAAGGCCATTTCCCCCGCGAACAAGCGCTAGGCTGGGATCAGTCGATGCTGGACTATCTGGACCGCAACCGCTTTGACGAGGTCTACAAAGGCCCCGGC---GATAATTTCTTCGGGACGCTCAGCGCTTCACGTCCCGAGATTTACCCCATCTACTGGTCGCAGGCGCAAATGCAGGCCCGCCAGAGTGAAGAAATGGCGAATGCGCAGTCGTTTCTCAATCGTCTGTGGACATTTGAAAGTGATGGAAAGCAATGGTTTAACCCGGATGTGAGCGTCATCTACCCTGACCGTATCCGCCGCCGTCCGCCCGGAACGACCTCCAAAGGTCTTGGAGCGCATACCGACTCCGGGGCACTGGAACGCTGGCTGCTTCCAGCGTATCAGCGCGTTTTCGCCAACGTCTTTAATGGCAATCTGGCGCAATATGATCCCTGGCATGCGGCACATCGTACGGAAGTTGAAGAGTACACGGTGGACAACACCACCAAATGTTCCGTGTTTCGGACATTCCAGGGCTGGACAGCGCTCTCTGATATGCTGCCTGGTCAGGGGCTGCTGCACGTCGTGCCCATTCCTGAAGCTATGGCGTACGTACTGTTACGTCCGCTGCTTGATGATGTGCCGGAGGATGAACTGTGCGGCGTAGCGCCCGGAAGAGTATTGCCGGTATCAGAGCAATGGCATCCACTGTTGATTGAGGCGTTAACCAGCATTCCAAAACTCGAAGCCGGAGACTCCGTCTGGTGGCACTGCGACGTCATCCATTCCGTTGCCCCCGTTGAAAATCAACAAGGTTGGGGCAACGTGATGTACATTCCTGCGGCACCGATGTGCGAGAAAAATCTTGCCTACGCGCACAAGGTGAAGGCCGCACTGGAAAAAGGCGCATCGCCGGGCGACTTCCCGCGCGAGGACTATGAAACAAACTGGGAAGGACGCTTTACGCTTGCCGACCTCAACATTCACGGTAAGCGAGCGTTGGGCATGGATGTT
Q8ZCK7_YERPE/1-415 ATGGCTTCATTACACATAGACGATATCCCTGCG------------GCCATTAAAGCGGTCAAACAACAATTACGCCAGGCGCTCCCTGACTATCAACAAGTCTTTCAAGCCGTTGAAGAGAATATCCGCCAGCAAGTCATGGAGATCCGTCGTAATCTGGCCGAAGGTAAAAACCCGGTCCCACAACTCCATGCCGATGATATTATCAACGGTAAGGTGACTGAAGAACAAAAAGCGCAAATAAAACAACGCGGCTGTTGTGCCATTCTCGGGGTATTTCCGCAGGAAAAAGCCACCGCATGGAACCGTGAAATTGGCGACTATCTGGATCGTAACAACTTTGTCGAACGCTTGAAAAATGCGGCCGAAGACAATTATTTTGGCACGCTGGCGGCCAGTAAACCTCAGATTTATGGCATTTACTGGTCAACGCCACAGGTCGAAGCCCGTCAGGATAAGCGCATGCAGGCAGTGCAAATATTCTTAAATAACCTGTGGCAAACCGAAAGCAACGGTAAGCAACATTTTGATGCTAACCGTGTCGTCACCTATGCTGACCGCACACGCCGCCGCCCACCAAAATCCTCTTCACTCGGCCTCTCTCCTCATGTGGATGGCGGTTCGATTGAACGCTGGCTGGATGAGAATTTCCGCCATGTTTACCGCCATGTGTTCTCCGGTCAATGGCAAAAATATGATCCTTTCGCCGCTGAGGGCCGCCCGGAAGTCCGTGAATTCCCC------TCACCGGCGGTGTGTTCGATGTTCCGCACCTTCCAGGGATGGACCGCACTGACCCCACAGCGGACCCATGCCGGAACCTTAAATGTTATTCCGATTGCTAATGCAATGGCTTACATATTACTGCGGGCCTTACAGGACGATGTCGCTGACGACGATTTGTGTGGCGCTGCACCCGGCCGTGCGTTATCAGCTTCTGAACAGTGGCATCCTCTTTTAATGGAAGCTATTTCCCCTATTCCAGATTTAGAGGCGGGTGATACGGTCTTTTGGCACTGTGATGTGATCCATTCAGTAGAGAATGAACATAATGGTGAGTTTGATAGTAACGTGATGTATATCGCTGCAGCGCCGTGGTGTGAAAAAAATGCGGCCTATTTGCCCCGCCAGTTAGCCAGCTTTATTGATGGCCGTTCACCACCAGACTTTGCCGCGGATGATTTCGAGGTGGACTTTATTGGCAGAGCCACCATCAAAAACCTCACTGAGATAGGTAAACAGCAGTTGGGCATAACAGAC